Preparation method of double-enzyme inorganic functional nanoflower and application of double-enzyme inorganic functional nanoflower in preparation of competitive ELISA (enzyme-linked immuno sorbent assay) kit for detecting clonorchiasis sinensis

Abstract

The invention discloses a preparation method of a double-enzyme inorganic functional nanoflower and application of the double-enzyme inorganic functional nanoflower in preparation of a competitive ELISA (enzyme-linked immuno sorbent assay) kit for detecting clonorchiasis sinensis. Belongs to the technical field of clonorchis sinensis detection. The invention provides a preparation method of a double-enzyme-inorganic functional nanoflower composite material, which comprises the following steps: reacting clonorchis sinensis monoclonal antibody, HRP (horse radish peroxidase) and copper phosphate solution at room temperature for 12-48 hours, and coprecipitating to obtain the functional nanoflower composite material. By utilizing the characteristic that the HNFs can catalyze a substrate TMB, species limitation caused by a traditional enzyme-labeled secondary antibody is broken, the detection sensitivity is improved, and multi-host detection of clonorchis sinensis is realized.

Description

Technical Field

[0001] The invention belongs to the technical field of Clonorchis sinensis detection, and specifically relates to a preparation method of a dual-enzyme inorganic functional nanoflower and an application of the nanoflower in preparing a competitive ELISA kit for Clonorchis sinensis disease detection. Background Art

[0002] People with mild infection of clonorchiasis often have no symptoms, but the worsening of symptoms in the later stage seriously threatens people's health. The lack of effective diagnostic technology is an important reason for the failure to detect latent patients of the disease, resulting in the expansion of pollution and the increasing infection rate year by year. At present, there are no related products for detecting human clonorchiasis in the domestic and foreign markets, which seriously hinders the prevention and control of the disease. Immunological diagnostic technology has been widely used in various pathogens including parasites, but its sensitivity and specificity still have much room for improvement.

[0003] There are many types of terminal hosts of Clonorchis sinensis (humans, dogs, cats, pigs, etc.) and they are widely distributed. Companion animals such as dogs and cats have the same living environment as humans. Single transmission from humans is not enough to completely prevent and control Clonorchis sinensis. It is also necessary to monitor the infection frequency of each terminal host in the food chain at the same time to achieve the purpose of multi-angle and all-round prevention and control. Therefore, establishing a detection method for multiple hosts of Clonorchis sinensis for epidemiological monitoring is of great significance for controlling the prevalence of the disease. Summary of the invention

[0004] The purpose of the present invention is to improve the sensitivity of detecting Clonorchis sinensis antibodies and to improve the sensitivity and specificity of finding antibodies in serum samples with low-intensity infection.

[0005] The invention provides a method for preparing a dual-enzyme inorganic functional nanoflower composite material. The preparation method of the composite material is as follows: reacting a Clonorchis sinensis monoclonal antibody, HRP and a copper phosphate solution at room temperature for 12-48 hours, and obtaining the functional nanoflower composite material after coprecipitation.

[0006] It is further defined that the total volume is 50 mL, the mass ratio of Clonorchis sinensis monoclonal antibody to HRP is (1-3): (1-3), the concentration of the copper phosphate solution is 50 nM-200 nM, and PBS solution is added to dissolve to 50 mL.

[0007] It was further specified that the mass ratio of Clonorchis sinensis monoclonal antibody to HRP was 1:2, the concentration of the copper phosphate solution was 100 nM, and the reaction was carried out at room temperature for 24 hours.

[0008] It is further defined that the specific conditions of the co-precipitation are to collect the crystal precipitate by centrifugation at 12,000 r and 4° C. for 30 min, wash it three times with deionized water, and dry it at 30° C.

[0009] It is further specified that the monoclonal antibody against Clonorchis sinensis is obtained by secretion of a hybridoma cell line, and the hybridoma cell line has been deposited in the General Microbiology Center of China National Microbiological Culture Collection Administration, with the deposit number CGMCCNO.46128 and the deposit time being November 6, 2024.

[0010] The present invention provides a dual enzyme-inorganic functional nano flower composite material obtained by the above method.

[0011] The invention provides a Clonorchis sinensis antibody detection kit, which comprises the above-mentioned dual enzyme-inorganic functional nanoflower composite material.

[0012] It is further defined that the kit also includes an ELISA reaction plate, a Clonorchis sinensis CSTR1 antigen, a blocking solution, a sample diluent, a washing solution, a color development substrate and a stop solution.

