Construction of rapid identification method for large yellow croaker wild and domesticated populations based on four general InDel loci

Abstract

The invention belongs to the technical field of fish genetic identification, discloses construction of a rapid identification method of large yellow croaker wild and domesticated populations based on four universal InDel loci, and particularly discloses a group of InDel molecular markers for identifying the large yellow croaker wild and domesticated populations, and is characterized in that the InDel molecular markers comprise InDel21-17662246, InDel21-13979637, InDel1-35741636 and InDel3-21732774. The invention provides a group of InDel molecular markers for wild and domesticated large yellow croaker populations, the InDel molecular markers are used for detecting a PCR product obtained through primer amplification, strip polymorphism can be detected through agarose gel, extra restriction enzyme digestion or complicated polyacrylamide gel electrophoresis operation is not needed, the detection time is shortened, and the detection cost is reduced. The method can rapidly and accurately realize identification of wild and domesticated populations of large yellow croakers.

Description

Technical Field

[0001] The invention belongs to the technical field of fish genetic identification, and specifically relates to the construction of a rapid identification method for wild and domesticated populations of large yellow croaker based on four universal InDel sites. Background Art

[0002] Large yellow croaker (Larimichthys crocea) belongs to the order Perciformes, family Sciaenidae, genus Larimichthys, and is one of the most important marine economic fishes in China. In recent years, due to the expansion of large yellow croaker farming and the increase in the exchange of fry between different geographical regions, the distribution of farmed populations has far exceeded that of wild populations. The release activities have improved the resource base of large yellow croaker, but have also caused problems of mixed populations and low genetic diversity.

[0003] Resequencing refers to a bioinformatics method that obtains the genome sequence information of a living organism and compares it with an existing genome to find the differences between the sequence information. A large number of single nucleotide polymorphisms (SNPs), short insertions or deletions (Short InDels), structural variations (SVs) and copy number variations (CNVs) can be obtained through genome resequencing. With the rise of the next-generation sequencing platform, its high-throughput and low-cost advantages have led more and more species to join the ranks of high-throughput sequencing. By detecting variations in species individuals or groups and building a genetic variation database for the species, it is of great significance to promote the preservation of germplasm resources and the management of gene banks. According to the different needs for obtaining the scope of genomic genetic information, it can be divided into whole genome resequencing (WGS) and reduced-representation genome sequencing (RRGS). Whole genome resequencing refers to the use of high-throughput sequencing technology to completely sequence the genome of an organism and compare it with a reference genome. This technology can be used to analyze genetic differences between individuals, find disease-related genes or gene mutation sites, and reveal genome structure. With the continuous development of high-throughput sequencing technology, WGS technology has also been widely used. The advancement of sequencing technology has strongly promoted the development of genomics, allowing complex genome sequences to be presented through accurate sequencing and precise assembly. Whole genome resequencing has gone through three stages with the development of sequencing technology, namely Sanger sequencing technology, NGS technology, and PacBio and Nanopore technology. In recent years, whole genome resequencing has gradually been applied to a variety of fish, including carp (Cyprinus carpio), Atlantic salmon (Salmo salar), and goldfish (Carassius auratus). Currently, researchers can use whole genome resequencing to analyze the population structure and population history of fish, and discover genetic differences between fish populations.

[0004] How to accurately and quickly identify wild and domesticated large yellow croaker populations is the core of large yellow croaker germplasm resource identification. In 2019, researchers used the third-generation PacBio single-molecule sequencing technology and high-throughput chromosome conformation capture technology to assemble a large yellow croaker reference genome. The highly accurate large yellow croaker reference genome provides an important genomic resource to support the identification and evaluation of large yellow croaker germplasm resources. At present, the development of genetic-specific molecular markers has been applied in large yellow croaker. In 2022, researchers developed sex-specific molecular markers for the Daiqu population of large yellow croaker through the genome between dmrt1 and cfap157, providing a powerful tool for promoting sex-controlled breeding of the Daiqu population of large yellow croaker.

