Methylation markers for auxiliary diagnosis of gastric cancer and their applications

Abstract

The present invention discloses a methylation marker for auxiliary diagnosis of gastric cancer and its application, wherein the methylation marker is a sequence shown in SEQ ID NO: 1 or a sequence having more than 90% similarity with SEQ ID NO: 1. The present invention can quickly provide more accurate test results to clinicians by detecting the methylation level of the methylation marker in the DNA of the sample to be tested, which is helpful to improve the detection rate of early gastric cancer, and can also help monitor the disease status, reflect the therapeutic efficacy and detect cancer recurrence at an early stage, thereby improving the patient's prognosis and treatment effect.

Description

Technical Field

[0001] The present invention belongs to the field of biomedical detection technology, and more specifically, the present invention relates to a methylation marker for auxiliary diagnosis of gastric cancer, a kit for auxiliary diagnosis of gastric cancer, and a method for detecting the methylation level of a methylation marker. Background Art

[0002] Gastric cancer refers to an epithelial malignant tumor that originates in the stomach. According to the latest data from China in 2020, the incidence and mortality of gastric cancer ranked third among all malignant tumors. There are about 1.2 million new cases of gastric cancer worldwide each year, of which China accounts for about 40%. The proportion of early gastric cancer in my country is very low, only about 20%, and most of them are already in the advanced stage when they are discovered, with an overall 5-year survival rate of less than 50%.

[0003] Among the malignant tumors of the stomach, adenocarcinoma accounts for 95%, which is also the most common digestive tract malignant tumor, and even ranks among the top of all human malignant tumors. Early gastric cancer is often asymptomatic or has only mild symptoms. When clinical symptoms are obvious, the disease is already in the late stage. Therefore, early detection, early intervention, and early treatment of gastric cancer are very important.

[0004] Traditional gastric cancer screening techniques include serological examinations, imaging examinations, pathological examinations, and endoscopic examinations. Commonly used serological examination indicators include gastric function tests (PGⅠ, PGⅡ, PGⅠ / PGⅡ), G-17, Helicobacter pylori (Hp) antibodies, and tumor markers (CEA, CA199, AFP, CA724, CA125, etc.). Although tumor marker detection is simple and easy, its sensitivity and specificity are limited, and false positive or false negative results are prone to occur. It cannot be used alone for the diagnosis of gastric cancer. Imaging examinations include X-ray gas barium double contrast angiography, ultrasound examination (US), CT, MRI, positron emission tomography (PET-CT), etc. CT examinations have low sensitivity for early gastric cancer; MRI is expensive and highly dependent on equipment; PET-CT is expensive, has limited diagnostic value for early gastric cancer, and may be insensitive to certain types of gastric cancer (such as signet ring cell carcinoma). Pathological examination refers to the use of endoscopic biopsy to examine the lesion site and pathological examination to determine whether the lesion is cancer, the degree of differentiation of the tumor, and the expression of special molecules. This examination method is invasive and may cause discomfort to the patient, and patient compliance is low. Gastroscopy and endoscopic biopsy are currently the gold standard for diagnosing gastric cancer. Commonly used gastroscopy techniques include ordinary white light endoscopy, chemical staining endoscopy, electronic staining endoscopy, magnifying endoscopy, and endoscopic ultrasound (EUS). Endoscopic examination can determine the location of the tumor and obtain tissue specimens for pathological examination, but endoscopic examination is invasive, may cause discomfort to the patient, and requires high skills and experience from the operator.

[0005] In recent years, gene methylation detection has attracted attention from the medical community as a new means of screening for early gastric cancer. Methylation refers to the methylation of the fifth carbon atom of cytosine through the action of DNA methyltransferase, thereby producing 5-methylcytosine. Many reports have confirmed that host DNA methylation is related to the occurrence and development of cancer, and the degree of methylation changes in CpG sites in different regions is one of the prerequisites for gene dysfunction, which is mainly manifested as high methylation of CpG islands in the promoter region and low methylation of the whole genome. Both can serve as basic markers of tumor epigenetics, resulting in silencing of tumor suppressor genes and activation of oncogenes.