[0013] It is further defined that the ELISA well reaction plate is coated with 7.5ug / mL of Clonorchis sinensis CsTR1 antigen, the blocking solution is 5% skim milk, the sample diluent is phosphate buffer, the washing solution is PBST, the color developing substrate is 30% H2O2 and 50mMTMB, and the stop solution is 2M H2SO4.

[0014] The present invention provides an application of the above-mentioned kit in a kit for detecting clonorchiasis sinensis.

[0015] Beneficial effects: McAb, HRP and Cu3(PO4)2 are used to generate bifunctional nanoflowers in a natural state to compete with the serum to be tested for binding to the CSTR1 antigen on the bottom of the plate. The content of HNFs bound to the bottom of the plate can be detected to obtain the content of CSTR1 antibodies in the serum to be tested. At the same time, the characteristic of HNFs itself that it can catalyze the substrate TMB is used to break the species restriction caused by traditional enzyme-labeled secondary antibodies, improve the sensitivity of detection, and realize the detection of multiple hosts of Clonorchis sinensis.

[0016] The method provided by the present invention can achieve the effect of catalyzing the TBM substrate without the need for the additional coupling of the monoclonal antibody with HRP, and can also play the role of catalyzing the TBM substrate without adding HRP.

[0017] The present invention provides a preparation of a monoclonal antibody-based dual enzyme-inorganic functional nanoflower (McAb-HRP@Cu-HNFs) and a competitive ELISA kit for multi-host detection of clonorchiasis sinensis, wherein the dual enzymes are CSTR1 monoclonal antibody (McAb) and horseradish peroxidase (HRP), and the inorganic carrier is copper phosphate. The monoclonal antibody in McAb-HRP@Cu-HNFs can specifically bind to the CSTR1 antigen of Clonorchiasis sinensis, and HRP can improve the ability to catalyze substrates. The competitive ELISA method established on this basis is sensitive, specific, and accurate, and can be used for the detection of multi-hosts (dogs, mice, and humans) of clonorchiasis sinensis. The preparation method of McAb-HRP@Cu-HNFs provided by the present invention is simple to operate, low in cost, mild in reaction conditions, simple and quick to operate, and has the advantages of strong specificity, high sensitivity, good repeatability, and large-scale diagnosis compared with traditional etiological diagnosis methods, providing technical support for multi-host detection of clonorchiasis sinensis.

[0018] [Biological preservation information]: A hybridoma cell line against the CSTR1 antigen of Clonorchis sinensis, named CSTR1-C3B4C10, has been deposited in the General Microbiology Center of China Microbiological Culture Collection Administration, with the deposit number CGMCCNO.46128 and the preservation date of November 6, 2024. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 The microscopic morphology of three nanoflowers under electron microscope;

[0020] Figure 2 The detection effect diagram of McAb-HRP@Cu-HNFs at different growth stages;

[0021] Figure 3 The optimization results of the nanoflower generation system are shown in Figure 1. A is the optimization result of the ratio of McAb and HRP, and B is the optimization result of Cu 2+ Concentration optimization result diagram;

[0022] Figure 4 The results of McAb-HRP@Cu-HNFs detection of multiple host serums are shown in Figure 1. A is the rabbit serum test result, B is the mouse serum test result, C is the dog serum test result, and D is the human serum test result.

[0023] Figure 5 The figure is the optimization result diagram of coating solution and coating time in McAb-HRP@Cu-HNFs-cELISA reaction system; A is the coating solution selection result diagram, and B is the coating time selection result diagram;

[0024] Figure 6The optimization results of the blocking solution and blocking time in the McAb-HRP@Cu-HNFs-cELISA reaction system are shown in Figure 1. A is the blocking solution selection result diagram, and B is the blocking time selection result diagram.

[0025] Figure 7 The figure is the optimization result diagram of the competitive incubation time and color development time in the McAb-HRP@Cu-HNFs-cELISA reaction system; A is the result diagram of the incubation time selection, and B is the result diagram of the color development time selection;

[0026] Figure 8 The results of the application evaluation of McAb-HRP@Cu-HNFs-cELISA in canine serum samples; A: defining the positive and negative critical values; B: determining the antibody titer curve; C: specificity test;

[0027] Fig. 9 The results of the application evaluation of McAb-HRP@Cu-HNFs-cELISA in mouse serum samples; A: defining the positive and negative critical values; B: determining the antibody titer curve;

