SNP loci for identifying resistance to northern corn leaf blight and uses thereof

By developing 14 SNP loci and their probes, chips, and kits, liquid-phase chip technology was used to identify maize leaf spot resistance, solving the problems of high detection cost and low sensitivity in existing technologies, and realizing efficient and low-cost maize leaf spot resistance identification and genotyping analysis.

CN119753220BActive Publication Date: 2026-03-24HENAN AGRICULTURAL UNIVERSITY
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-01-07
Publication Date
2026-03-24

AI Technical Summary

Technical Problem

Existing technologies are insufficient for effectively identifying maize short leaf spot resistance, and existing SNP marker detection methods are unsuitable for high-throughput detection due to high costs or low sensitivity. There is also a lack of dedicated chips for detecting maize short leaf spot resistance.

Method used

Fourteen SNP loci and their corresponding probes, chips, and kits were developed to identify maize short leaf spot resistance. High-throughput, low-cost genotyping was performed using liquid-phase chip technology, and targeted capture and analysis were carried out using a next-generation sequencing platform.

Benefits of technology

It achieves highly sensitive, specific, and high-throughput identification of maize small leaf spot resistance, reduces detection costs, and supports genotyping of maize inbred lines and screening of disease-resistant resources.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005233711360000101
    Figure BDA0005233711360000101
  • Figure BDA0005233711360000131
    Figure BDA0005233711360000131
  • Figure BDA0005233711360000141
    Figure BDA0005233711360000141
Patent Text Reader

Abstract

The application provides application of 14 SNP sites in identification of corn small spot resistance and probes, chips and kits for detecting the 14 SNP sites. The 14 SNP sites can be used for identification of corn small spot resistance sites, corn inbred line genotyping, corn inbred line authenticity identification, corn inbred line diversity analysis and the like.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of crop molecular biology technology, specifically relating to SNP sites for identifying resistance to maize leaf spot disease and their applications. Background Technology

[0002] Maize leaf spot is a significant foliar disease in maize production. In the early 1970s, the prevalence of race T of the leaf spot pathogen led to a major outbreak in the United States, resulting in a yield reduction of over 15%, a loss of more than 30 billion jin (15 million kg), and directly causing the withdrawal of T-type cytoplasmic hybrids from maize production. In my country, due to the influence of varieties, climate, the large-scale accumulation of pathogens, and traditional farming practices, the occurrence of maize leaf spot has been increasing year by year. In 2021, the National Crop Variety Approval Committee, when revising the approval standards for new maize varieties, specifically emphasized resistance to maize leaf spot. Currently, due to the complexity of the pathogen (race) of maize leaf spot, the collection of resistance resources and the cloning of resistance genes are progressing slowly, and there is still no effective way to prevent large-scale outbreaks.

[0003] Currently, marker-assisted selection (MAG) is mainly divided into three categories: the first generation uses molecular hybridization as its core technology, with commonly used restriction fragment length polymorphism (RFLP) markers; the second generation utilizes PCR detection as its core technology, such as commonly used simple sequence repeats (SSR), amplified fragment length polymorphism (AFLP), and sequence tag sites (STS); the third generation combines restriction enzyme digestion with PCR technology, such as AFLP and CAPS. The fourth category is single nucleotide polymorphism (SNP) markers. Compared with SNP markers, first-generation marker detection is cumbersome, has a long detection cycle, and is more expensive, making it unsuitable for high-throughput sample detection; second-generation marker detection is based on PCR amplification, has poor reproducibility, and is not suitable for high-throughput molecular breeding detection; third-generation marker detection combines the advantages of the first and second generations, but is relatively expensive and cannot be used for genome-wide molecular marker detection. Liquid chips made using large-scale, dense oligonucleotide probe arrays can simultaneously detect a large number of SNP sites, typically covering thousands of SNPs, and have significant advantages in large-scale genotyping and association analysis. Enriching target fragments with probes can significantly improve the sensitivity and specificity of detection. Compared with traditional solid-state chips, they are lower in cost and have higher throughput, showing significant advantages in targeting, flexibility and cost-effectiveness.