[0005] In 2023, based on genome resequencing and comparison of genetic marker data of yellow croaker populations distributed in the eastern and southern coastal waters of China, it was found that climate-driven habitat changes may have occurred between the Naozhou yellow croaker and the Min-Yuedong yellow croaker populations. However, there is currently a lack of accurate and rapid identification methods for wild / domesticated yellow croaker populations. The development of accurate and rapid identification methods for wild / domesticated yellow croaker using genetic-specific markers of yellow croaker can effectively promote the distribution research of yellow croaker populations in my country. InDel is the insertion or deletion of a fragment sequence at a certain position in the genome and is one of the molecular genetic markers. Researchers screened candidate genes associated with traits through Fst scanning combined with InDel sites. Based on the InDel data set obtained by whole genome resequencing of yellow croaker populations, agarose gel electrophoresis technology can be used to more intuitively show the genetic differences between different yellow croaker populations with the naked eye, and use this as a genetic marker to construct a population identification system. Summary of the invention

[0006] The purpose of the first aspect of the present invention is to provide a set of InDel molecular markers for identifying wild and domesticated populations of large yellow croaker.

[0007] The second aspect of the present invention aims to provide a primer set for amplifying the InDel molecular marker of the first aspect of the present invention.

[0008] The third aspect of the present invention aims to provide a detection reagent, a gene chip or a kit.

[0009] The purpose of the fourth aspect of the present invention is to provide the use of the InDel molecular marker of the first aspect of the present invention, the primer set of the second aspect of the present invention or the detection reagent, gene chip or kit of the third aspect of the present invention in the identification of wild and / or domesticated samples of large yellow croaker.

[0010] The purpose of the fifth aspect of the present invention is to provide the application of the InDel molecular marker of the first aspect of the present invention, the primer set of the second aspect of the present invention or the detection reagent, gene chip or kit of the third aspect of the present invention in assisted breeding or identification of germplasm resources of large yellow croaker.

[0011] The purpose of the sixth aspect of the present invention is to provide a method for identifying wild and / or domesticated populations of large yellow croaker.

[0012] The purpose of the seventh aspect of the present invention is to provide the application of the method for identifying wild and / or domesticated large yellow croaker samples of the sixth aspect of the present invention in the identification and evaluation of large yellow croaker germplasm resources.

[0013] In order to achieve the above object, the technical solution adopted by the present invention is:

[0014] The first aspect of the present invention provides a group of InDel molecular markers for identifying wild and domesticated populations of large yellow croaker, wherein the InDel molecular markers include InDel21-17662246, InDel21-13979637, InDel1-35741636 and InDel3-21732774;

[0015] Wherein, the InDel21-17662246 is located at position 17662246 of chromosome 21 NC_040031.1 of large yellow croaker, and there is an insertion / deletion of the sequence fragment shown in SEQ ID NO: 1;

[0016] The InDel21-17662246 is located at position 17662246 of chromosome 21 NC_040031.1 of large yellow croaker, and there is an insertion / deletion of the sequence fragment shown in SEQ ID NO: 2;

[0017] The InDel1-35741636 is located at position 35741636 of chromosome 1 NC_040011.1 of large yellow croaker, and there is an insertion / deletion of the sequence fragment shown in SEQ ID NO: 3;

[0018] The InDel3-21732774 is located at position 21732774 of chromosome 3 NC_040013.1 of large yellow croaker, and there is an insertion / deletion of the sequence fragment shown in SEQ ID NO:4.

[0019] In some embodiments of the present invention, the above four InDel molecular markers are obtained by the following steps:

[0020] S1. After sequencing the whole genome of 395 wild and domesticated samples of large yellow croaker, the InDel sites with differences between wild and domesticated large yellow croaker were screened using population genetics selection signal analysis.