[0028] Fig.10 The results of the application evaluation of McAb-HRP@Cu-HNFs-cELISA in human serum samples; A: defining the positive and negative critical values; B: determining the antibody titer curve; C: specificity test;

[0029] Fig.11 The results of the verification of the functionality of nanoflowers; A is the substrate that can be catalyzed by HRP-HNFs; B is the specific competitive recognition antibody of McAb-HNFs; C is the enhanced detection effect of McAb-HRP@Cu-HNFs. DETAILED DESCRIPTION

[0030] Example 1. Preparation of hybridoma cells

[0031] A polypeptide (KLH-GGKAPPPESA) was prepared based on the repeating unit of CSTR1 for mouse immunization. The polypeptide was prepared by Sangon Biotechnology (Shanghai) Co., Ltd.

[0032] (1) First immunization: Mix the prepared KLH-GGKAPPPESA (100 μg) with an equal amount of Freund's complete adjuvant, ultrasonicate until the emulsion is in water, and inject 200 μL / mouse subcutaneously at multiple points. Perform the second immunization 14 days later, with the same dosage as the first immunization, and try to avoid the first inoculation site. Perform the third immunization again after an interval of 14 days, with the same process as above. For the fourth immunization, no adjuvant is added, and intraperitoneal injection is used. Serum is collected 10 days later to detect antibody titer.

[0033] (2) Determination of mouse serum titer: KLH-GGKAPPPESA polypeptide was used as an ELISA coated antigen to detect the serum antibody titer of immunized mice, and non-immunized mouse serum was set up as a negative control. Finally, the maximum serum dilution with P / N>2.1 was taken as the mouse serum titer (Table 1).

[0034] Table 1 Detection of serum titer in immunized mice

[0035]

[0036] (3) Cell fusion. Take out the SP2 / 0 cells from liquid nitrogen, quickly put them in a 37℃ water bath to melt, then transfer them to a biosafety cabinet, centrifuge and remove the supernatant, resuspend them with 1mL DMEM basal medium, and transfer them to a culture bottle. Add an appropriate amount of complete medium, gently mix and culture in an incubator. After one day of culture, centrifuge and remove the supernatant, count and store at 4℃. Kill the experimental mice, disinfect them with 75% alcohol, cut open the abdomen to expose the peritoneum, inject the basal culture medium into the mouse abdominal cavity, press the abdominal cavity repeatedly and then aspirate the liquid into a centrifuge tube. After centrifugation, remove the supernatant, the bottom is the feeder layer cells, blow them away with 20% HAT complete medium, and plate 200μL / well on a 96-well plate for culture. Select mice with a CSTR1 antibody titer higher than 1:5000 after four immunizations, collect blood from the eyeballs, separate the serum, and store at -20℃ for later use.

[0037] The mice were then disinfected with 75% ethanol, and the spleen was removed and ground. Filtered with a sterile mesh and rinsed with basal culture medium. The rinse solution was collected and centrifuged to precipitate spleen cells, which were resuspended with basal culture medium and counted for later use. SP2 / 0 cells in the logarithmic growth phase were selected and mixed with spleen cells at a ratio of 1:5. The supernatant was removed by centrifugation, and the precipitate at the bottom of the centrifuge tube was gently knocked off. It was placed in a 37°C water bath, and preheated PEG 4000 was added (completed within 60 seconds). The centrifuge tube was gently shaken and allowed to stand for 30 seconds. The preheated basal culture medium was then added to terminate. The cells were resuspended with 20% HAT complete culture medium, spread onto a 96-well plate, and cultured in a 37°C, 5% CO2 incubator. 20% HAT DMEM complete culture medium was supplemented on days 4 and 8, respectively, and cell fusion was observed throughout the process.

[0038] (4) Screening and cloning of positive wells. On the 5th and 10th days after cell fusion, the cell culture supernatant was collected and added to each well of a 96-well plate at 100 μL. The plates were incubated at 37°C for 60 minutes, washed three times, and patted dry. Then, 100 μL of rabbit anti-mouse secondary antibody diluted 1:5,000 was added to each well. The plates were also incubated at 37°C for 60 minutes, washed three times, and patted dry. Then, 100 μL of TMB was added to each well. The plates were protected from light and color was developed for 15 minutes. Then, 100 μL of stop solution was added to terminate the reaction. The supernatant of SP2 / 0 cells was used as a negative control in the experiment. The absorbance value was read by an ELISA reader. The 31-B4-C10 cell line was screened out with the highest titer (Table 2).