[0004] Disease resistance microarrays, also known as SNP microarrays, utilize silicon, filter membranes, or other substrates as carriers. Through microfabrication techniques such as printing and inkjet printing, dense arrays of oligonucleotide probes are fixed and formed. These probes undergo base pairing with the target genome using nucleic acid hybridization principles, and the genotype of each SNP locus is determined based on the intensity of the hybridization signal. Currently, two main types of microarrays have been developed: solid-phase microarrays and liquid-phase microarrays. Compared to solid-phase microarrays, liquid-phase microarrays use complementary base pairing principles to design specific probes for the target region's gene sequence, achieving targeted capture of the target gene or locus. High-throughput next-generation sequencing is then performed on the captured fragments using a sequencing platform, enabling precise genotype identification of the target region or locus. Liquid-phase microarrays exhibit significant advantages in throughput, sensitivity, ease of operation, automation, sample volume, specificity, and accuracy. Currently developed SNP microarrays are mainly used for detecting drought resistance, herbicide tolerance, heterosis, and transgenic diseases; microarrays for detecting maize leaf spot disease resistance are still lacking. The developed chips are mainly used in molecular breeding, genome-wide association analysis of genotypes and phenotypes, genetic map construction, and crop resource identification.

[0005] Therefore, there is an urgent need in this field for an SNP liquid phase chip for identifying resistance to maize leaf spot disease. Summary of the Invention

[0006] The purpose of this invention is to provide SNP loci for identifying resistance to maize leaf spot disease and their applications, providing identification tools for screening resistant resources for maize leaf spot disease, genetic improvement of susceptible inbred lines, identification of resistance genes in inbred lines, and genome-wide genetic analysis of leaf spot disease. Thus, this invention has been completed.

[0007] In a first aspect, the present invention provides the application of 14 SNP sites in the identification of maize leaf spot resistance, said SNP sites including:

[0008] (1) The SNP site at position 155842030 on chromosome 9 with polymorphism G / A;

[0009] (2) The SNP site at position 16877754 on chromosome 3 with polymorphism A / G;

[0010] (3) The SNP site at position 16905944 on chromosome 3 with a polymorphism of T / C;

[0011] (4) The SNP site at position 16678723 on chromosome 3 with polymorphism A / G;

[0012] (5) The SNP site at position 154229449 on chromosome 9 with a polymorphism of C / T;

[0013] (6) The SNP site at position 158233558 on chromosome 9, with a polymorphism of G / A;

[0014] (7) The SNP site at position 157181668 on chromosome 9 with polymorphism C / A;

[0015] (8) The SNP site at position 155511186 on chromosome 9 with polymorphism A / G;

[0016] (9) The SNP site at position 153517876 on chromosome 9 with polymorphism A / C;

[0017] (10) The SNP site at position 153901636 on chromosome 9 with a polymorphism of C / T;

[0018] (11) The SNP site at position 18063115 on chromosome 9 with a polymorphism of T / C;

[0019] (12) The SNP site at position 16877094 on chromosome 3 with polymorphism A / T;

[0020] (13) SNP site at position 33281840 on chromosome 3 with polymorphism C / T;

[0021] (14) The SNP site at position 33539944 on chromosome 3 with polymorphism G / A.

[0022] In a second aspect, the present invention provides a probe for identifying resistance to maize leaf spot disease, the probe comprising one or more of the probes shown in SEQ ID NO:1-14, SEQ ID NO:1-14 for detecting the 14 SNP sites described in the first aspect.

[0023] In a third aspect, the present invention provides a chip for identifying resistance to maize leaf spot disease, the chip comprising the probes described in the second aspect.

[0024] In a fourth aspect, the present invention provides a kit for identifying resistance to maize leaf spot disease, the kit comprising the probe described in the second aspect or the chip described in the third aspect.

[0025] In a fifth aspect, the present invention provides a method for identifying resistance to maize leaf spot disease, wherein the method uses the probe described in the second aspect, or the chip described in the third aspect, or the kit described in the fourth aspect to detect the 14 SNP sites described in the first aspect.