[0021] S2. Allele frequency calculation and chi-square test were performed based on the InDel dataset to screen candidate genes with extremely significant differences in allele frequency between wild and farmed large yellow croaker populations (P<0.001). Four large-fragment (bp>40) InDels were screened as candidate specific genetic difference sites and InDel expansion verification was performed based on agarose gel electrophoresis technology.

[0022] Based on the above screening, the four InDels were located on three different chromosomes of large yellow croaker (chromosome 1 (NC_040011.1), chromosome 3 (NC_040013.1), chromosome 21 (NC_040031.1)), and the position information is as follows: InDel21-17662246, InDel1-35741636, InDel21-13979637 and InDel3-21732774. A set of agarose gel electrophoresis primers that can be used for the identification of wild domesticated large yellow croaker samples was designed.

[0023] S3. Perform amplification experiments using the PCR reaction system to verify whether the four marker reaction systems can identify wild domesticated samples of large yellow croaker;

[0024] S4. The agarose gel electrophoresis results were compared with the results of known marker detection for accuracy and detection rate, proving that the reaction system can identify wild domesticated samples of large yellow croaker.

[0025] The second aspect of the present invention provides a primer set for amplifying a large yellow croaker genomic DNA fragment including the InDel molecular marker of the first aspect of the present invention.

[0026] In some embodiments of the present invention, the nucleotide sequence of the primer set is shown in SEQ ID NO:5 to SEQ ID NO:13.

[0027] The third aspect of the present invention provides a detection reagent, a gene chip or a kit, comprising the primer set of the second aspect of the present invention.

[0028] In some embodiments of the present invention, the kit further comprises one or more of dNTPs, polymerase (DNA polymerase and exonuclease), PCR reaction buffer, Taq, PCR stabilizer and enhancer.

[0029] The fourth aspect of the present invention provides the use of the InDel molecular marker of the first aspect of the present invention, the primer set of the second aspect of the present invention or the detection reagent, gene chip or kit of the third aspect of the present invention in the identification of wild and / or domesticated large yellow croaker samples.

[0030] The fifth aspect of the present invention provides the use of the InDel molecular marker of the first aspect of the present invention, the primer set of the second aspect of the present invention or the detection reagent, gene chip or kit of the third aspect of the present invention in assisted breeding or identification of germplasm resources of large yellow croaker.

[0031] The sixth aspect of the present invention provides a method for identifying wild and / or domesticated populations of large yellow croaker, comprising the step of using the primer set of the second aspect of the present invention or the detection reagent, gene chip or kit of the third aspect of the present invention to detect the InDel molecular marker of the first aspect of the present invention on a large yellow croaker sample to be tested.

[0032] In some embodiments of the present invention, the identification method comprises the following steps:

[0033] (1) using the DNA of the large yellow croaker sample to be tested as a template, and performing PCR amplification using the primer set of the second aspect of the present invention or the detection reagent, gene chip or kit of the third aspect of the present invention to obtain a PCR amplification product;

[0034] (2) performing gel electrophoresis on the PCR amplification product, and obtaining the genotype of the InDel molecular marker of the first aspect of the present invention in the genome of the large yellow croaker to be tested according to the amplified fragment;

[0035] (3) Analyze the frequency of the genotype of the InDel molecular marker, score it, and construct a ROC curve to determine whether the large yellow croaker population to be tested is wild large yellow croaker or domesticated large yellow croaker.

[0036] In some embodiments of the present invention, the genotype in step (2) is as follows:

[0037] The genotype of InDel21-17662246: the 316bp single band is the I / I genotype, the 316bp / 263bp two bands are the I / D genotype, and the 263bp single band is the D / D genotype;

[0038] The genotype of InDel21-13979637: the single band of 193 bp is the I / I genotype, the two bands of 193 bp / 138 bp are the I / D genotype, and the single band of 138 bp is the D / D genotype;

[0039] The genotype of InDel1-35741636: the 385bp single band is the I / I genotype, the 385bp / 332bp two bands are the I / D genotype, and the 332bp single band is the D / D genotype;

[0040] The genotype of InDel3-21732774: the single band of 263bp is I / I genotype, the two bands of 263bp / 213bp are I / D genotype, and the single band of 213bp is D / D genotype.