[0039] Table 2 Indirect ELISA detection of cell line supernatant titer

[0040] Cell lines 6-E5-E7 17-H10-F10 19-G1-D4 26-C11-H8 27-F1-H9 <![CDATA[OD 450 ]]> 2.02 1.93 1.94 2.71 2.29 Cell lines 28-F6-D2 29-D10-D7 31-B4-C10 Negative control Positive Control <![CDATA[OD 450 ]]> 1.96 2.23 3.44 0.05 3.31

[0041] Select cells with high OD values ​​for expansion culture, freeze a portion, and subclone the other portion again. After mixing the liquid in the positive cell wells detected, transfer it to a 1.5mL centrifuge tube and centrifuge to remove the supernatant. Continue to subculture the cells to the 25th generation to obtain a stable hybridoma cell line. During the last culture, when the cells are in the logarithmic growth phase, freeze the cells, record the relevant information in detail, and store them in liquid nitrogen.

[0042] Preservation information of 31-B4-C10 cell line: A hybridoma cell line secreting monoclonal antibodies against Clonorchis sinensis, named CSTR1-C3B4C10, has been deposited in the General Microbiology Center of China Microorganism Culture Collection Administration, with the deposit number CGMCC NO.46128 and the preservation date of November 6, 2024.

[0043] (5) Preparation of monoclonal antibody ascites and titer determination. Female Balb / c mice were intraperitoneally injected with 0.5 mL of IFA to stimulate immune response. Nine days later, 0.5 mL of culture medium (containing 2×10 6 Hybridoma cells). Monitor the mental state and abdominal volume changes of mice daily. If the abdomen of the mouse is significantly swollen, collect ascites with a syringe and centrifuge at 5,000r for more than 20 minutes. The supernatant is the monoclonal antibody and is stored at -80℃ for later use.

[0044] The ascites was diluted in multiple ratios and plated on a 96-well plate, 100 μL / well, coated at 37°C for 60 minutes, washed three times with PBST and patted dry; HRP-labeled rabbit anti-mouse secondary antibody was added at a dilution of 1:5 000, 100 μL / well, incubated at 37°C for 60 minutes, washed three times with PBST and patted dry; single-component TMB substrate solution was added, 100 μL / well, color was developed at 37°C in the dark for 10 minutes; 2M sulfuric acid was added to terminate the reaction, 100 μL / well. The negative control was coated with SP2 / 0 cell ascites, and the rest of the operation steps were the same. The results were read by an ELISA reader, and the titer of mouse 31-B4-C10 ascites reached 1:32 000.

[0045] (6) Identification of monoclonal antibody subclasses. The ascites of mice injected with monoclonal antibodies was collected to identify the McAb of Clonorchis sinensis. The subclass of the monoclonal antibody was identified using IgG1, IgG2a, IgM, and IgA antibodies, respectively. The monoclonal antibody was of the IgG1 type.

[0046] Example 2. Preparation and verification of McAb-HRP@Cu-HNFs functional nanoflowers

[0047] 1. Preparation of McAb-HRP@Cu-HNFs functional nanoflowers: First, the McAb and HRP of Clonorchis sinensis obtained in Example 1 were diluted to 1 mg / mL with 0.1M PBS, and 30 μL of each of the two diluted solutions was added to 50 mL of 0.1M PBS solution, followed by 10 μL of copper phosphate solution (100 mM), and allowed to stand at room temperature for 24 hours. During this period, nanoflowers will gradually generate and increase, and blue crystals will form at the bottom. The entire liquid will be centrifuged at 12,000r at 4°C for 30 minutes to collect the crystal precipitate, which will be washed three times with deionized water, and the final crystal precipitate will be dried at 30°C to obtain a solid crystal powder, namely McAb-HRP@Cu-HNFs.

[0048] 2. Preparation of McAb@Cu--HNFs: The McAb of Clonorchis sinensis obtained in Example 1 was diluted to 1 mg / mL with 0.1M PBS, 30 μL of each of the two diluted solutions was added to 50 mL of 0.1M PBS solution, and then 10 μL of copper phosphate solution (100 mM) was added, and the mixture was allowed to stand at room temperature for 24 h. During this period, nanoflowers will gradually generate and increase, and blue crystals will form at the bottom. The entire liquid will be centrifuged at 12,000r at 4°C for 30 min to collect the crystal precipitate, which will be washed three times with deionized water, and the final crystal precipitate will be dried at 30°C to obtain a solid crystal powder.

