Sugarcane smut monitoring and early warning method based on soil bacterial source detection

Abstract

The invention discloses a sugarcane smut monitoring and early warning method based on soil bacterial source detection, and relates to the technical field of sugarcane disease prevention and control. The method comprises the following steps: (1) collecting soil of a sugarcane field, extracting soil DNA by using a soil DNA extraction kit, and carrying out fluorescent quantitative PCR detection by using a primer pair SEQ ID NO.2 and SEQ ID NO.3 to obtain the copy number of sugarcane smut bacteria in the soil; and (2) judging the severity of the sugarcane smut according to the copy number of the sugarcane smut bacteria, and dividing the severity of the sugarcane smut into four grades from low to high for early warning. According to the method, the sugarcane smut is subjected to severity grading according to the number of the sugarcane smut bacteria in the soil of the sugarcane field, so that the purposes of monitoring the sugarcane smut of the ratoon sugarcane and giving out early warning are achieved, and a scientific basis is provided for prevention and control of the sugarcane smut of the ratoon sugarcane.

Description

Technical Field

[0001] The invention relates to the technical field of sugarcane disease prevention and control, and in particular to a sugarcane smut monitoring and early warning method based on soil bacteria source detection. Background Art

[0002] Sugarcane smut is the most threatening disease in my country's sugarcane areas. The average incidence of smut in the main sugarcane varieties GT42 and 05-136 ratoon cane in my country's sugarcane areas has reached 50%, and in some fields it is as high as more than 90%, seriously affecting the quality and yield of sugarcane. At present, due to the lack of a monitoring and early warning system for sugarcane smut, it is impossible to monitor and issue early warnings for the disease in a timely manner, making it difficult to prevent and control the disease; in addition, the sugarcane varieties in my country's sugarcane areas are relatively single, lack disease-resistant varieties, and are planted year after year, and the bacterial source accumulates over the years, making sugarcane smut, especially ratoon cane sugarcane smut, worsen year by year. Monitoring and early warning of sugarcane smut is a prerequisite and key link for the prevention and control of sugarcane smut, especially ratoon cane sugarcane smut. At present, there is no report on the monitoring and early warning system for sugarcane smut. Therefore, it is necessary to establish a monitoring and early warning system for sugarcane smut, monitor and issue early warnings for sugarcane smut, and provide a scientific basis for the prevention and control of ratoon cane sugarcane smut. Summary of the invention

[0003] The purpose of the present invention is to solve the above problems existing in the prior art and provide a method for monitoring and early warning of sugarcane smut based on soil bacterial source detection. The present invention classifies the severity of sugarcane smut according to the relationship between the number of sugarcane smut fungi in the soil of the sugarcane field and the incidence of sugarcane smut, thereby achieving the purpose of monitoring and issuing early warnings for sugarcane smut in ratoon sugarcane and providing a scientific basis for the prevention and control of sugarcane smut in ratoon sugarcane.

[0004] To achieve the above object, the present invention provides the following technical solutions:

[0005] A sugarcane smut monitoring and early warning method based on soil bacteria source detection comprises the following steps:

[0006] (1) Soil detection of sugarcane smut pathogen

[0007] Soil from the sugarcane field was collected, soil DNA was extracted using a soil DNA extraction kit, and then primers SEQ ID NO.2, i.e., upstream primer SsbE-2F: CCTCGCAACCTTGGACAGT and SEQ ID NO.3, i.e., downstream primer SsbE-2R: GTTGATGAACCAGAGCGTGAG were used for fluorescence quantitative PCR detection to obtain the Ct value of the sample, and the copy number of sugarcane smut pathogen in the soil was obtained by calculation through a standard curve;

[0008] (2) Construction of a monitoring and early warning system for sugarcane smut based on soil bacterial source detection

[0009] The severity of sugarcane smut is determined based on the copy number of sugarcane smut pathogen measured in step (1), and the severity of sugarcane smut is divided into the following four levels of warning from low to high: according to the 0.500g soil detection statistics, level 1 warning: less than or equal to 1000 copies; level 2 warning: greater than 1000 and less than or equal to 10000 copies; level 3 warning: greater than 10000 and less than or equal to 15000 copies; level 4 warning: greater than 15000 copies.