[0026] The beneficial effects of this invention are: the 14 SNP loci of this invention can be used for the identification of maize leaf spot resistance loci, genotyping of maize inbred lines, identification of the authenticity of maize inbred lines, and analysis of maize inbred line diversity; the chip of this invention has high sensitivity and specificity, low cost, and high throughput. Attached Figure Description

[0027] To more clearly illustrate the technical solutions in the specific embodiments of the present invention, the accompanying drawings in the specific embodiments will be briefly described below.

[0028] Figure 1 The correlation analysis of small leaf spot phenotypes in 505 maize inbred lines under different environments is shown.

[0029] Figure 2 The analysis of resistance sites for maize leaf spot disease under different environments is presented.

[0030] Figure 3 The results of linkage analysis (chromosome 3) of small spot disease resistance loci using RIL populations of CML454 (resistant) × GEMS41 (susceptible) are shown.

[0031] Figure 4 The results of small spot disease resistance loci analysis in the F2 population of CML496 (resistant) × GEMS41 (susceptible) crossbred using extreme pooling analysis technique are shown.

[0032] Figure 5 The distribution of 6600 SNPs on the genome is shown.

[0033] Figure 6 The process of using a chip for liquid phase probe capture is illustrated. Detailed Implementation

[0034] The present invention will be described in detail below. It should be understood that the following description is merely illustrative and is not intended to limit the scope of the invention; the scope of protection of the invention is defined by the appended claims. Furthermore, those skilled in the art will understand that modifications can be made to the technical solutions of the present invention without departing from its spirit and intent. Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art.

[0035] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the subject matter pertains. Before a detailed description of the invention, the following definitions are provided to better understand it.

[0036] In this paper, the terms "single nucleotide polymorphism," "SNP," "SNP marker," and "SNP site" refer to DNA sequence polymorphisms caused by variations in a single nucleotide at the genomic level. These changes can occur within coding regions of genes, non-coding regions (such as promoter regions or their vicinity, or introns), or intergenic regions.

[0037] In this document, the term "probe" refers to a molecule that can bind to a specific sequence, subsequence, or other portion of another molecule. Unless otherwise specified, the term "probe" generally refers to a polynucleotide probe that can bind to another polynucleotide (often called a "target polynucleotide") through complementary base pairing. Depending on the stringency of the hybridization conditions, the probe can bind to a target polynucleotide that lacks complete sequence complementarity with the probe. Probes can be labeled directly or indirectly, including primers. Hybridization methods include, but are not limited to, solution-phase, solid-phase, mixed-phase, or in situ hybridization assays.

[0038] In this article, the term "corn leaf spot," also known as corn spot disease or corn southern leaf blight, refers to a disease of corn caused by the fungus *Helicobacter pylori*. It primarily affects the leaves, but leaf sheaths, husks, and ears can also be affected. It can occur throughout the entire growth period of corn, but is most severe during the tasseling and grain-filling stages.

[0039] As previously stated, the present invention aims to provide SNP sites for identifying resistance to maize leaf spot disease and their applications.

[0040] Therefore, in a first aspect, the present invention provides the application of 14 SNP sites in the identification of maize leaf spot resistance, said SNP sites including:

[0041] (1) The SNP site at position 155842030 on chromosome 9 with polymorphism G / A;

[0042] (2) The SNP site at position 16877754 on chromosome 3 with polymorphism A / G;

[0043] (3) The SNP site at position 16905944 on chromosome 3 with a polymorphism of T / C;

[0044] (4) The SNP site at position 16678723 on chromosome 3 with polymorphism A / G;

[0045] (5) The SNP site at position 154229449 on chromosome 9 with a polymorphism of C / T;

[0046] (6) The SNP site at position 158233558 on chromosome 9, with a polymorphism of G / A;

[0047] (7) The SNP site at position 157181668 on chromosome 9 with polymorphism C / A;