[0049] 3. HRP@Cu--HNFs: HRP was diluted to 1 mg / mL with 0.1M PBS, and 30 μL of each of the two diluted solutions was added to 50 mL of 0.1M PBS solution, followed by 10 μL of copper phosphate solution (100 mM), and then allowed to stand at room temperature for 24 hours. During this period, nanoflowers will gradually form and increase, and blue crystals will form at the bottom. The entire liquid was centrifuged at 12,000r at 4°C for 30 minutes to collect the crystal precipitate, which was washed three times with deionized water, and the final crystal precipitate was dried at 30°C to obtain a solid crystal powder.

[0050] The dried McAb@Cu-HNFs, HRP@Cu-HNFs, and McAb-HRP@Cu-HNFs were diluted with deionized water to a concentration of 1 mg / mL, and 30 μL was added to a clean silicon wafer and placed in an incubator to dry naturally. After gold spraying, the microscopic morphology of the three nanoflowers was observed under a desktop scanning electron microscope. All three structures showed a typical "flower"-like morphology. HRP-HNFs was looser and had a larger specific surface area than the other two structures; McAb-HNFs had the densest morphology and resembled a rose; McAb-HRP@Cu-HNFs had a typical "petal"-like structure and had the largest surface area among the three. With a large surface area, there are more binding sites exposed on the surface, which is more conducive to binding to substrate-coated antigens ( Figure 1 ).

[0051] Compared with the detection effect of McAb@Cu-HNFs, McAb-HRP@Cu-HNFs can also achieve specific competitive binding to CRTR1 antibody in serum, and the 1-(P / N) value is improved, which is better than that of simple McAb@Cu-HNFs ( Fig.11 ).

[0052] The growth of nanoflowers includes three stages: nucleation, aggregation, and growth. As time goes by, more and more nanoflower crystals will be generated, and their morphology will change accordingly. Once the petals become tight, it is possible that the recognition site will be included, which will reduce the efficiency of antigen-antibody binding and affect the detection effect. McAb-HRP@Cu-HNFs grown for 12h, 24h, 36h, and 48h were prepared, and the microscopic state was observed by SEM, and the detection effect on rabbit Clonorchis sinensis negative and positive serum was detected by cELISA. Nanoflowers at different growth periods and their microscopic morphology were made, which also proved that loose structures have better detection effects.

[0053] At 12-24h, the overall structure of the nanoflowers was intact and loose, with a large specific surface area; at 36-48h, the nanoflowers gradually became compact, and some binding sites were blocked. The detection effect of 12-24h was significantly better than that of 36-48h. The amount of nanoflowers generated at 24h was significantly more than that at 12h. Combined with the maximum utilization rate and detection effect (P is a positive sample, N is a negative sample), McAb-HRP@Cu-HNFs was finally selected to grow to 24h ( Figure 2 PI=(1-OD Sample / OD Negative )×100%.

[0054] In the functionalized hybrid nanoflower system, McAb can specifically recognize antibodies, HRP can enhance the catalytic reaction, and the appropriate ratio can enhance the synergistic effect of the two. The McAb:HRP ratios were set at 3:1, 2:1, 1:1, 1:2, and 1:3. The results showed that the detection effect was best when the McAb:HRP addition ratio was 2:1 ( Figure 3 A).

[0055] Optimum Cu 2+ Concentration screening. Appropriate concentration of Cu 2+ This can achieve the maximum utilization of raw materials and avoid the interference of excess ions. 2+ The concentrations were set to 50nM, 75nM, 100nM, 125nM, 150nM, 175nM, and 200nM. The test results at 50-100nM were significantly better than those at 125-200nM. There was no difference in the test results between 50-100nM, but the amount of nanoflowers generated at 100nM was more. Finally, the optimal Cu2+ The concentration is 100 nM ( Figure 3 B).

[0056] The positive and negative serum of rabbit, mouse, dog and human were diluted with PBS according to the ratio of serum to be tested: McAb-HRP@Cu-HNFs=4:1, 3:1, 2:1, 1:1, 1:2, 1:3, 1:4, 1:10. The results showed that McAb-HRP@Cu-HNFs can be used to detect multi-host serum of Clonorchiasis sinensis, and the best effect was achieved when the ratio of serum to be tested: McAb-HRP@Cu-HNFs was 1:2 ( Figure 4 ).