[0010] Furthermore, in step (1), the soil of the sugarcane field is collected according to a 5-point sampling method, and then the soil is repeated 3 times, and DNA is extracted from each soil using a soil DNA extraction kit.

[0011] Furthermore, in step (1), the soil DNA extraction kit is a BioFast soil genomic DNA extraction kit.

[0012] Furthermore, in step (1), the specific steps of constructing the standard curve are as follows: using primer pair SEQ ID NO.2 and SEQ ID NO.3 to perform PCR amplification on soil DNA to obtain a specific fragment of 148 bp, namely, a sequence fragment SEQ ID NO.1 after amplification of the bE gene DNA of sugarcane smut pathogen (Sporisorium scitamineum): CCTCGCAACCTTGGACAGTCCTTACCCCTCCCAACAAGACAAAGAAGCGCTACTGCGG ATCACGAATGATTCATGTGCCGGCACAGATGGATCTTCCCAAGGCCGTCCGCCTCTGG ACGCTCACCAGCTCACGCTCTGGTTCATCAAC, extracting plasmid, and gradiently diluting it into a standard plasmid, using it as a template, and performing a fluorescence quantitative PCR experiment to obtain a standard curve: Ct value = -3.8167×log 10 (copy number) + 35.848; using primers to perform fluorescence quantitative PCR detection on SEQ ID NO.2 and SEQ ID NO.3, the Ct value of the sample was obtained, and the Ct value was substituted into the standard curve formula to obtain the copy number of sugarcane smut fungus in the soil.

[0013] Furthermore, in step (1), the PCR reaction system is as follows: total volume 20 μL, including 2×Master Mix 10 μL, upstream primer 10 μmol / L 0.4 μL, downstream primer 10 μmol / L 0.4 μL, DNA template 1 μL, distilled water 8.2 μL; PCR reaction program is as follows: 95°C pre-denaturation for 3 min, 95°C denaturation for 15 s, 58°C annealing for 15 s, 72°C extension for 20 s; repeat the steps from denaturation to extension for a total of 40 cycles.

[0014] Furthermore, in step (1), the fluorescence quantitative PCR instrument used in the fluorescence quantitative PCR detection is an AnalytikJena qTOWERE3 fluorescence quantitative PCR instrument.

[0015] Furthermore, in step (2), the first-level warning: the smut incidence rate corresponding to the copy number less than or equal to 1000 is 0-10.00%; the second-level warning: the smut incidence rate corresponding to the copy number greater than 1000 and less than or equal to 10000 is 10.01-20.00%; the third-level warning: the smut incidence rate corresponding to the copy number greater than 10000 and less than or equal to 15000 is 20.01-30.00%; the fourth-level warning: the smut incidence rate corresponding to the copy number greater than 15000 is greater than 30.00%.

[0016] The present invention also provides a method for treating sugarcane smut with different warning levels, which is as follows:

[0017] After detecting the copy number and determining the warning level of sugarcane smut, take the following measures:

[0018] Level 1 warning: Newly planted sugarcane is not treated or the sugarcane seeds are soaked in 1500 times diluted pyraclostrobin for 15 minutes before planting; perennial sugarcane is sprayed with 1500 times diluted pyraclostrobin once during the sugarcane seedling stage.

[0019] Level 2 warning: Before planting new sugarcane, soak the sugarcane seeds in 1500 times diluted pyraclostrobin for 15 minutes; for perennial sugarcane, spray the above agent 1500 times diluted pyraclostrobin 1-2 times during the sugarcane seedling stage.

[0020] Level 3 warning: Before planting new sugarcane, soak the seeds in 1500 times diluted pyraclostrobin for 15 minutes; for perennial root sugarcane, do not leave one-year perennial roots for new plantings. Before planting, soak the seeds in 1500 times diluted pyraclostrobin for 15 minutes.