[0048] (8) The SNP site at position 155511186 on chromosome 9 with polymorphism A / G;

[0049] (9) The SNP site at position 153517876 on chromosome 9 with polymorphism A / C;

[0050] (10) The SNP site at position 153901636 on chromosome 9 with a polymorphism of C / T;

[0051] (11) The SNP site at position 18063115 on chromosome 9 with a polymorphism of T / C;

[0052] (12) The SNP site at position 16877094 on chromosome 3 with polymorphism A / T;

[0053] (13) SNP site at position 33281840 on chromosome 3 with polymorphism C / T;

[0054] (14) The SNP site at position 33539944 on chromosome 3 with polymorphism G / A.

[0055] Regarding the first aspect, those skilled in the art can use 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 or 14 of the above 14 SNP sites to identify maize short leaf spot resistance in practical applications.

[0056] In a second aspect, the present invention provides a probe for identifying resistance to maize leaf spot disease, the probe comprising one or more of the probes shown in SEQ ID NO:1-14, SEQ ID NO:1-14 for detecting the 14 SNP sites described in the first aspect.

[0057] Among them, SEQ ID NO:1-14 are respectively:

[0058] (1)TCTGCTCGTCTTGTCTCCCTCGATCAACCTGTTCTTGCTTGCT CTGTACTTCACAGATCAAAGGATTAAAGTGGTGCACTGTCTTGGT TTTTAGGTACTTGTTTGTTTAGGTCTCGGGTT (SEQ ID NO: 1);

[0059] (2)GACTTACTGTGGGCATGCATATACTATGCAATAAGCCAAAAgg gggggggggggggggTGCTGAGTGAGAACGGAGAACAGGGAGGAGCG CATGCAGGATGGAGTTGTGGACTTTGCTGT(SEQ ID NO:2);

[0060] (3)TCGCGGCTCCAATTTATGGGTAGGTCAGCTAGTACCGACCCG TAGCTGGTCAACCAGGCGGCACACCAGTCCGTGCCGAGCCTTGC GGCGGAGAAGAGGAAAAGTGGAGGTAATGGGTCC(SEQ ID NO:3);

[0061] (4)ACCTGATCTTTACATCCATATCCATATCCACTCCAGGACACCG CTGTGTGCCTCTTGTGAGTGAAGCCTACTAGCTAGTAGATGTAGAT CTGGGGAGGCTACGCCGGATCAGAACGACAG(SEQ ID NO:4);

[0062] (5)GTTAACATATATAATAACTATACGTGTTGGAGCTATCGATCCTT TATAAATCTTGATTTTAATGCATTTTGTTCTGTCTGAGATCACCGAT ATTGGAACAGGGTTATGATCTGCCCTAGC(SEQ ID NO:5);

[0063] (6)CTGTAAATTTGTCCAGAACATGTTTTCCCTAATAGCCCATCAT ATCCCGCTCTTTTTCTTGTTGATATGACCAAGGCTGGCAGCATCGC TGCTCAAGATAATGTTTGGGGCGCATGATTT(SEQ ID NO:6);

[0064] (7)TTAGAACACACAAGCCAATCTGGAACCATGAAATTAGAAAA GATTTCCCGAAGTACCCAATCCCACAGATGGGAATCACAGAACTA CCAATACCTAACCCCTGGAATCTACAGCTAATAG(SEQ ID NO:7);(8)GAGAAGGAAGACGAGATTATGGTCTCAAAGTATCTCGAGAT GACTTCAGACTCTGAAACCCCTATAAAAGTTGAGAACGTCATGTC ACTGCATTCTGCAAATGATGATGATGTTCCTTCT(SEQ ID NO:8);(9)GTCACTCTCCGTCTGGTCATCACGGGCAGGCACGCACCAGAT GCGGGTAGATAGAGAGAGATGCTGAATTGGAAGGTCAGTGCTGG ACTGACCAGCTCACCTGGCCAAGATTGCCGattc(SEQ ID NO:9);(10)TTTGCCTCGGAGTTCTCATCATTTGCTCTCATCTTGCCTGGT TCTTTTGACTTCCTTACACTTGAGGTGAGGCCTGCCAAGGCATGC GAGTCCTTATTCGTACTTCTAAGACCAAAGTAG(SEQ ID NO:10);(11)GGTACAACAGTAACAGGCAAGACGATTAACCACCCAGTCA CGCAACTCGCGCGTGACATGGCGAGTGGGTCGTATCATGTCCCAT CAGAGTTGCCCATGCCAAGAGGGATCATGATGGCT(SEQ ID NO:11);