[0057] Example 3. Kit for detecting Clonorchis sinensis antibodies

[0058] A Clonorchis sinensis antibody detection kit comprises: a dual enzyme-inorganic functional nanoflower composite material, an ELISA reaction plate, a Clonorchis sinensis CSTR1 antigen, a blocking solution, a sample diluent, a washing solution, a chromogenic substrate and a stop solution, wherein the ELISA well reaction plate is coated with 7.5 ug / mL Clonorchis sinensis CsTR1 antigen, the blocking solution is 5% skim milk, the sample diluent is a phosphate buffer, the washing solution is PBST, the chromogenic substrate is 30% H2O2 and TMB, and the stop solution is 2M H2SO4.

[0059] CSTR1 antigen amino acid sequence: (SEQ ID NO.1)

[0060] GGKAPPPESAGGKAPPPESAGGKAPPPESAGGKAPPPESAGGKAPPPESAGGKAPPPE SAGGKAPPPESAGGKAPPPESAGGKAPPPESAGGKAPPPESA;

[0061] CSTR1 antigen gene sequence: (SEQ ID NO.2)

[0062] GGCGGCAAGGCACCACCTCCTGAGTCAGCTGGCGGCAAGGCACCACCTCCTGAGTCAGCTGGCGGCAAGGCACCACCTCCTGAGTCAGCTGGCGGCAAGGCACCACCTCCTGAGTCAGCTGGCGGCAAGGCACCACCTCCTGAGTCAGCT GGCGGCAAGGCACCACCTCCTGAGTCAGCTGGCGGCAAGGCACCACCTCCTGAGTCAGCTGGCGGCAAGGCACCACCTCCTGAGTCAGCTGGCGGCAAGGCACCACCTCCTGAGTCAGCTGGCGGCAAGGCACCACCTCCTGAGTCAGCT.

[0063] Example 4. ELISA detection of antibodies

[0064] 1. Optimization of McAb-HRP@Cu-HNFs-cELISA reaction system: The chessboard method was used to screen the optimal coating concentration of the antigen and the optimal dilution multiple of the antibody. When the CSTR1 antigen was coated at 7.5ug / mL and the serum:McAb-HRP@Cu-HNFs ratio was 1:3, the detection effect was best (Table 1).

[0065] Table 1 Screening antigen coating concentration and antibody dilution multiple

[0066]

[0067] 2. Selection of dilution multiples of McAb-HRP@Cu-HNFs: McAb was diluted at 1:250, 1:500, 1:1 000, 1:2 000, 1:4 000, 1:6 000, 1:8 000, and 1:10 000, respectively, and then competitive incubation was carried out according to the optimal ratio of serum:McAb-HRP@Cu-HNFs. The results showed that the detection effect was best when McAb-HRP@Cu-HNFs was diluted at 1:1000.

[0068] 3. Optimization of coating solution and coating time: The five common coating solutions (PBS, CBS, NaCl, Tris, ddH20) all have certain detection effects, among which CBS has the best effect, with a PI value of 89% ( Figure 5 A) Further optimization of the coating time showed that the negative serum OD was 450 The value is basically around 1.2, but as time goes by, the OD of positive serum 450 As the PI value increases, the PI value decreases, so the coating time is selected as 12h ( Figure 5B).

[0069] 4. Optimization of blocking solution and blocking time: A suitable blocking solution can effectively reduce the non-specific binding of the reaction. After screening three blocking solutions (5% skim milk, 1% BSA, and 1% Casein), all of them have a certain effect, among which 5% skim milk has the best effect ( Figure 6 A). Further optimization of the blocking time showed that the PI value was the highest when the blocking time was 1.5 h ( Figure 6 B).

[0070] 6. Optimization of competitive incubation time and color development time: The competitive incubation time between the serum to be tested and the monoclonal antibody is an important factor in determining the quality of the entire reaction system. Insufficient reaction time will lead to insufficient antigen-antibody binding, while too long a time will cause non-specific binding. The serum to be tested was competitively incubated with McAb-HRP@Cu-HNFs for 0.5h, 1h, 1.5h, and 2h, respectively. The results showed that the PI value of the competitive incubation for 1h was the highest, and the detection effect was the best ( Figure 7 A).

[0071] The color development reaction is the last step of the monitoring system. The appropriate color development time is an important factor affecting the determination of positive and negative results. The color change produced by the catalytic substrate will deepen over time, and the impact of non-specific binding antigen-antibody complex will also become greater. By setting the gradient color development time of 5min, 10min, 15min, and 20min, the PI value of 10min color development is the highest, and the detection effect is the most ideal ( Figure 7 B).