[0021] Level 4 warning: Perennial root sugarcane will no longer be left as roots but will be newly planted. Before planting, the sugarcane seeds should be soaked in 1500 times diluted pyraclostrobin for 15 minutes; or the crops can be rotated with other crops.

[0022] Beneficial effects of the present invention:

[0023] Monitoring and early warning of sugarcane smut are the prerequisites and key links of disease prevention and control. The present invention establishes a monitoring and early warning system for sugarcane smut based on soil bacterial source detection, divides the severity of sugarcane smut into grades according to the relationship between the number of sugarcane smut bacteria in sugarcane field soil and the incidence of sugarcane smut, and detects the copy number of sugarcane smut bacteria in the soil by fluorescent quantitative PCR to determine the incidence range and early warning level of smut, thereby achieving the purpose of monitoring and issuing early warnings for sugarcane smut of ratoon sugarcane, and providing a scientific basis for the prevention and control of sugarcane smut of ratoon sugarcane. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 This is the soil DNA electrophoresis test diagram;

[0025] Figure 2 This is the DNA Marker and the first lane detection diagram. DETAILED DESCRIPTION

[0026] In order to further explain the technical means and effects adopted by the present invention to achieve the predetermined invention purpose, the technical scheme in the embodiment of the present invention will be described more completely in conjunction with the accompanying drawings.

[0027] Example

[0028] A sugarcane smut monitoring and early warning method based on soil bacteria source detection comprises the following steps:

[0029] 1. Sugarcane smut soil detection

[0030] (1) Soil from the sugarcane field was collected according to the 5-point sampling method, and then divided into 3 replicates, and DNA was extracted using the BioFast soil genomic DNA extraction kit from Hangzhou Bioray. 0.500 g of soil was weighed for DNA extraction from each soil sample, and finally 50 ul of ddH2O was added for elution; the specific soil sample numbers are as follows: Liuzhou cK1, Liuzhou cK2, Liuzhou cK3, Liuzhou Yao1, Liuzhou Yao2, Liuzhou Yao3; Chongzuo Luobai ck1, Chongzuo Luobai ck2, Chongzuo Luobai ck3; Chongzuo Luobai Yaoji 1, Chongzuo Luobai Yaoji 2, Chongzuo Luobai Yaoji 3; Liucheng Taiping Town ck1, Liucheng Taiping Town ck2, Liucheng Taiping Town ck3, Liucheng Taiping Town Yaoji 1, Liucheng Taiping Town Yaoji 2, Liucheng Taiping Town Yaoji 3.

[0031] DNA electrophoresis detection: 1.2% agarose gel, voltage 120V, electrophoresis 30min.

[0032] The order of electrophoresis is as follows: DL2000 (lane 1), Liuzhou cK1 (lane 2), Liuzhou cK2 (lane 3), Liuzhou cK3 (lane 4), Liuzhou medicine 1 (lane 5), Liuzhou medicine 2 (lane 6), Liuzhou medicine 3 (lane 7); Chongzuo Luobai ck1 (lane 8), Chongzuo Luobai ck2 (lane 9), Chongzuo Luobai ck3 (lane 10); Chongzuo Luobai medicine 1 (lane 11), Chongzuo Luobai medicine 2 (lane 12), Chongzuo Luobai medicine 3 (lane 13); Liucheng Taiping Town ck1 (lane 14), Liucheng Taiping Town ck2 (lane 15), Liucheng Taiping Town ck3 (lane 16), Liucheng Taiping Town medicine 1 (lane 17), Liucheng Taiping Town medicine 2 (lane 18), Liucheng Taiping Town medicine 3 (lane 19).

[0033] Figure 1 The presence of DNA bands in all lanes confirmed that the DNA of all test samples met the requirements of fluorescent quantitative PCR testing. Figure 2 for Figure 1 The enlarged view on the left shows the DNA Marker and the first lane, which is the standard reference for DNA quality.