[0041] In some embodiments of the present invention, the scoring rules in step (3) are as follows:

[0042] When the frequency of the I / I genotype of InDel21-17662246, InDel21-13979637, InDel1-35741636 or InDel3-21732774 is greater than the D / D genotype, 1 point is given, otherwise 0 point is given.

[0043] In some embodiments of the present invention, the cut-off value of the ROC curve (i.e., the maximum value of the ROC curve sensitivity (sensitivity%) + specificity (specificity%)) is set as the discrimination threshold. When the total score of the large yellow croaker population to be tested is higher than the threshold, it is a wild large yellow croaker population, otherwise it is a domesticated large yellow croaker population.

[0044] In some embodiments of the present invention, the PCR amplification in step (1) is multiplex PCR amplification.

[0045] In some embodiments of the present invention, the reaction procedure of the PCR amplification is pre-denaturation at 92-96°C for 3-6 min; denaturation at 92-96°C for 28-35 s, annealing at 58-60°C for 30-40 s, extension at 70-72°C for 40-50 s, 32-37 cycles; extension at 70-72°C for 3-6 min.

[0046] The identification method of the present invention is based on 4 effective InDel sites, and only 2 PCR reaction systems and instant agarose gel electrophoresis are needed to realize rapid and simple identification of wild and domesticated samples of large yellow croaker. The method can be operated with simple reagents and analytical instruments, and can realize rapid and accurate identification of wild and domesticated samples of large yellow croaker. Compared with the current method for identifying large yellow croaker populations, the method is faster to operate, has lower detection requirements, and has a higher accuracy rate and extremely fast detection efficiency.

[0047] The seventh aspect of the present invention provides the application of the method for identifying wild and / or domesticated large yellow croaker samples according to the sixth aspect of the present invention in the identification and evaluation of large yellow croaker germplasm resources.

[0048] The beneficial effects of the present invention are:

[0049] The present invention provides a set of InDel molecular markers for wild and domesticated populations of large yellow croaker. The PCR products obtained by amplification using the InDel molecular marker detection primers of the present invention can be detected by using agarose gel to detect band polymorphism, without the need for additional restriction endonuclease digestion or complicated polyacrylamide gel electrophoresis operations, and can quickly and accurately achieve identification of wild and domesticated populations of large yellow croaker. The InDel molecular marker is a co-dominant marker, and has the advantages of stable amplification, high accuracy, convenient and rapid detection, etc.

[0050] The identification method provided by the present invention is a multi-site large yellow croaker wild domesticated sample identification system based on agarose gel electrophoresis technology, which is developed based on multiple DNA fragment insertion and deletion (InDel) sites screened by whole genome resequencing of large yellow croaker and selection signal analysis of population genetics. The design and detection of the method are based on PCR amplification reaction and agarose gel electrophoresis technology. The system merges 4 candidate indicator InDels into 2 PCR reactions, specifically amplifies and types the indication accuracy of the 4 sites in two groups of samples. Through agarose gel electrophoresis verification of 240 large yellow croaker samples with known typing, it is proved that the 4-site InDel markers can successfully identify the wild / domesticated classification of large yellow croaker in most samples. Compared with the current identification methods and markers, this method greatly improves the efficiency of distinguishing wild and domesticated populations of large yellow croaker, can use simple instruments and equipment for rapid and accurate genotyping, and can conveniently and efficiently realize the typing identification of large yellow croaker populations. The method has the advantages of simple operation, low cost and short time consumption, high efficiency and applicability, providing an efficient identification method for wild and domesticated populations of large yellow croaker, and providing favorable genetic resources for large yellow croaker breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0051] Figure 1 It is a partial agarose gel electrophoresis diagram of the amplification of the reaction system of two sites (D1 and D2), among which, D1: 316 / 263bp, I / I genotype is a band of 316bp, I / D genotype is two bands of 316bp / 263bp, and D / D genotype is a band of 263bp; D2: 193 / 138bp, I / I genotype is a band of 193bp, I / D genotype is two bands of 193bp / 138bp, and D / D genotype is a band of 138bp; in the figure, the values ​​corresponding to C, B, and Y are known domesticated samples of large yellow croaker, the values ​​corresponding to X are known wild samples of large yellow croaker, and M is maker.