[0006] A large amount of existing research data shows that the methylation status and distribution of different genes vary greatly. Even for the same gene, its methylation status and distribution are not uniform. By detecting the methylation levels in different regions of the same gene, the diagnostic detection efficiency (specificity and sensitivity) of the same sample and the same tumor may be different, and it may even have no diagnostic effect on the tumor at all.

[0007] Therefore, it is very meaningful to screen a methylation marker with high specificity and sensitivity for auxiliary diagnosis of gastric cancer. Summary of the invention

[0008] Based on this, the purpose of the present invention is to provide a methylation marker for auxiliary diagnosis of gastric cancer and its application. The present invention found that there is a differential methylation interval in the first exon region of PCDHGB7 gene ch5:141417548-141417847, and the methylation level of this interval can be detected to achieve auxiliary diagnosis of gastric cancer (including well-differentiated gastric cancer, moderately differentiated gastric cancer, and poorly differentiated gastric cancer), and has good sensitivity and specificity. Therefore, it can be used as a methylation marker for auxiliary diagnosis of gastric cancer.

[0009] The specific technical solutions for achieving the above-mentioned invention objectives include the following.

[0010] In a first aspect of the present invention, a methylation marker for assisting in the diagnosis of gastric cancer is provided, wherein the methylation marker is a sequence as shown in SEQ ID NO:1 or a sequence having a similarity of more than 90% with SEQ ID NO:1.

[0011] The second aspect of the present invention provides the use of the above-mentioned methylation marker for auxiliary diagnosis of gastric cancer or its detection reagent in the preparation of a kit for auxiliary diagnosis of gastric cancer.

[0012] In a third aspect of the present invention, a kit for assisting in the diagnosis of gastric cancer is provided, wherein the kit comprises a reagent for detecting the methylation level of the above-mentioned methylation marker.

[0013] The fourth aspect of the present invention provides a method for detecting the methylation level of the methylation marker for non-disease diagnosis purposes, comprising the following steps: using the above-mentioned kit to perform enzyme digestion and fluorescent quantitative PCR amplification on the DNA of the sample to be tested, collecting the fluorescent signal, and analyzing it.

[0014] The inventors of the present invention used 38 regions of 16 genes with large methylation differences between pan-cancer tissues and corresponding normal tissues in the TCGA database as detection targets, and found that by detecting the methylation level of 299 bases in the first exon region of the PCDHGB7 gene (ch5:141417548-141417847) in gastric epithelial cells or blood samples, it is possible to identify patients with gastric cancer (including well-differentiated gastric cancer, moderately differentiated gastric cancer, and poorly differentiated gastric cancer) and precancerous lesions with high specificity and sensitivity, which has clinical diagnostic significance. Therefore, the first exon region of the PCDHGB7 gene (ch5:141417548-141417847) can be used as a methylation marker for auxiliary diagnosis of gastric cancer.

[0015] In clinical applications, by detecting the methylation level of the methylation markers in the DNA of the blood sample to be tested, more accurate test results can be quickly provided to clinical physicians, which will help improve the detection rate of early gastric cancer. It can also help monitor the disease status, reflect the efficacy of treatment and detect cancer recurrence at an early stage, thereby improving the patient's prognosis and treatment effect. DETAILED DESCRIPTION

[0016] In order to facilitate the understanding of the present invention, the present invention will be described more fully below. The present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosure of the present invention more thorough and comprehensive.

[0017] Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as those commonly understood by those skilled in the art to which the present invention belongs. The terms used in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention. The term "and / or" used in the present invention includes any and all combinations of one or more of the related listed items.

[0018] If not otherwise specified, the embodiments are all carried out according to conventional experimental conditions or the conditions recommended by the manufacturer's instructions. The raw materials and reagents used in the present invention are all commercially available, and any biological germplasm materials can be provided to the outside as scientific research. If the specific conditions are not specified, they are carried out according to conventional conditions or the conditions recommended by the manufacturer. The reagents or instruments used without indicating the manufacturer are all conventional products that can be purchased commercially. The method for calculating the methylation level is known in the art. For example, in an embodiment of detecting methylation by PCR, the methylation level ΔCt = Ct target gene - Ct internal reference gene.