[0065] (12) GGTGGAGAGCTGTTCCTAACACCACCCCTCCAGACTTCAAG AAAGTCACCTGCCAGCCATCATAAGCATAAGCACGCCATTAACAG GAGGACCCAATCTATATCTACTTTAGCAGACTAC (SEQ ID NO: 12); (13) TTCAGATATGAACATGCAATTTTAAATGGCTCACGCCCACAA ACATGACATATCAATACGCCATTCTAGTGTATTCTCTGGTAAACAA AGAAACAAGAAGCAAATTTGGTATTCATGTGC (SEQ ID NO: 13); (14) ATGGAATAAGGATTAAGGTGTGGTACCGTGTGTCAAGCGTT TGAACGTACTAAACACATACCAAGAAATATGGTAAATCGGTAAGCCTAGTACCTGAGTGAACCTGCCCGCAGACTTTAC (SEQ ID NO: 14).

[0066] SEQ ID NO:1-14 are used to detect the 14 SNP sites described in the first aspect, for example, SEQ ID NO:1 is used to detect the SNP site in the first aspect (1), SEQ ID NO:2 is used to detect the SNP site in the first aspect (2), SEQ ID NO:3 is used to detect the SNP site in the first aspect (3), etc. Similar to the first aspect, those skilled in the art can use 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 or 14 of the above 14 probes in practical applications to identify maize leaf spot resistance.

[0067] In a third aspect, the present invention provides a chip for identifying resistance to maize leaf spot disease, the chip comprising the probes described in the second aspect.

[0068] In one embodiment, the chip further includes probes for identifying maize varieties, such as detection probes for SNP sites disclosed in other patents or articles for identifying maize varieties, such as the probes in CN106544425B (A DNA chip and its application in maize variety identification and breeding). In a further embodiment, the chip is a liquid phase chip.

[0069] In a fourth aspect, the present invention provides a kit for identifying resistance to maize leaf spot disease, the kit comprising the probe described in the second aspect or the chip described in the third aspect.

[0070] In one embodiment, the kit further comprises dNTPs, DNA polymerase, MgCl2, and PCR reaction buffer. Those skilled in the art will understand that the kit may also include other necessary reagents. In a further embodiment, the kit further comprises template DNA as a positive control to increase the accuracy of SNP site detection.

[0071] In a fifth aspect, the present invention provides a method for identifying resistance to maize leaf spot disease, wherein the method uses the probe described in the second aspect, or the chip described in the third aspect, or the kit described in the fourth aspect to detect the 14 SNP sites described in the first aspect.

[0072] In an exemplary implementation, the probe of SEQ ID NO:1 is used to detect the SNP site of the first aspect (1) to identify maize leaf spot resistance. If the SNP site is G, the sample does not have maize leaf spot resistance, and if the SNP site is A, the sample has maize leaf spot resistance.

[0073] Example

[0074] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of this invention should be included within the scope of protection of this invention.

[0075] Example 1: Identification of SNP resistance sites significantly associated with small leaf spot disease

[0076] This example illustrates the process of screening 14 SNP sites for identification of maize leaf spot resistance.

