Molecular marker and identification method for identifying milkvetch root in genuine production area and non-genuine production area

Abstract

The invention provides a molecular marker for identifying milkvetch roots in a genuine production area and a non-genuine production area and an identification method. The molecular marker contains a nucleotide sequence of which the polymorphism at the 131 bp position of the fifth exon of an astragalus membranaceus genome Am02G035490 is A / T, wherein the 131 bp position is shown in SEQ ID NO: 1. The invention also provides a method for identifying the genuine Astragalus root production area by using the SNP molecular marker, and a technical guarantee is provided for accurate tracing and stable quality of the genuine Astragalus root production area and healthy and ordered development of the Astragalus root industry.

Description

Technical Field

[0001] The invention relates to the field of molecular biology, in particular to a molecular marker and an identification method for identifying astragalus from authentic and non-authentic production areas. Background Art

[0002] Astragalus Astragali Radix Astragalus mongolicus is a traditional Chinese medicinal material in my country. It is a perennial herb of the genus Astragalus in the Leguminosae family. Astragalus membranaceus var. mongholicus Astragalus membranaceus A . membranaceus The dried root of Astragalus membranaceus. It has a long history of medicinal use, first recorded in "Fifty-two Prescriptions for Diseases", and has a medicinal history of more than 2,000 years. It is known as "the best tonic", "the holy medicine for replenishing qi", and "nine out of ten medicines are Astragalus membranaceus". As the market demand for Astragalus membranaceus gradually increases, wild Astragalus membranaceus can no longer meet the demand. Since the 1950s, my country has begun to cultivate Astragalus membranaceus on a large scale. In the process of artificial cultivation of Astragalus membranaceus, there is a phenomenon of blind introduction of species, and it is common to allocate seeds and seedlings across provinces and regions, which leads to mixed germplasm and uneven quality of medicinal materials. In addition, the phenomenon of counterfeiting and selling inferior medicinal materials as good ones also occurs frequently. Whether the Astragalus membranaceus is produced in an authentic production area directly affects its use value and economic value.

[0003] It is generally believed that Shanxi (Taihang Mountains) and Inner Mongolia (Yinshan Mountains) are the authentic production areas of Astragalus. However, due to the relatively complex historical changes in Astragalus varieties and authentic production areas, coupled with the phenomenon of mixed provenances caused by disorderly introduction over the years, it is difficult to identify the origin of Astragalus.

[0004] At present, the origin identification technology of Astragalus membranaceus is still based on the traditional "identifying appearance and judging quality". Molecular marker technologies such as AFLP, RAPD, ISSR, SCoT, SCAR, and DNA barcoding are also often used for the germplasm identification of authentic medicinal materials.

[0005] The traditional "identification by appearance and quality" requires high experience of identification personnel and has a certain degree of subjectivity. Molecular marker technologies such as AFLP, RAPD, ISSR, SCoT, SCAR, and DNA barcodes have problems such as poor repeatability, insufficient accuracy, and low efficiency. Summary of the invention

[0006] The purpose of the present invention is to provide a molecular marker and an identification method for identifying astragalus from authentic and non-authentic production areas.

[0007] In order to achieve the purpose of the present invention, in a first aspect, the present invention provides a molecular marker for identifying Astragalus from authentic and non-authentic production areas, wherein the molecular marker comprises a nucleotide sequence (n is a or t) with a polymorphism of A / T at the 131 bp of the 5th exon of Am02G035490 of the Astragalus genome as shown in SEQ ID NO:1.

[0008] In the present invention, the reference genome is the first version of the Astragalus mongolica genome (http: / / www.gpgenome.com / species / 109).

[0009] Furthermore, the nucleotide at the 131st bp is A, and the corresponding Astragalus comes from the authentic production area; the nucleotide at the 131st bp is T, and the corresponding Astragalus comes from the non-authentic production area.

[0010] In a second aspect, the present invention provides a pair of primers for amplifying the molecular marker, comprising an upstream primer as shown in SEQ ID NO:2 and a downstream primer as shown in SEQ ID NO:3.

[0011] In a third aspect, the present invention provides a detection reagent or a kit containing the primers.

[0012] In a fourth aspect, the present invention provides a method for identifying astragalus from authentic and non-authentic production areas, comprising: using the DNA of the astragalus sample to be tested as a template, using the primers shown in SEQ ID NO:2-3 or a detection reagent or kit containing the primers to perform PCR amplification, and judging the source of the astragalus sample to be tested based on the amplification result.