[0019] As used herein, "DNA" or "DNA molecule" refers to deoxyribonucleic acid. The bases (bp) of DNA are adenine (A), guanine (G), cytosine (C) and thymine (T). DNA forms include cDNA, genomic DNA, fragmented DNA or artificially synthesized DNA. DNA can be single-stranded or double-stranded.

[0020] In some embodiments of the present invention, a methylation marker for assisting the diagnosis of gastric cancer is disclosed, wherein the methylation marker is a sequence shown in SEQ ID NO:1 or a sequence having a similarity of more than 90% to SEQ ID NO:1.

[0021] In other embodiments of the present invention, disclosed is the use of the above-mentioned methylation marker for auxiliary diagnosis of gastric cancer or its detection reagent in the preparation of a kit for auxiliary diagnosis of gastric cancer.

[0022] In other embodiments of the present invention, a kit for assisting in the diagnosis of gastric cancer is disclosed, wherein the kit comprises a reagent for detecting the methylation level of the above-mentioned methylation marker.

[0023] In some of the embodiments, the kit includes reagents used in PCR amplification method, fluorescent quantitative PCR method, digital PCR method, methylation-specific PCR, DNA methylation chip, targeted DNA methylation sequencing, liquid phase chip method, first-generation sequencing method, third-generation sequencing method, second-generation sequencing method, pyrophosphate sequencing method, bisulfite conversion sequencing method, methylation chip method, simplified bisulfite sequencing technology or a combination thereof.

[0024] In some embodiments, the reagents include primer probes for fluorescent quantitative PCR detection of methylation markers, and the primer probes are selected from any one of the following groups:

[0025] Group A: a forward primer having a sequence such as SEQ ID NO: 2 or having a similarity of 90% or more to SEQ ID NO: 2, a reverse primer having a sequence such as SEQ ID NO: 3 or having a similarity of 90% or more to SEQ ID NO: 3, and a probe having a sequence such as SEQ ID NO: 4 or having a similarity of 90% or more to SEQ ID NO: 4;

[0026] Group B: a forward primer having a sequence such as SEQ ID NO: 2 or having a similarity of 90% or more to SEQ ID NO: 2, a reverse primer having a sequence such as SEQ ID NO: 8 or having a similarity of 90% or more to SEQ ID NO: 8, and a probe having a sequence such as SEQ ID NO: 4 or having a similarity of 90% or more to SEQ ID NO: 4;

[0027] Group C: a forward primer having a sequence such as SEQ ID NO:9 or having 90% or more similarity to SEQ ID NO:9, a reverse primer having a sequence such as SEQ ID NO:10 or having 90% or more similarity to SEQ ID NO:10, and a probe having a sequence such as SEQ ID NO:11 or having 90% or more similarity to SEQ ID NO:11.

[0028] In some of the embodiments, the two ends of the probe are modified with a fluorescent quencher group and a fluorescent reporter group, respectively; and / or, the fluorescent quencher group is BHQ1 or BHQ2 or other fluorescent quencher groups known to those skilled in the art; the fluorescent reporter group is FAM, VIC, HEX or CY5 or other fluorescent reporter groups known to those skilled in the art.

[0029] In some embodiments, the reagents also include primer probes for fluorescent quantitative PCR detection of the internal reference gene GAPDH, including: a forward primer having a sequence such as SEQ ID NO: 5 or having a similarity of more than 90% to SEQ ID NO: 5, a reverse primer having a sequence such as SEQ ID NO: 6 or having a similarity of more than 90% to SEQ ID NO: 6, and a probe having a sequence such as SEQ ID NO: 7 or having a similarity of more than 90% to SEQ ID NO: 7.