[0077] The inventors of this application utilized 505 publicly disclosed maize inbred lines (http: / / www.maizego.org / Resources.html) to conduct artificial inoculation identification of *Cephalotaxus fortunei* in Junxian County, Henan Province, Changge County, Henan Province, and Baoding City, Hebei Province (spore concentration 1×10⁻⁶). 5 / mL), using a resistance standard of 1-9 levels. Identification results under multi-year, multi-location environmental conditions showed that related population inbred lines exhibited wide variation in resistance to maize leaf spot, with most resistant materials originating from inbred lines containing tropical / subtropical lineages. Correlation analysis of maize inbred lines' leaf spot phenotypes using the Corrplot function showed that, at the p < 0.01 level, population phenotypes under different environments were significantly correlated, with correlation coefficients ranging from 0.54 to 0.87. Figure 1 ).

[0078] Subsequently, the inventors used publicly available second-generation sequencing data from 505 maize inbred lines to perform variant detection and analysis. The reference genome was version B73_v5. GATK software was used to analyze genomic variant information for each sample group (2011 Changge Xiaoban A, 2012 Changge Xiaoban A, 2012 Changge Xiaoban B, 2012 Baoding Xiaoban A, 2012 Baoding Xiaoban B, and 2012 Junxian Xiaoban). Filtering parameters included: retention of sites with a MISS deletion rate < 0.1, a population heterozygosity rate (HET) < 0.05, and a MAF ≥ 0.05; retention of sites with a GC content < 65 in the 120bp sequences upstream and downstream of the SNP (30 < 120 bp), a sequence complexity > 0.9, and a duplication rate ≤ 25%. Ultimately, a candidate locus containing 6,118,276 SNPs was obtained. Genome-wide association analysis (GWA) of small leaf spot disease was performed using a mixed linear model in Tassel software, identifying SNPs associated with resistance to small leaf spot on chromosomes 1, 3, 4, 5, 6, 8, and 9. Figure 2 ).

[0079] Based on the identification of small leaf spot resistance in inbred lines of related populations, a recombinant inbred line (RIL) population containing 160 families, formed by crosses of CML454 (resistant) × GEMS41 (susceptible), and an F2 population formed by crosses of CML496 (resistant) × GEMS41 (susceptible), were used for inoculation identification of small leaf spot resistance in Xuchang and Xinxiang, Henan Province, for two consecutive years (2016 and 2017). Genetic linkage maps were constructed, and two QTL (quantitative trait loci) loci significantly associated with small leaf spot resistance were detected on chromosomes 3 (10-50 Mb) and 9 (120-160 Mb), respectively. Figure 3 and Figure 4 Based on the genome-wide association analysis above, 14 new SNP sites that are highly significantly associated with maize leaf spot disease were screened out within these two disease resistance regions (Table 1).

[0080] Table 1: 14 novel SNP loci significantly associated with resistance to maize leaf spot disease

[0081]

[0082] Example 2: Chip Fabrication

[0083] Using the data and data filtering steps from Example 1, the best-quality SNPs were selected according to the window criteria. Specifically, the rules were: a gene frequency difference > 0.1 within two consecutive windows; at least one SNP marker within an 800Kb window; and 99% coverage across the entire genome. Finally, 6600 SNP loci evenly distributed across the genome were selected. Figure 5 These 6,600 SNP sites include the 14 SNP sites mentioned above.

[0084] This embodiment is based on the aforementioned 6600 SNP loci and utilizes data from Beijing Baiyu Biotechnology Co., Ltd. A hybridization capture system is used to fabricate microarrays, enabling targeted capture of target genes or loci. High-throughput next-generation sequencing of the captured fragments is then performed using a sequencing platform, allowing for precise genotyping of the target region or locus. The specific experimental procedure is as follows: Figure 6 As shown. The chip in this embodiment includes probes as shown in SEQ ID NO:1-14 to detect the 14 SNP sites described above.

[0085] Preparation of 6K liquid-phase gene chip for maize

[0086] The preparation process includes template synthesis and probe preparation. The synthesized DNA template (Oligo Pool) undergoes quality control and in vitro amplification experiments to ultimately prepare the finished probe. Production is then complete. Maize 6K liquid phase gene chip capture kit ( Maize 6K liquid phase gene chip).