[0052] Figure 2 The ROC curve corresponding to the rapid identification method of wild and domesticated populations of large yellow croaker based on four common InDel sites.

[0053] Figure 3 This is the agarose gel electrophoresis diagram of 30 large yellow croaker samples verified in Example 4. DETAILED DESCRIPTION

[0054] The present invention is further described in detail below through specific examples.

[0055] It should be understood that these embodiments are only used to illustrate the present invention and are not used to limit the scope of the present invention.

[0056] In order to make the purpose, technical scheme and advantages of the embodiments of the present invention clearer, the technical scheme in the embodiments of the present invention will be described clearly and completely below. If the specific conditions are not specified in the embodiments, they are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be purchased commercially.

[0057] The features and performance of the present invention are further described in detail below in conjunction with the embodiments.

[0058] Example 1

[0059] Four universal InDel sites are used to achieve rapid identification of wild and domesticated populations of large yellow croaker. The InDel sites are located on three different chromosomes of large yellow croaker (chromosome 1 (NC_040011.1), chromosome 3 (NC_040013.1) and chromosome 21 (NC_040031.1)), and the position information is as follows: InDel21-17662246 (denoted as D1), InDel21-13979637 (denoted as D2), InDel1-35741636 (denoted as D3) and InDel3-21732774 (denoted as D4).

[0060] The above four Indels were obtained through whole genome resequencing and population genetics selection signal analysis screening. The specific methods are as follows:

[0061] A total of 576.43G whole genome resequencing raw data were generated for 395 large yellow croaker individuals, with an average of 13405.42M raw data generated per sample. On this basis, a total of 574.60G filtered data were generated, with an average of 13362.97M generated per sample. 99.48% of reads were mapped to the large yellow croaker reference genome. Allele frequency calculation and chi-square test (P<0.05) were performed based on the InDel dataset. Four InDels with the highest allele frequency difference between wild large yellow croaker populations and domesticated large yellow croaker populations and passing the chi-square test were selected as candidate specific genetic difference sites and InDel expansion verification based on agarose gel electrophoresis was performed.

[0062] The specific genotypes of the four InDels are shown in Table 1 .

[0063] Table 1 Specific genotypes of the four InDels

[0064]

[0065] For InDel, In is a large fragment insertion, Del is a large fragment deletion, and the large fragment mutation information of each site is:

[0066] D1: GTTACATAACAACATGACATGAAGTATTTATAGTGATCATTTTAAACAGTTGT→G, i.e., there is a deletion or insertion of GTTACATAACAACATGACATGAAGTATTTATAGTGATCATTTTAAACAGTTGT (SEQ ID NO: 1) at position 17662246 of chromosome 21 (NC_040031.1);

[0067] D2: TTTTCTTACCTCCTTTTGTCTTTTTTTTATTATTATTTTAGTCAAAAAGGACAAA→T, i.e., there is a deletion or insertion of TTTTCTTACCTCCTTTTGTCTTTTTTTTATTATTATTTTAGTCAAAAAGGACAAA (SEQ ID NO: 2) at position 13979637 of chromosome 21 (NC_040031.1);

[0068] D3: AGCTTGCAGGCCATCCTGCTTTTTTATGGCAACAATATCCAACGCGAAAAAAT→A, i.e., there is a deletion or insertion of AGCTTGCAGGCCATCCTGCTTTTTTATGGCAACAATATCCAACGCGAAAAAAT (SEQ ID NO: 3) at position 35741636 of chromosome 1 (NC_040011.1);

[0069] D4: ACATGTGTAACCGCACGAGGAAAAGTCACCAATTCAGGCATGTGTGGCCT→A, i.e., there is a deletion or insertion of ACATGTGTAACCGCACGAGGAAAAGTCACCAATTCAGGCATGTGTGGCCT (SEQ ID NO: 4) at position 21732774 of chromosome 3 (NC_040013.1).