[0030] In some of the embodiments, the two ends of the probe are modified with a fluorescent quencher group and a fluorescent reporter group, respectively; and / or, the fluorescent quencher group is BHQ1 or BHQ2 or other fluorescent quencher groups known to those skilled in the art; the fluorescent reporter group is FAM, VIC, HEX or CY5 or other fluorescent reporter groups known to those skilled in the art.

[0031] In some embodiments, the reagents further include a restriction enzyme reaction solution for fluorescent quantitative PCR detection of methylation markers, a DNA polymerase, and a PCR premix; the restriction enzyme reaction solution includes a methylation-sensitive restriction endonuclease and an endonuclease buffer; the PCR premix includes a PCR buffer, dNTPs, and Mg 2+ .

[0032] In some embodiments, the kit further includes a positive control and a negative control. By setting the positive control and the negative control, false negative or false positive results in the test can be effectively avoided, further ensuring the accuracy of the test.

[0033] In other embodiments of the present invention, a method for detecting the methylation level of the above-mentioned methylation marker for non-disease diagnosis purposes is disclosed, comprising the following steps: using the above-mentioned kit to detect the sample to be tested

[0034] The DNA was digested by enzymes and amplified by fluorescence quantitative PCR, and the fluorescence signals were collected and analyzed.

[0035] In some embodiments, the reaction system of the enzyme digestion and fluorescent quantitative PCR amplification reaction comprises: an enzyme digestion reaction solution, a DNA polymerase, a primer mixture, a probe mixture and a PCR premix; in the reaction system, Mg 2+ The final concentration of is 1.0mM-10.0mM; the final concentrations of the forward primer and the reverse primer are 2000nM-7000nM respectively; the final concentration of the probe is 1000nM-4000nM; and / or, the reaction procedure of the enzyme digestion and fluorescent quantitative PCR amplification reaction is: 37°C, 30 minutes, 1 cycle; 80°C, 20 minutes, 1 cycle; 95°C, 5 minutes, 1 cycle; 95°C, 10 seconds, 60°C 40 seconds, 45 cycles.

[0036] In some embodiments, the sample to be tested is blood, plasma, serum or gastric epithelial cells.

[0037] The present invention is described in detail below with reference to specific embodiments.

[0038] Example 1 Identification of gastric cancer methylation markers

[0039] The Illumina 450K methylation array level 3 data of the Cancer Genome Atlas (TCGA) database was downloaded from the UCSC Xena browser. The level 3 data had been normalized and aggregated, and the absolute methylation value was calculated from the β value of the 450K methylation array [methylation value = (β value + 0.5) × 100%].

[0040] According to the beta value with large methylation differences between pan-cancer tissues and corresponding normal tissues, the distribution of methylation sites of each gene was studied. A total of 38 regions of 16 genes (PCDHGB12, PCDHGB7, DRD5, PCDHGB6, cg14732324, WRAP73, cg06962177, SHOX2, SFRP1, NDRG4, CKNQ5, COL4A1, CLIP4, BMP3, SEPT9, SDC2) were screened as detection targets, and primer probes for amplifying detection targets and primer probes for amplifying the internal reference gene GAPDH were designed (1 forward primer, 1 reverse primer, 1 probe, see Table 1 for details).

[0041] Table 1

[0042]

[0043]

[0044]

[0045]

[0046] The primers and probes in Table 1 were used to detect the methylation levels of 60 gastric epithelial cell samples (30 control samples; 30 positive samples, including 8 well-differentiated gastric cancer samples, 12 moderately differentiated gastric cancer samples, and 10 poorly differentiated gastric cancer samples). The following steps were included:

[0047] (1) Extracting DNA from the gastric epithelial cell sample to be tested (RayBiotech Life, Inc. Nucleic Acid Extraction Kit, Catalog No. NAE-PBNA-MAG);

[0048] (2) Preparation of restriction enzyme digestion reaction solution: According to the number of samples to be tested (number of samples + positive and negative quality control), prepare the restriction enzyme digestion reaction solution (5 μL, one person) according to the instruction manual of the methylation-sensitive restriction endonuclease (HhaI, purchased from New England Biolabs, catalog number R0139S), invert to mix, and centrifuge briefly.