[0087] Example 3 Verification Experiment

[0088] I. Sample and Data Acquisition

[0089] 1. Identification of maize resistance phenotypes and determination of test samples

[0090] During the implementation of the inventor's field maize research project, 112 maize inbred lines were selected. At the small trumpet stage of maize, the maize plants were artificially inoculated by spraying a suspension of small leaf spot fungus spores. Four to five weeks after inoculation, resistance to small leaf spot was investigated, and maize resistance phenotypic data were obtained (including 32 disease-resistant maize inbred lines, 23 disease-non-resistant maize inbred lines, and 57 intermediate types). Ear leaves of all maize inbred lines were collected for subsequent analysis.

[0091] 2. DNA library construction and capture

[0092] Genotyping of 112 maize samples was performed using the chip prepared above: maize leaves were collected, and leaf DNA was extracted using the SDS method. DNA quality was assessed using a spectrophotometer. Quality-controlled maize DNA samples underwent ultrasonic or enzyme digestion, end repair and 3' end addition of an "A", adapter ligation and purification, and Pre-PCR library amplification to obtain the library required for hybridization capture. The capture method followed... The hybridization capture system is followed by library and probe hybridization, probe binding to magnetic beads, rinsing of non-specifically bound libraries, post-capture PCR amplification, library quantification, and quality control before sequencing.

[0093] 3. Quantitative quality control of the library

[0094] Library concentration was detected using a Qubit 4.0 Fluorometer. A library with a pre-capture concentration >25 ng / μL was considered a qualified library. Detection was performed using an ABIQsep 100; the main peak should be around 200-500 bp, with no extraneous peaks before or after it.

[0095] 4. Sequencing

[0096] We used the BGI DNBSEQ T7 next-generation sequencing platform to perform 2*150bp paired-end sequencing.

[0097] II. Data Analysis

[0098] 1. Raw sequencing data

[0099] Raw image data obtained from high-throughput sequencing (DNBSEQ platform, Nova platform, etc.) is identified and converted into raw sequencing data (called Raw data) in Fastq format by a specific program. The provided file format is generally: Project Number / Flowcell Number / Sample Name_Lane Number_I+index Number.R1 or R2.clean.fastq.gz.

[0100] 2. Data filtering and quality control

[0101] By setting certain filtering criteria, connector information, low-quality bases, and undetected bases (represented by N) that could interfere with subsequent information analysis are removed. The final data obtained is called clean data or clean reads. In this embodiment, the data filtering criteria are:

[0102] 1) Filter out reads containing adapter sequences;

[0103] 2) When the content of N in a single-end sequencing read exceeds 3% of the length of that read, remove this pair of paired reads;

[0104] 3) When the number of low-quality (less than 3) bases in a single-end sequencing read exceeds 50% of the length of that read, remove the paired reads.

[0105] 3. Data Analysis Process

[0106] Variance analysis was performed using the samtools / bcftools (https: / / github.com / samtools / samtools) workflow. The filtered sequencing sequences were then aligned with a reference genome. The main workflow is as follows:

[0107] (1) Map to reference (BWA parameter: default parameter);

[0108] (2)Remove Duplicates(samtools);

[0109] (3) Call Variants(bcftools(MQ≥30, other parameters are default));

[0110] (4)VCF Quality filter (bcftools standard);

[0111] (5)Annotating variants(snpEff / Python Script);

[0112] (6) Genome-wide association analysis was performed using a general linear model in Tassel software, and a total of 94 SNP loci were identified that were highly significantly associated with maize leaf spot resistance. The specific results are shown in Table 2. The inventors further found that all 14 new SNP loci of the present invention were included in the identification results, confirming the universality of the new SNP loci of the present invention.

[0113] Table 2: 94 SNP loci that are highly significantly associated with resistance to maize leaf spot disease.

[0114]

[0115]

[0116]

[0117] Note: The bolded sites are the 14 SNP sites of this invention.

[0118] III. Chip Performance

[0119] This embodiment tested the target site capture efficiency of a maize 6K liquid-phase gene chip, using maize varieties HN2238-HN2255. Based on site evaluation and design, and capture results, the average capture rate of the target sites was found to be above 95%. Specific data are shown in Table 3.