[0072] 7. Optimization results of parameters of McAb-HRP@Cu-HNFs-cELISA: The final operation steps and judgment method of the McAb-HRP@Cu-HNFs-cELISA detection system are as follows: CSTR1 was diluted to 7.5μg / mL with CBS, 100μL was added to each well, and after coating for 12h at 4℃, PBST was shaken and washed for 3min / time, for a total of three times. 200μL of 5% skim milk (PBST dissolved) was added to each well for blocking, incubated at 37℃ for 1.5h, and PBST was shaken and washed for 3min / time, for a total of three times. McAb-HRP@Cu-HNFs was diluted with PBS at 1:1000, and then the serum to be tested and McAb-HRP@Cu-HNFs were mixed at 1:2 and added to the microplate (total volume 100μL), and the competition reaction was carried out at 37℃ for 1h, washed 3 times with PBST and the microplate was patted dry.

[0073] Add 100 μL of substrate (add color development solution substrate (30% H2O2 + 50 mM TMB) to each well, keep constant temperature at 37°C for 10 min to fully develop the color, and add 100 μL of sulfuric acid solution (2M) to stop the color development. Read the OD of the sample to be tested and the McAb solution on the microplate reader respectively. 450 Calculate the sample inhibition rate PI value.

[0074] Example 5. Evaluation of McAb-HRP@Cu-HNFs-cELISA in clinical samples

[0075] (1) Application of McAb-HRP@Cu-HNFs-cELISA in canine clinical samples

[0076] The optimized cELISA method was used to detect 53 canine negative serum samples and calculate the PI value of the serum to be tested. The average value was 32.91, the standard deviation was 5.11, and the cut-off value calculated by adding 2 times the standard deviation was 43.13% ( Figure 8 A). The serum of dogs artificially infected with Clonorchis sinensis at different stages was tested and the antibody titer curve was drawn. The results showed that the antibody positive conversion time detected by this method was 21 days after infection ( Figure 8 B). In detecting positive sera of dogs infected with different parasites, cELISA only specifically identifies positive sera of Clonorchis sinensis, and has no cross-reaction with sera of other parasites, with strong specificity ( Figure 8 C).

[0077] cELISA testing of canine clinical serum samples: 53 canine serum samples were tested using the optimized cELISA method, and the test results were compared with the fecal KK test method. The KK method detected 11 positive and 42 negative samples, while cELISA detected 12 positive and 41 negative samples (compared with the KK method, the sensitivity of this method was 100% and the specificity was 97.62% (Table 2) Table 2 Comparison of cELISA test results with KK method

[0078]

[0079] (2) Application of McAb-HRP@Cu-HNFs-cELISA in mouse clinical samples

[0080] 42 negative mouse serum samples were tested to calculate the positive and negative cutoff values. The optimized cELISA method was used to calculate the inhibition rate PI value of the serum to be tested. The average value was 25.63, the standard deviation was 6.19, and the cut-off value calculated by adding 2 times the standard deviation was 38.01% ( Fig. 9A). The antibody titer curve was drawn by testing the sera of mice artificially infected with Clonorchis sinensis at different stages. The results showed that the antibody positive conversion time detected by this method was 21 days after infection ( Fig. 9 B).

[0081] (3) Evaluation of McAb-HRP@Cu-HNFs-cELISA in human serum samples

[0082] 88 healthy human serum samples were tested to determine the cut-off value. The average value was 31.8 and the standard deviation was 7.87. The PI value calculated by adding the average value to twice the standard deviation was 47.54, which was used as the threshold of this method ( Fig.10 A). Detection of human Schistosoma japonicum, Trichinella spiralis, Toxoplasma gondii, Whipworm, Cysticercus, Ascaris, Hookworm, Echinocystis, Clonorchis sinensis positive serum and negative serum as control, this method only specifically identifies Clonorchis sinensis positive serum, no cross reaction with other types of parasites, specificity is strong ( Fig.10 B). In the sensitivity experiment, serum samples were divided into different infection levels according to the infection intensity detected by the modified Kato-Katz method in fecal samples (EPG: 0, 24, 48, 72, 96, 120, 144, 168, 192, 216, 240). The results showed that this method can identify serum samples with different infection intensities and can still effectively detect serum samples with low-intensity infection (EPG ≥ 24), with high sensitivity ( Fig.10 C);

[0083] EPG: The number of eggs per gram of feces is mainly based on the modified Kato-Katz method (KK method), which is currently the internationally recognized method for testing for clonorchiasis and the current standard for testing for clonorchiasis in the industry. Compared with the direct smear method, the modified Kato-Katz method can perform quantitative fecal sampling (42 mg), and the processed samples are more convenient to observe and can be used for quantitative testing of eggs.