[0049] (3) Prepare PCR reaction solution: According to the number of samples to be tested (number of samples + positive and negative quality control), prepare PCR reaction solution (10 μL, one person), invert to mix, and centrifuge instantly. The PCR reaction solution includes: 5 μL PCR buffer, 1 μL dNTPs, 3 μL Mg 2+, forward primer (target gene to be detected and internal reference gene) 0.2 μL each, reverse primer (target gene to be detected and internal reference gene) 0.2 μL each, probe (target gene to be detected and internal reference gene) 0.1 μL each; in the PCR reaction solution, Mg 2+ The final concentration of the primer was 10.0 mM, the final concentration of the forward primer and the reverse primer were both 5000 nM, and the final concentration of the probe was 2000 nM;

[0050] (4) Place the PCR reaction tubes in order on the PCR tube rack, add 5 μL of enzyme digestion reaction solution, 10 μL of PCR reaction solution, 0.2 μL of DNA polymerase, and then add 10 μL of DNA sample to each PCR reaction tube, carefully cover the reaction tube, centrifuge instantly, remove bubbles in the reaction system, and place the PCR reaction tube into the instrument. The specific reaction system is shown in Table 2.

[0051] Table 2 Reaction system

[0052]

[0053]

[0054] (5) Open the instrument setting window, set the enzyme digestion, PCR amplification and signal collection programs, and run the programs. The enzyme digestion and amplification programs are shown in Table 3.

[0055] Table 3 Enzyme digestion and amplification procedures

[0056]

[0057] (6) Analysis of test results

[0058] The Ct values ​​of the target genes are shown in Tables 4 to 8, and the Ct value of the reference gene GAPDH is shown in Table 9.

[0059] Table 4

[0060]

[0061]

[0062] Table 5

[0063]

[0064]

[0065]

[0066] Table 6

[0067]

[0068]

[0069] Table 7

[0070]

[0071]

[0072]

[0073] Table 8

[0074]

[0075]

[0076] Table 9

[0077]

[0078]

[0079] According to Tables 4 to 9, the ΔCt values ​​(ΔCt=target gene Ct value-GAPDH Ct value) were calculated. The results showed that except for gene 2-PCDHGB7, the results of the other 15 genes had no diagnostic value (P>0.05).

[0080] For PCDHGB7, which has diagnostic value, the optimal cutoff value of the ROC curve was calculated based on SPSS15.0 software, and the optimal critical point of 8 was selected according to the Youden index. When the △Ct value test result is ≤8, the test result is judged to be positive, otherwise it is negative. The sample to be tested is positive, indicating that the possibility of malignant lesions of the gastric mucosal epithelium is increased, and the patient is advised to undergo further clinical examination in time. The specificity (cutoff value is 8, the percentage of cancer patients with methylation △Ct value less than or equal to 8), sensitivity (the percentage of normal people with methylation △Ct greater than 8), and AUC (area under the ROC curve) analysis of the △Ct value test results are shown in Table 10.

[0081] Table 10

[0082]

[0083] From the results in Table 10, it can be seen that the methylation level in gastric epithelial cells can be detected with high specificity and sensitivity by using three sets of primer probes designed for the first exon region of PCDHGB7 ch5:141417548-141417847 (299 bases, SEQ ID NO:1), and the AUC (area under the ROC curve) is greater than 0.9; while the methylation level in gastric epithelial cells is detected by using primer probes designed for other regions of the first exon region of PCDHGB7, and the specificity and sensitivity are significantly reduced, and the AUC (area under the ROC curve) is less than 0.9. Therefore, the first exon region of PCDHGB7 gene ch5:141417548-141417847 can be used as a methylation marker for auxiliary diagnosis of gastric cancer.