[0034] (2) PCR amplification was performed using the self-designed primer pair SsbE-2F: CCTCGCAACCTTGGACAGT as shown in SEQ ID NO.2, SsbE-2R: GTTGATGAACCAGAGCGTGAG as shown in SEQ ID NO.3 to obtain the bE gene DNA fragment of sugarcane smut fungus. The fragment was cloned into pMD19-T Vector. After sequencing confirmed that the sequence was correct, the plasmid was extracted and gradiently diluted into a series of standard plasmids as templates. After performing fluorescent quantitative PCR experiments, a standard curve was obtained.

[0035] The specific steps of constructing the standard curve are as follows:

[0036] The soil DNA was amplified by PCR using a primer pair, namely the upstream primer SEQ ID NO.2 and the downstream primer SEQ ID NO.3, to obtain a specific fragment of 148 bp, namely the sequence fragment after the amplification of the bE gene DNA of sugarcane smut fungus.

[0037] The reaction conditions of fluorescence quantitative PCR are as follows:

[0038] Fluorescence quantitative PCR reaction system: prepare the reaction mixture as shown in Table 1 below.

[0039] Table 1

[0040]

[0041] Fluorescence quantitative PCR reaction program: The cycling conditions are shown in Table 2 below.

[0042] Table 2

[0043]

[0044] The PCR product was cloned and sequenced to obtain SEQ ID NO.1, as shown below:

[0045] CCTCGCAACCTTGGACAGTCCTTACCCCTCCCAACAAGACAAAGAAGCGCTACTGCGG

[0046] ATCACGAATGATTCATGTGCCGGCACAGATGGATCTTCCCAAGGCCGTCCGCCTCTGG ACGCTCACCAGCTCACGCTCTGGTTCATCAAC.

[0047] The plasmid containing SEQ ID NO.1 was extracted and the plasmid concentration was determined by Qubit 3.0 fluorescence spectrophotometer to be 20.6 ng / μl. The copy number was calculated using the formula: (6.02×10 23 )×(concentration ng / ul×10 -9 ) / (DNA length×660)=copies / ul, the obtained 1μl plasmid copy number is: 6,730,574,665.

[0048] The plasmid was diluted into the following concentration gradient to obtain plasmids with five gradient concentrations as standards, as shown in Table 3 below.

[0049] Table 3

[0050] Plasmid mass concentration setting (ng / μl) Unit copy number (copies / μl) 0.00000206 673.0574665 0.0000206 6730.574665 0.000206 67305.74665 0.00206 673057.4665 0.0206 6730574.665

[0051] The plasmid standard DNA was amplified by fluorescence quantitative PCR using a primer pair, namely the upstream primer SEQ ID NO.2 and the downstream primer SEQ ID NO.3, and the Ct value of each standard was obtained, as shown in Table 4 below.

[0052] Table 4

[0053] Unit copy number (copies / μl) Average Ct value 673.0574665 26.81 6730.574665 23.56 67305.74665 20.69 673057.4665 17.20 6730574.665 14.06

[0054] The logarithm of the unit copy number (log 10 ) and Ct value to draw a standard curve, and deduce the standard curve. The obtained standard curve is: Ct value = -3.8167×log 10 (Copy number)+35.848.

[0055] (3) Using the self-designed primer pair SsbE-2F: CCTCGCAACCTTGGACAGT as shown in SEQ ID NO.2, SsbE-2R: GTTGATGAACCAGAGCGTGAG as shown in SEQ ID NO.3, fluorescence quantitative PCR detection was performed to obtain the Ct value of the sample, and the copy number of sugarcane smut fungus in 0.500g soil was obtained by calculation through the standard curve.

[0056] The specific steps of the fluorescent quantitative PCR detection are as follows:

[0057] The soil DNA was amplified by fluorescence quantitative PCR using a primer pair, i.e., upstream primer SEQ ID NO.2 and downstream primer SEQ ID NO.3, to obtain the Ct value of the sample. The Ct value was substituted into the standard curve formula to calculate the bacterial copy number in 1 μl of soil DNA, and then the copy number of sugarcane smut pathogen in 0.500 g of soil was regressed and calculated.