[0070] Corresponding amplification primer sequences were designed for the above four InDels, and the primer sequences are shown in Table 2.

[0071] Table 2 Amplification primer sequences corresponding to the four InDels

[0072]

[0073] Note: D2-R*: matches the deletion mutation sequence in the D2 primer region and needs to be added to the amplification system together with D2-R. There is no deletion mutation sequence in the primer region of the other three sites. K is a degenerate base of G / T.

[0074] Example 2

[0075] A rapid identification method for wild and domesticated populations of large yellow croaker based on four universal InDel loci comprises the following steps:

[0076] S1: Extract genomic DNA from the fin tissue of the tested large yellow croaker population using the phenol-chloroform extraction method;

[0077] S2: Construct a PCR reaction system for typing experiments, divide the four InDels into two reaction systems (D1 and D2 in one reaction system, D3 and D4 in another reaction system), the PCR reaction system is shown in Table 3, and the reaction procedure is shown in Table 4.

[0078] Table 3 PCR reaction system

[0079]

[0080] In Table 3, Primer 1mix and Primer 2mix refer to the upstream and downstream primers of D1 and D2, respectively; or the upstream and downstream primers of D3 and D4.

[0081] Table 4 PCR reaction program

[0082]

[0083] S3: Agarose gel electrophoresis detection

[0084] 1) Prepare 3% agarose gel;

[0085] 2) Add 3 μL of product or DNA marker to the gel wells; electrophoresis at 100 V for 30 min;

[0086] 3) Use gel imaging instrument to take pictures of the electrophoresis pattern.

[0087] S4: Data Analysis

[0088] The electrophoresis pattern information was organized into an excel sheet, with "I" representing insertion and "D" representing deletion. Only the upper band (i.e., 316bp, 193bp, 385bp, and 263bp in D1 to D4, respectively) was homozygous for insertion, marked as the "I / I" genotype; the double bands were heterozygous, marked as the "I / D" genotype; only the lower band (263bp, 138bp, 332bp, and 213bp) was homozygous for deletion, marked as the "D / D" genotype.

[0089] That is, D1: 316 / 263bp, the I / I genotype is one band of 316bp, the I / D genotype is two bands of 316bp / 263bp, and the D / D genotype is one band of 263bp; D2: 193 / 138bp, the I / I genotype is one band of 193bp, the I / D genotype is two bands of 193bp / 138bp, and the D / D genotype is one band of 138bp; D3: 385 / 332bp, the I / I genotype is one band of 385bp, the I / D genotype is two bands of 385bp / 332bp, and the D / D genotype is one band of 332bp; D4: 263 / 213bp, the I / I genotype is one band of 263bp, the I / D genotype is two bands of 263bp / 213bp, and the D / D genotype is one band of 213bp.