[0084] SEQ ID NO: 1:

[0085] AAAGAGGTAGAGAAAAGTCAAGTTGCAGTCCCACACAGAGCCTCTGGGCGCCCCGTC

[0086] GGCCAGTGCAGAGCAAGCGCTGACGCCGGGGATCCCTCAGCCTCTAGCCTGGGATTCCC

[0087] TGCGCAGCCAACAACAGAAAGAAAACCAGCTCCCACACAGAGGCTCCCGGCTGCGC

[0088] AGACCTTGCCCAGCACACCAGATTGCCAGCTCCGAGACCCGGGACTCCTCCTGTCCTGG

[0089] GCCGAATGCTCTTTTAGCGCGGTAGAGTGCACTTTCTCCAACTGGAAAAGCGGGGACCC

[0090] AGCGAGA

[0091] Example 2 Verification of the methylation markers of Example 1

[0092] This example uses 9 sets of primer probes for the PCDHGB7 gene in Table 1, and uses 100 blood samples (50 negative control samples and 50 positive samples, the positive samples include 10 well-differentiated gastric cancer samples, 19 moderately differentiated gastric cancer samples, and 21 poorly differentiated gastric cancer samples) as test samples to verify that the methylation level of the methylation marker detected in the blood sample can also be used for auxiliary diagnosis of gastric cancer. The following steps are included:

[0093] (1) Place the blood collection tube containing the blood sample in a centrifuge and centrifuge at a speed of 1350±150 rcf for 10 minutes, and carefully draw out the serum; extract the DNA of the serum sample to be tested (RayBiotech Life, Inc. Nucleic Acid Extraction Kit, Catalog No. NAE-PBNA-MAG)

[0094] (2) to (5) are the same as in Example 1 (PCDHGB7 gene detection primer probe, internal reference gene detection primer probe are shown in Table 1).

[0095] (6) Test results and analysis

[0096] The test results are shown in Table 11.

[0097] Table 11 Test results

[0098]

[0099]

[0100]

[0101] The obtained △Ct value (△Ct = target gene Ct value - GAPDH Ct value) was calculated, and the optimal cutoff value of the ROC curve was calculated based on SPSS15.0 software. The optimal critical point was selected according to the Youden index. When the △Ct value ≤ the optimal critical point of each gene, the test result was judged to be positive, otherwise it was negative. The △Ct value results were analyzed for specificity (the percentage of cancer patients with methylation △Ct values ​​less than or equal to the optimal critical point), sensitivity (the percentage of normal people with methylation △Ct greater than the optimal critical point) and AUC (area under the ROC curve) (when there is no amplification curve, the Ct value is uniformly assigned to 45 for △Ct value calculation), and the analysis results are shown in Table 12.

[0102] Table 12 Analysis results

[0103]

[0104] As can be seen from the results in Table 12, the test results for blood samples are similar to those for gastric epithelial cell samples. That is, using three sets of primer probes designed for the first exon region of PCDHGB7 ch5:141417548-141417847 (299 bases, SEQ ID NO:1) to detect the methylation level in blood samples can have both high specificity and sensitivity, and the AUC (area under the ROC curve) is greater than 0.9; while using primer probes designed for other regions of the first exon region of PCDHGB7 to detect the methylation level in blood samples, its specificity and sensitivity are significantly reduced, and the AUC (area under the ROC curve) is less than 0.9.

[0105] Based on the results of Example 1 and Example 2, detecting the methylation level of methylation markers in gastric epithelial tissue cells or blood samples can be used to assist in the diagnosis of gastric cancer with high specificity and sensitivity.

[0106] The technical features of the above-described embodiments may be arbitrarily combined. To make the description concise, not all possible combinations of the technical features in the above-described embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0107] The above-mentioned embodiments only express several implementation methods of the present invention, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. A methylation marker for assisting the diagnosis of gastric cancer, characterized in that: The methylation marker is a sequence shown in SEQ ID NO: 1 or a sequence having a similarity of more than 90% with SEQ ID NO:

1.

2. Use of the methylation marker for auxiliary diagnosis of gastric cancer or its detection reagent according to claim 1 in the preparation of a kit for auxiliary diagnosis of gastric cancer.

3. A kit for assisting in the diagnosis of gastric cancer, characterized in that: The kit comprises a reagent for detecting the methylation level of the methylation marker according to claim 1.