[0058] The reaction conditions of fluorescence quantitative PCR are as follows:

[0059] Fluorescence quantitative PCR reaction system: prepare the reaction mixture as shown in Table 5 below.

[0060] Table 5

[0061]

[0062] Fluorescence quantitative PCR reaction program: The cycling conditions are shown in Table 6 below.

[0063] Table 6

[0064]

[0065] The experimental results are shown in Table 7 below:

[0066] Table 7

[0067]

[0068]

[0069] 2. Survey on the incidence of sugarcane smut

[0070] In July, the incidence of sugarcane smut was investigated at the above sampling points. The survey method was: 5 rows of 10 meters (about 60 m) 2 One replicate, a total of 3 replicates, investigated the total number of plants and the number of smut plants in each replicate, and calculated the incidence of sugarcane smut.

[0071] 3. Construction of sugarcane smut monitoring and early warning system based on soil fungus source monitoring

[0072] The relationship between the number of copies of soil bacteria of sugarcane smut and the incidence rate was statistically analyzed, and the severity level of ratoon sugarcane smut was divided into: 0-1000 copies (smut incidence rate 0-10.00%), 1001-10000 copies (smut incidence rate 10.01-20%), 10001-15000 copies (smut incidence rate 20.01-30.00%), and 15001 or more copies (smut incidence rate greater than 30.00%). According to the results, 4 warning levels were divided, level 1: less than or equal to 1000 copies, level 2: greater than 1000 and less than or equal to 10000 copies, level 3: greater than 10000 and less than or equal to 15000 copies, and level 4: greater than 15000 copies.

[0073] According to the above test results and warning level classification, the soil samples in Table 7 are classified as shown in Table 8 below:

[0074] Table 8

[0075]

[0076]

[0077] In addition, in order to verify the accuracy of the sugarcane smut monitoring and early warning system of the present invention, the present invention also selected experiments in different regions, and used the method of the present invention to detect the incidence of sugarcane smut in ratoon sugarcane and the copy number of sugarcane smut fungus sources in the soil, respectively, covering the data of the four early warning levels divided by the present invention. The specific results are shown in Tables 9-12.

[0078] Table 9

[0079]

[0080] Table 10

[0081]

[0082] Table 11

[0083]

[0084] Table 12

[0085]

[0086] It can be seen from the test result data in Tables 9-12 that the soil copy number set by the present invention can correspond to the smut incidence rate one by one, and the warning levels are divided into level 1: soil copy number is less than or equal to 1000 copies, level 2: greater than 1000 and less than or equal to 10000, level 3: greater than 10000 and less than or equal to 15000 copies, and level 4: greater than 15000 copies; the above four warning levels of sugarcane smut are divided into level 1 (smut incidence rate 0-10.00%), level 2 (smut incidence rate 10.01-20.00%), level 3 (smut incidence rate 20.01-30.00%), and level 4 (smut incidence rate greater than 30.00%), which are corresponding and accurate, and have practical and effective monitoring and early warning significance.

[0087] After determining the warning level of sugarcane smut, the following measures can be taken:

[0088] Level 1 warning: Newly planted sugarcane is not treated or the sugarcane seeds are soaked in 1500 times diluted pyraclostrobin for 15 minutes before planting; perennial sugarcane is sprayed with 1500 times diluted pyraclostrobin once during the sugarcane seedling stage.

[0089] Level 2 warning: Before planting new sugarcane, soak the sugarcane seeds in 1500 times diluted pyraclostrobin for 15 minutes; for perennial sugarcane, spray the above agent 1500 times diluted pyraclostrobin 1-2 times during the sugarcane seedling stage.

[0090] Level 3 warning: Before planting new sugarcane, soak the seeds in 1500 times diluted pyraclostrobin for 15 minutes; for perennial sugarcane, it is recommended not to leave the perennial roots for one year and plant new ones. Before planting, soak the seeds in 1500 times diluted pyraclostrobin for 15 minutes.