[0013] Preferably, the system used for PCR amplification includes: 1 μL of DNA template, 10 μL of 2×M5 HiPer plus Taq HiFiPCR mix, 1 μL each of 10 μM upstream and downstream primers, and ddH2O added to 20 μL.

[0014] Preferably, the reaction program used for PCR amplification is: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 40 s, annealing at 55°C for 20 s, extension at 72°C for 2 min, for a total of 35 cycles; extension at 72°C for 10 min.

[0015] Furthermore, judging the source of the astragalus sample to be tested according to the amplification result includes: analyzing the polymorphic sites contained in the molecular markers in the amplified product, and if the nucleotide at the 131st bp of the amplified product is A, the astragalus to be tested is derived from an authentic production area; if the nucleotide at the 131st bp of the amplified product is T, the astragalus to be tested is derived from a non-authentic production area.

[0016] By means of the above technical solution, the present invention has at least the following advantages and beneficial effects: (I) The present invention provides a method for identifying the authentic production area of ​​Astragalus membranaceus using SNP molecular markers. This method can be used to identify a small amount of leaves (100 mg) without causing damage to the plant. At the same time, this method is not limited to living samples, but can also be applied to dried Astragalus membranaceus roots on the market. This provides technical support for the accurate traceability of the authentic production area of ​​Astragalus membranaceus, stable quality, and the healthy and orderly development of the Astragalus membranaceus industry.

[0017] (ii) There are a large number of DNA sequence variations in the genome. Compared with other molecular markers, the third-generation molecular marker SNP developed based on this has the characteristics of large number, wide distribution, stable variation, bi-allelic variation and easy automated analysis.

[0018] (III) This method only needs a pair of primers for PCR amplification to identify whether it is authentically produced Astragalus. Ordinary PCR reagents can meet the amplification requirements, and no expensive high-fidelity enzymes are required. In addition, the simple and fast first-generation sequencing technology - Sanger sequencing is used for detection, and the test results are clear and easy to read. The entire identification process is fast, simple and safer for the environment and the human body. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 This is a sequence alignment of the SEQ ID NO: 1 interval of samples from authentic and non-authentic production areas of Astragalus membranaceus in the resequencing in a preferred embodiment of the present invention; wherein: NoDaoDi is the sequence of all non-authentic production area samples in the SEQ ID NO: 1 interval, and DaoDi is the sequence of all authentic production area samples in the SEQ ID NO: 1 interval.

[0020] Figure 2 It is the result of first-generation Sanger sequencing of samples from authentic and non-authentic production areas of Astragalus membranaceus in a preferred embodiment of the present invention after being amplified by the upstream primer shown in SEQ ID NO: 2 and the downstream primer shown in SEQ ID NO: 3. DETAILED DESCRIPTION

[0021] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are all commercially available products.

[0022] The authentic production areas of Astragalus membranaceus involved in the following embodiments include Hunyuan County, Ying County, Fanshi County, Wutai County of Shanxi Province and Guyang County, Wuchuan County, Urad Front Banner, Fengzhen City, Liangcheng County of Inner Mongolia Autonomous Region, and non-authentic production areas of Astragalus membranaceus include Tahe County, Huma County, Songling District of Heilongjiang Province, Dangchang County, Qingshui County, Zhang County of Gansu Province, etc. (as shown in Table 1 and Table 2).

[0023] Table 1 Authentic and non-authentic production areas of Astragalus

[0024] Table 2 Authentic and non-authentic production areas of Astragalus

[0025] Example 1 By analyzing the genome resequencing data of 202 representative wild astragalus samples from the distribution areas of astragalus in China, it was found that there was an A / T base transversion in the exon region of Am02G035490 in both the authentic production areas and the non-authentic production areas. Primers were designed based on this SNP site, the nucleotide sequence of the upstream primer is shown in SEQ ID NO:2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO:3, which are used for molecular marker-assisted selection of germplasm from authentic production areas of astragalus.

[0026] This embodiment provides a method for identifying the authentic production area of ​​Astragalus membranaceus using the SNP molecular marker, which is located at the 131 bp position in the 5th exon region of Am02G035490 as shown in SEQ ID NO: 1, and the polymorphism is A / T (n is a or t). For the convenience of description, the present invention names this SNP molecular marker in the 5th exon region of Am02G035490 as DD-SNP.