[0090] S5: Combined with the agarose gel electrophoresis verification results, the difference in allele frequencies of the above four loci between the wild population and the domesticated population of large yellow croaker was analyzed (P<0.05). Since it is impossible to effectively type the large yellow croaker population based on a single InDel locus, it is necessary to comprehensively identify the four InDel verification results. On this basis, the alleles with a higher frequency in the wild population of large yellow croaker than in the domesticated population were scored as 1 point, and the alleles with a lower frequency in the wild population of large yellow croaker than in the domesticated population were scored as 0 points. A method for distinguishing wild / domesticated samples of large yellow croaker based on the above four loci was constructed. Generally, on this basis, if a method is constructed based on x loci (x≤10), the total score of the discrimination method is 2x (number of alleles*2), and all verification samples are scored. Based on the scoring results, the total score data sets of the wild population and the domesticated population are constructed respectively, and the data sets are input into GraphPadPrism 8 to construct the receiver operating characteristic curve (ROC curve). The method is feasible when the ROC curve area (AUC) is greater than 0.9. The cut-off value is set as the discrimination threshold (the cut-off value is the maximum value of the ROC curve sensitivity (sensitivity%) + specificity (specificity%)). Samples with scores higher than the threshold are wild samples of large yellow croaker, and samples with scores lower than the threshold are domesticated samples of large yellow croaker.

[0091] Example 3

[0092] The rapid identification method of Example 2 was used to screen known wild large yellow croaker and domesticated large yellow croaker populations, with 120 wild large yellow croakers and 120 domesticated large yellow croakers respectively.

[0093] The electrophoresis diagram of PCR reaction products of some large yellow croaker samples is as follows: Figure 1 The results of the identification method based on the four InDels are shown in Figure 2As shown, the ROC curve area (AUC) constructed by the combination of 4 InDels is 0.9608, the sensitivity of the optimal threshold is 90.8% (i.e., the probability of a wild large yellow croaker being identified by this identification method is 90.8%), and the specificity is 89.2% (i.e., the probability of a domesticated large yellow croaker being excluded by this identification method is 89.2%), wherein the AUC area is greater than 0.9, which means that the method is feasible. The threshold of the total score of the identification method constructed based on the above 4 InDels is 4 points. On this basis, samples with a score greater than 4 points are identified as wild large yellow croaker samples, and samples with a score less than or equal to 4 points are identified as domesticated large yellow croaker samples. According to the actual detection situation, the large yellow croaker population can be typed by observing with the naked eye whether there are more than 4 In fragments in the 4 InDels in the agarose gel electrophoresis result diagram (more than 4 In fragments are wild large yellow croaker samples, less than or equal to 4 In fragments are domesticated large yellow croaker samples, the larger band in the same site is the In fragment, the smaller band is the Del fragment, the genotype with only large bands is counted as In / In, the genotype with only small bands is counted as Del / Del, and the presence of one large band and one small band is counted as In / Del).

[0094] In summary, the identification method constructed based on four InDels has a high discrimination rate and extremely fast discrimination efficiency, and can be applied to the rapid discrimination of wild and domesticated large yellow croaker.

[0095] Example 4

[0096] To further verify the universal applicability of the rapid identification method of wild and domesticated large yellow croaker populations based on four universal InDel sites in Example 2, 30 additional known wild / domesticated large yellow croaker samples were taken for a second round of screening. Figure 3 ) were scored, and the screening results in the wild population of yellow croaker (population size: 15) were 15 wild samples of yellow croaker and 0 domesticated samples of yellow croaker; the screening results in the domesticated population of yellow croaker (population size: 15) were 12 domesticated samples of yellow croaker and 3 wild samples of yellow croaker. This shows that the rapid identification method of wild and domesticated populations of yellow croaker based on 4 universal InDel sites in Example 2 is universal in indicating wild / domesticated samples of yellow croaker, and has a high typing accuracy rate.

[0097] The embodiments of the present invention are described in detail above in conjunction with the accompanying drawings, but the present invention is not limited to the above embodiments. Various changes can be made within the knowledge of ordinary technicians in the relevant technical field without departing from the purpose of the present invention. In addition, the embodiments of the present invention and the features in the embodiments can be combined with each other without conflict.