4. The kit for assisting in the diagnosis of gastric cancer according to claim 3, characterized in that: The kit includes reagents used in PCR amplification method, fluorescent quantitative PCR method, digital PCR method, methylation-specific PCR, DNA methylation chip, targeted DNA methylation sequencing, liquid phase chip method, first-generation sequencing method, third-generation sequencing method, second-generation sequencing method, pyrophosphate sequencing method, bisulfite conversion sequencing method, methylation chip method, simplified bisulfite sequencing technology or a combination thereof.

5. The kit for assisting in the diagnosis of gastric cancer according to claim 4, characterized in that: The reagents include primer probes for fluorescent quantitative PCR detection of methylation markers, and the primer probes are selected from any one of the following groups: Group A: a forward primer having a sequence such as SEQ ID NO: 2 or having a similarity of 90% or more to SEQ ID NO: 2, a reverse primer having a sequence such as SEQ ID NO: 3 or having a similarity of 90% or more to SEQ ID NO: 3, and a probe having a sequence such as SEQ ID NO: 4 or having a similarity of 90% or more to SEQ ID NO: 4; Group B: a forward primer having a sequence such as SEQ ID NO: 2 or having a similarity of 90% or more to SEQ ID NO: 2, a reverse primer having a sequence such as SEQ ID NO: 8 or having a similarity of 90% or more to SEQ ID NO: 8, and a probe having a sequence such as SEQ ID NO: 4 or having a similarity of 90% or more to SEQ ID NO: 4; Group C: a forward primer having a sequence such as SEQ ID NO:9 or having 90% or more similarity to SEQ ID NO:9, a reverse primer having a sequence such as SEQ ID NO:10 or having 90% or more similarity to SEQ ID NO:10, and a probe having a sequence such as SEQ ID NO:11 or having 90% or more similarity to SEQ ID NO:

11.

6. The kit for assisting in the diagnosis of gastric cancer according to claim 5, characterized in that: Also included are primer probes for fluorescent quantitative PCR detection of the internal reference gene GAPDH, including: a forward primer having a sequence such as SEQ ID NO: 5 or having a similarity of more than 90% to SEQ ID NO: 5, a reverse primer having a sequence such as SEQ ID NO: 6 or having a similarity of more than 90% to SEQ ID NO: 6, and a probe having a sequence such as SEQ ID NO: 7 or having a similarity of more than 90% to SEQ ID NO:

7.

7. The kit for assisting in the diagnosis of gastric cancer according to claim 5, characterized in that: The reagents also include enzyme digestion reaction solution, DNA polymerase and PCR premix for fluorescent quantitative PCR detection of methylation markers; the enzyme digestion reaction solution includes methylation sensitive restriction endonuclease and endonuclease buffer; the PCR premix includes PCR buffer, dNTPs and Mg 2+ .

8. A method for detecting the methylation level of the methylation marker of claim 1 for non-disease diagnosis purposes, characterized in that: The following steps are involved: The kit according to any one of claims 5 to 7 is used to perform enzyme digestion and fluorescence quantitative PCR amplification on the DNA of the sample to be tested, and the fluorescence signal is collected.

9. The method according to claim 8, characterized in that The reaction system of the enzyme digestion and fluorescent quantitative PCR amplification reaction comprises: an enzyme digestion reaction solution, a DNA polymerase, a primer mixture, a probe mixture and a PCR premix solution; in the reaction system, Mg 2+ The final concentration of is 1.0mM-10.0mM; the final concentrations of the forward primer and the reverse primer are 2000nM-7000nM respectively; the final concentration of the probe is 1000nM-4000nM; and / or, the reaction procedure of the enzyme digestion and fluorescent quantitative PCR amplification reaction is: 37°C, 30 minutes, 1 cycle; 80°C, 20 minutes, 1 cycle; 95°C, 5 minutes, 1 cycle; 95°C, 10 seconds, 60°C 40 seconds, 45 cycles.

10. The method according to claim 8, characterized in that The sample to be tested is blood, plasma, serum or gastric epithelial cells.

Images