[0027] Further, the method comprises: The optimized improved CTAB method is used to extract the genomic DNA of Astragalus as a template; PCR amplification is performed with the upstream primer shown in SEQ ID NO:2 and the downstream primer shown in SEQ ID NO:3, and the PCR amplification product is subjected to first-generation Sanger sequencing detection; according to the base type of the site in the Sanger sequencing detection result, it is judged whether the Astragalus to be identified is the Astragalus from the authentic production area: if the 131 bp of the sequence shown in SEQ ID NO:1 as the result of the Sanger sequencing detection is A, the Astragalus to be identified is from the authentic production area; if the 131 bp of the sequence shown in SEQ ID NO:1 as the result of the Sanger sequencing detection is T, the Astragalus to be identified is from a non-authentic production area ( Figure 1 and Figure 2 ).

[0028] Preferably, the PCR amplification system comprises: DNA template, 1 μL; 2×M5 HiPer plus Taq HiFiPCR mix, 10 μL; 10 μM upstream and downstream primers, 1 μL each; ddH2O added to 20 μL.

[0029] Preferably, the reaction conditions for the PCR amplification are: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 40 s, annealing at 55°C for 20 s, extension at 72°C for 2 min, for a total of 35 cycles; extension at 72°C for 10 min.

[0030] The primer sequences are as follows (5'-3'): Upstream primer: TCACGCTTTAGTCGCTTTCAC (SEQ ID NO: 2) Downstream primer: CAACAACGAAGGCTGAGAGTG (SEQ ID NO: 3) The PCR product is subjected to Sanger sequencing detection. According to the result of Sanger sequencing detection, the base at the 131 bp position can be directly judged whether the Astragalus germplasm is derived from the authentic production area: if the base at the 131 bp position of the Sanger sequencing detection result is A, the Astragalus to be identified is derived from the authentic production area; if the base at the 131 bp position is T, the Astragalus to be identified is derived from a non-authentic production area.

[0031] Although the present invention has been described in detail above with general descriptions and specific embodiments, it is obvious to those skilled in the art that some modifications or improvements can be made on the basis of the present invention. Therefore, these modifications or improvements made on the basis of not departing from the spirit of the present invention all belong to the scope of protection claimed by the present invention.

Claims

1. A molecular marker for identifying Astragalus from authentic and non-authentic production areas, characterized in that: The molecular marker contains a nucleotide sequence of A / T at the 131 bp position of the 5th exon of Am02G035490 of the Astragalus genome, as shown in SEQ ID NO:

1.

2. The molecular marker according to claim 1, characterized in that The nucleotide at the 131st bp is A, and the corresponding Astragalus comes from the authentic production area; the nucleotide at the 131st bp is T, and the corresponding Astragalus comes from the non-authentic production area.

3. A primer for amplifying the molecular marker according to claim 1 or 2, characterized in that: It includes an upstream primer as shown in SEQ ID NO:2 and a downstream primer as shown in SEQ ID NO:

3.

4. A detection reagent or kit containing the primers according to claim 3.

5. A method for identifying authentic and non-authentic Astragalus membranaceus production areas, characterized in that: include: The DNA of the astragalus sample to be tested is used as a template, and PCR amplification is performed using the primers described in claim 3 or the detection reagent or kit described in claim 4, and the source of the astragalus sample to be tested is determined according to the amplification result.

6. The method according to claim 5, characterized in that The system used for PCR amplification included: 1 μL of DNA template, 10 μL of 2×M5 HiPer plus Taq HiFi PCR mix, 1 μL each of 10 μM upstream and downstream primers, and ddH2O added to 20 μL.

7. The method according to claim 6, characterized in that The reaction program used for PCR amplification was as follows: pre-denaturation at 95 °C for 5 min; denaturation at 95 °C for 40 s, annealing at 55 °C for 20 s, and extension at 72 °C for 2 min, for a total of 35 cycles; and extension at 72 °C for 10 min.

8. The method according to claim 6 or 7, characterized in that: Judging the source of the astragalus sample to be tested according to the amplification result includes: analyzing the polymorphic sites contained in the molecular markers in the amplified product, and if the nucleotide at the 131st bp of the amplified product is A, the astragalus to be tested is derived from an authentic production area; if the nucleotide at the 131st bp of the amplified product is T, the astragalus to be tested is derived from a non-authentic production area.

Images