Claims

1. A set of InDel molecular markers for identifying wild and domesticated populations of large yellow croaker, characterized in that: The InDel molecular markers include InDel21-17662246, InDel21-13979637, InDel1-35741636 and InDel3-21732774; wherein, InDel21-17662246 is located at position 17662246 of chromosome 21 NC_040031.1 of large yellow croaker, and there is an insertion / deletion of the sequence fragment shown in SEQ ID NO: 1; The InDel21-17662246 is located at position 17662246 of chromosome 21 NC_040031.1 of large yellow croaker, and there is an insertion / deletion of the sequence fragment shown in SEQ ID NO: 2; The InDel1-35741636 is located at position 35741636 of chromosome 1 NC_040011.1 of large yellow croaker, and there is an insertion / deletion of the sequence fragment shown in SEQ ID NO: 3; The InDel3-21732774 is located at position 21732774 of chromosome 3 NC_040013.1 of large yellow croaker, and there is an insertion / deletion of the sequence fragment shown in SEQID NO:

4.

2. A primer set, which is used to amplify a large yellow croaker genomic DNA fragment containing the InDel molecular marker described in claim 1.

3. The primer set according to claim 2, characterized in that The nucleotide sequences of the primer set are shown in SEQ ID NO:5 to SEQ ID NO:

13.

4. A detection reagent, gene chip or kit, comprising the primer set according to claim 2 or 3.

5. Use of the InDel molecular marker according to claim 1, the primer set according to claim 2 or 3, or the detection reagent, gene chip or kit according to claim 4 in the identification of wild and / or domesticated populations of large yellow croaker.

6. Use of the InDel molecular marker according to claim 1, the primer set according to claim 2 or 3, or the detection reagent, gene chip or kit according to claim 4 in assisted breeding or identification of germplasm resources of large yellow croaker.

7. A method for identifying wild and / or domesticated populations of large yellow croaker, comprising the step of using the primer set described in claim 2 or 3 or the detection reagent, gene chip or kit described in claim 4 to detect the InDel molecular marker described in claim 1 on a large yellow croaker sample to be tested.

8. The identification method according to claim 7, characterized in that: The identification method comprises the following steps: (1) using the DNA of the large yellow croaker sample to be tested as a template, and performing PCR amplification using the primer set described in claim 2 or 3 or the detection reagent, gene chip or kit described in claim 4 to obtain a PCR amplification product; (2) performing gel electrophoresis on the PCR amplification product, and obtaining the genotype of the InDel molecular marker according to claim 1 in the genome of the large yellow croaker to be tested according to the amplified fragment; (3) Analyze the frequency of the genotype of the InDel molecular marker, score it, and construct a ROC curve to determine whether the large yellow croaker population to be tested is wild large yellow croaker or domesticated large yellow croaker.

9. The identification method according to claim 8, characterized in that: The genotypes in step (2) are as follows: The genotype of InDel21-17662246: the 316bp single band is the I / I genotype, the 316bp / 263bp two bands are the I / D genotype, and the 263bp single band is the D / D genotype; The genotype of InDel21-13979637: the single band of 193 bp is the I / I genotype, the two bands of 193 bp / 138 bp are the I / D genotype, and the single band of 138 bp is the D / D genotype; The genotype of InDel1-35741636: the 385bp single band is the I / I genotype, the 385bp / 332bp two bands are the I / D genotype, and the 332bp single band is the D / D genotype; The genotype of InDel3-21732774: the single band of 263 bp is the I / I genotype, the two bands of 263 bp / 213 bp are the I / D genotype, and the single band of 213 bp is the D / D genotype; Preferably, the scoring rules in step (3) are as follows: When the frequency of the I / I genotype of InDel21-17662246, InDel21-13979637, InDel1-35741636 or InDel3-21732774 is greater than the D / D genotype, a score of 1 is given, otherwise a score of 0 is given; Preferably, the cut-off value of the ROC curve is set as the discrimination threshold. When the total score of the large yellow croaker population to be tested is higher than the threshold, it is a wild large yellow croaker population, otherwise it is a domesticated large yellow croaker population.

10. Use of the identification method according to any one of claims 7 to 9 in the identification and evaluation of large yellow croaker germplasm resources.

Images