[0120] Table 3: Capture efficiency of target sites in maize 6K liquid-phase gene chip

[0121]

[0122] The capture efficiency and number of loci in the test samples were both well detected. It meets the delivery standards for maize 6K liquid-phase gene chips and is suitable for large-scale application.

[0123] Furthermore, this embodiment also analyzed the consistency of maize 6K liquid-phase gene chip detection results. Four maize DNA samples were selected from the above test samples, divided in half, and each half was used for maize 6K liquid-phase gene chip detection. For the same plant sample, the repeatability of the two DNA samples exceeded 99.7%. This indicates that the maize 6K liquid-phase gene chip detection results have excellent reliability and stability. Specific results are shown in Table 4.

[0124] Table 4: Detection consistency of maize 6K liquid phase gene chip

[0125]

[0126] The chip provided in Application Example 2 can accurately and efficiently identify SNP information, and can be used for the identification of maize leaf spot resistance sites, genotyping of maize inbred lines, identification of the authenticity of maize inbred lines, and analysis of maize inbred line diversity, providing strong support for molecular breeding for resistance to leaf spot and identification of variety authenticity.

[0127] The above provides a detailed description of the SNP sites for identifying maize leaf spot resistance and their applications. Specific embodiments are used to illustrate the principles and implementation methods of the invention. The descriptions of the embodiments above are only for the purpose of helping to understand the method and core ideas of the invention. At the same time, for those skilled in the art, there will be changes in the specific implementation methods and application scope based on the ideas of the invention. Therefore, the content of this specification should not be construed as a limitation of the invention.

Claims

1. Application of SNP loci in the identification of resistance to maize leaf spot disease, wherein the SNP locus is the SNP locus at position 155842030 on chromosome 9 with polymorphism G / A, and the reference genome is version B73_v5; in, If the SNP site is G, then the maize does not have resistance to small leaf spot; if the SNP site is A, then the maize has resistance to small leaf spot.

2. A method for identifying resistance to maize leaf spot disease, characterized in that, The method uses a probe as shown in SEQ ID NO:1, which is used to detect the SNP site as described in claim 1. Wherein, if the SNP site is G, then the maize does not have resistance to small leaf spot; if the SNP site is A, then the maize has resistance to small leaf spot.

3. A method for identifying resistance to maize leaf spot disease, characterized in that, The method employs a chip containing a probe as shown in SEQ ID NO:1, which is used to detect the SNP site as described in claim 1; Wherein, if the SNP site is G, then the maize does not have resistance to small leaf spot; if the SNP site is A, then the maize has resistance to small leaf spot.

4. The method according to claim 3, characterized in that, The chip also includes probes for identifying corn varieties.

5. A method for identifying resistance to maize leaf spot disease, characterized in that, The method employs a kit containing a probe as shown in SEQ ID NO:1, which is used to detect the SNP site described in claim 1; Wherein, if the SNP site is G, then the maize does not have resistance to small leaf spot; if the SNP site is A, then the maize has resistance to small leaf spot.

6. The method according to claim 5, characterized in that, The kit also contains dNTPs, DNA polymerase, MgCl2, and PCR reaction buffer.

7. The method according to claim 5 or 6, characterized in that, The kit also contains template DNA.

8. A method for identifying resistance to maize leaf spot disease, characterized in that, The method employs a kit containing a chip, the chip containing a probe as shown in SEQ ID NO:1, which is used to detect the SNP site as described in claim 1; Wherein, if the SNP site is G, then the maize does not have resistance to small leaf spot; if the SNP site is A, then the maize has resistance to small leaf spot.

9. The method according to claim 8, characterized in that, The kit also contains dNTPs, DNA polymerase, MgCl2, and PCR reaction buffer.

10. The method according to claim 8 or 9, characterized in that, The kit also contains template DNA.

Citation Information

Patent Citations

  • A DNA chip and its application in maize variety identification and breeding

    CN106544425B