[0091] Level 4 warning: Perennial root sugarcane will no longer be left as roots but will be newly planted. Before planting, the sugarcane seeds should be soaked in 1500 times diluted pyraclostrobin for 15 minutes; or the crops can be rotated with other crops.

[0092] Although the present invention has been disclosed as above with preferred embodiments, it is not intended to limit the present invention. Any person skilled in the art may make some modifications and improvements without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention shall be based on the definition of the claims.

Claims

1. A sugarcane smut monitoring and early warning method based on soil fungus source detection, characterized in that: The steps include: (1) Soil detection of sugarcane smut pathogen Soil from the sugarcane field was collected, soil DNA was extracted using a soil DNA extraction kit, and then fluorescent quantitative PCR detection was performed using the primer pair: upstream primer SEQ ID NO.2 and downstream primer SEQ ID NO.3 to obtain the Ct value, and the copy number of sugarcane smut fungus in the soil was obtained by calculation through the standard curve; (2) Construction of a monitoring and early warning system for sugarcane smut based on soil bacterial source detection The severity of sugarcane smut is determined based on the copy number of sugarcane smut pathogen measured in step (1), and the severity of sugarcane smut is divided into the following four levels of warning from low to high: according to the statistics of 0.500g soil detection, level 1 warning: less than or equal to 1000 copies; level 2 warning: greater than 1000 and less than or equal to 10000 copies; level 3 warning: greater than 10000 and less than or equal to 15000 copies; Level 4 warning: greater than 15,000 copies.

2. The method for monitoring and early warning of sugarcane smut based on soil bacteria source detection according to claim 1, characterized in that: In step (1), the soil DNA extraction kit is a BioFast soil genomic DNA extraction kit.

3. The method for monitoring and early warning of sugarcane smut based on soil bacteria source detection according to claim 1, characterized in that: In step (1), the standard curve construction steps are as follows: using primers SEQ ID NO.2 and SEQ ID NO.3 to perform PCR amplification on soil DNA to obtain a specific fragment of 148 bp, namely, a sequence fragment SEQ ID NO.1 after amplification of the bE gene DNA of sugarcane smut pathogen, extracting plasmids, and gradient diluting them into standard plasmids, using them as templates, and performing fluorescence quantitative PCR reaction to obtain a standard curve: Ct value = -3.8167×log 10 (Copy number)+35.

848.

4. The method for monitoring and early warning of sugarcane smut based on soil bacteria source detection according to claim 1, characterized in that: In step (1), the PCR reaction system is as follows: total volume 20 μL, including 2×Master Mix 10 μL, upstream primer 10 μmol / L 0.4 μL, downstream primer 10 μmol / L 0.4 μL, DNA template 1 μL, distilled water 8.2 μL; PCR reaction program is as follows: 95°C pre-denaturation for 3 min, 95°C denaturation for 15 s, 58°C annealing for 15 s, 72°C extension for 20 s; repeat the steps from denaturation to extension for a total of 40 cycles.

5. The method for monitoring and early warning of sugarcane smut based on soil bacteria source detection according to claim 1, characterized in that: In step (1), fluorescent quantitative PCR detection is performed using AnalytikJena qTOWERE3 fluorescent quantitative PCR instrument.

6. The method for monitoring and early warning of sugarcane smut based on soil bacteria source detection according to claim 1, characterized in that: In step (2), the first level warning: the smut incidence rate corresponding to the copy number less than or equal to 1000 is 0-10.00%; the second level warning: the smut incidence rate corresponding to the copy number greater than 1000 and less than or equal to 10000 is 10.01-20.00%; the third level warning: the smut incidence rate corresponding to the copy number greater than 10000 and less than or equal to 15000 is 20.01-30.00%; the fourth level warning: the smut incidence rate corresponding to the copy number greater than 15000 is greater than 30.00%.

Images