[0084] Place the gauze above the stool sample, scrape the stool overflowing from the mesh back and forth, then take the stool quantitative plate (the depression in the middle is used to place the sample) and place it on the slide. After filling the quantitative plate, slowly remove it. Cover it with a strip of cellophane that has been treated with malachite green and glycerol in advance, and gently press it into an oval shape. Leave it at room temperature for 1 hour to allow the sample to become relatively transparent so that it can be observed under a microscope. To finally calculate the number of eggs per gram of feces (Eggs per gram, EPG), you need to multiply the number of eggs on each slide by 24.

[0085] cELISA detection of human clinical serum samples: The optimized cELISA method was used to detect 133 human serum samples, and the test results were compared with the fecal KK detection method. The KK method detected 59 positive and 74 negative samples, and McAb-HRP@Cu-HNFs-cELISA detected 61 positive and 72 negative samples. Compared with the KK method, the sensitivity of this method was 96.61% and the specificity was 94.59% (Table 3).

[0086] Table 3 Comparison of cELISA test results with KK method

[0087]

[0088] In summary, the present invention provides a method for preparing dual enzyme-inorganic functional nanoflowers, and on this basis, a competitive ELISA detection method for multi-host detection of Clonorchiasis sinensis is further established, which can be used for serological antibody detection of humans, dogs and mice infected with Clonorchiasis sinensis. The detection time of the constructed cELISA for artificially infected dog and mouse sera is 21 days after infection, and it has good specificity and no cross-reaction with dog / human sera infected with other parasites. The constructed cELISA has good detection performance, with a sensitivity of 100% and a specificity of 97.62% in canine clinical serum samples; the sensitivity is 96.61% and the specificity is 94.59% in human clinical serum samples, which provides technical guarantee for the detection and scientific prevention and control of multi-host Clonorchiasis sinensis.

Claims

1. A method for preparing a dual-enzyme inorganic functional nanoflower composite material, characterized in that: The preparation method of the composite material is as follows: reacting Clonorchis sinensis monoclonal antibody, copper phosphate solution and / or HRP at room temperature for 12-48 hours, and obtaining a functional nanoflower composite material after co-precipitation.

2. The method according to claim 1, characterized in that The total volume is 50 mL, the mass ratio of Clonorchis sinensis monoclonal antibody to HRP is (1-3): (1-3), the concentration of copper phosphate solution is 50 nM-200 nM, and PBS solution is added to dissolve to 50 mL.

3. The method according to claim 1, characterized in that The mass ratio of Clonorchis sinensis monoclonal antibody to HRP was 1:2, the concentration of copper phosphate solution was 100 nM, and the reaction was carried out at room temperature for 24 hours.

4. The method according to claim 1, characterized in that The specific conditions of the co-precipitation are to collect the crystal precipitate by centrifugation at 12,000 r and 4° C. for 30 min, wash it three times with deionized water, and dry it at 30° C.

5. The method according to claim 1, characterized in that The monoclonal antibody against Clonorchis sinensis is obtained by secretion of a hybridoma cell line, and the hybridoma cell line has been deposited in the General Microbiology Center of the China Culture Collection Administration, with the deposit number CGMCC NO.46128 and the deposit time being November 6, 2024.

6. A dual-enzyme-inorganic functional nanoflower composite material obtained by the method described in any one of claims 1 to 5.

7. A Clonorchis sinensis antibody detection kit, characterized in that: The kit comprises the dual-enzyme-inorganic functional nanoflower composite material according to claim 5.

8. The kit according to claim 7, characterized in that The kit also includes an ELISA reaction plate, a Clonorchis sinensis CSTR1 antigen, a blocking solution, a sample diluent, a washing solution, a color developing substrate and a stop solution.

9. The kit according to claim 7, characterized in that The ELISA well reaction plate was coated with 7.5ug / mL of Clonorchis sinensis CsTR1 antigen, the blocking solution was 5% skim milk, the sample diluent was phosphate buffer, the washing solution was PBST, the color substrate was 30% H2O2 and 50mM TMB, and the stop solution was 2M H2SO4.

10. Use of the kit according to any one of claims 7 to 9 in a kit for detecting clonorchiasis sinensis.

Images