Indirect ELISA kit for detecting infectious bovine rhinotracheitis virus infection antibody

Abstract

The invention discloses an indirect ELISA kit for detecting an infectious bovine rhinotracheitis virus infection antibody, and belongs to the technical field of biological detection. The kit comprises an ELISA plate coated with an antigen; the antigen is a recombinant BICP0 protein; the sequence of the coding gene of the recombinant BICP0 protein is as shown in SEQ ID NO. 2. On the basis of analyzing the specificity of the non-structural protein of the infectious bovine rhinotracheitis virus, the non-structural protein BICP0 which is efficiently expressed in escherichia coli after codon optimization is selected as a coating antigen, and an ELISA method for detecting the infectious bovine rhinotracheitis virus infection antibody is established. The kit can be used for detecting infection of infectious bovine rhinotracheitis in a non-immunized cattle farm and screening wild virus infected cattle in a cattle farm immunized with an infectious bovine rhinotracheitis inactivated vaccine in a high-throughput manner, immunization and detection elimination are combined, and the efficiency and effect of preventing and controlling the infectious bovine rhinotracheitis are improved.

Description

Technical Field

[0001] The invention relates to the technical field of biological detection, in particular to an indirect ELISA kit for detecting bovine infectious rhinotracheitis virus infection antibodies. Background Art

[0002] Infectious Bovine Rhinotracheitis (IBR) is an acute, febrile, contact-transmitted infectious disease of cattle caused by the Infectious Bovine Rhinotracheitis Virus (IBRV). Infected cattle may show respiratory symptoms, reproductive tract symptoms, abortion, decreased milk production and other symptoms, causing serious economic losses to the cattle industry.

[0003] The best way to prevent and control the disease is vaccination and purification and elimination. At present, there are two main vaccines for bovine infectious rhinotracheitis in my country: bovine viral diarrhea / mucosal disease, bovine infectious rhinotracheitis bivalent inactivated vaccine (Huaweit, Tiankang, Jinyu Baoling and other companies) and bovine infectious rhinotracheitis inactivated vaccine (C1 strain) (Beijing Shengtaier). These vaccines have good immunogenicity and are suitable for domestic bovine infectious rhinotracheitis disease prevention and control. However, bovine infectious rhinotracheitis virus has a wide range of infection routes, a high invisible infection rate, a long incubation period, and the vaccine has poor immune effect for some reason. In the case, individual cattle may still be infected in the immunized cattle farm, and as a source of infection, they continue to discharge pathogens, causing the disease to persist in the cattle farm. Therefore, it is necessary to test the immune cattle herd for wild virus infection antibodies, exclude wild virus infected cattle from the immunized cattle farm, and gradually purify the disease. This requires the establishment of a method for detecting wild virus infection. Virus isolation and identification, PCR testing and other methods of detecting pathogens can be implemented, but for invisible infections without viremia and virus release, it is difficult to collect suitable samples for testing. The most effective method for detecting wild virus infection is still antibody testing, because it has the advantages of long existence, easy sampling, and can be evaluated even if it is not in the infection period.

[0004] However, existing IBR antibody detection kits are all designed with virus structural proteins as antigens, and cannot distinguish wild virus infection antibodies from inactivated vaccine immune antibodies, and cannot screen wild virus infected cattle in immune cattle farms. To solve this problem, the present invention analyzes the specificity of bovine infectious rhinotracheitis virus encoded proteins, selects BICP0 non-structural protein as an antigen to develop a bovine infectious rhinotracheitis infection antibody detection kit with strong specificity, high sensitivity and good accuracy, which can not only be used to screen infected cattle from inactivated vaccine immune cattle farms for virus purification, but also can be used to screen infected cattle from non-immune cattle farms for direct purification, providing an effective means for better prevention and control of bovine infectious rhinotracheitis.

[0005] The existing methods for detecting bovine infectious rhinotracheitis infection include molecular biology methods such as PCR and qPCR, and serological methods such as ELISA. Molecular biology methods have high requirements for experimental conditions and personnel, and have a low detection throughput, making it difficult to meet the needs of large-scale rapid detection. At the same time, the detection of pathogens is only applicable to the infection stage, and cannot be performed on recovered animals, making it difficult to investigate the true extent and scope of the infection. Serological methods such as ELISA can detect antibodies and can detect viral infections for a long time, but they all use viral structural proteins as antigens. When using inactivated vaccines for immunization, they cannot distinguish between immune antibodies and wild virus infection antibodies, and cannot detect wild virus-infected cattle from immunized cattle farms. Summary of the invention

[0006] The purpose of the present invention is to provide an indirect ELISA kit for detecting antibodies against bovine infectious rhinotracheitis virus infection, so as to solve the problems existing in the above-mentioned prior art. The indirect ELISA kit provided by the present invention adopts the non-structural protein BICP0 efficiently expressed in Escherichia coli after codon optimization as the coating antigen, and can accurately detect bovine infectious rhinotracheitis virus infection in cattle farms immunized with inactivated vaccines and cattle farms that have not been immunized.

[0007] To achieve the above object, the present invention provides the following solutions:

[0008] The present invention provides an indirect ELISA kit for detecting bovine infectious rhinotracheitis infection antibodies, the kit comprising an ELISA plate coated with an antigen;

[0009] The antigen is recombinant BICP0 protein;

[0010] The coding gene sequence of the recombinant BICP0 protein is shown in SEQ ID NO.2.

[0011] Furthermore, the antigen-coated ELISA plate is prepared by the following steps:

[0012] A carbonate buffer solution containing recombinant BICP0 protein was added to a 96-well microplate, and the plate was coated at 37°C for 1 hour. Then, PBST containing 5% skimmed milk powder was added, and the plate was blocked at 37°C for 1 hour. The plate was washed and patted dry.

[0013] Furthermore, in the carbonate buffer solution, the concentration of the recombinant BICP0 protein is 1 μg / mL.

[0014] Furthermore, it also includes washing solution, diluent, enzyme-labeled secondary antibody, color development solution, stop solution, standard IBRV-positive serum and standard IBRV-negative serum.

[0015] Furthermore, the washing solution and diluent are both PBST solutions; the enzyme-labeled secondary antibody is HRP-labeled goat anti-bovine IgG;

[0016] The color developing solution is TMB solution; the stop solution is 10% sulfuric acid solution.

[0017] The present invention also provides a method for detecting bovine infectious rhinotracheitis infection antibodies for non-disease diagnosis purposes, comprising the step of using the kit to detect bovine infectious rhinotracheitis infection antibodies.

[0018] Further, the following steps are included:

[0019] Add 20-fold diluted standard IBRV positive serum, standard IBRV negative serum and the sample to be tested to the antigen-coated ELISA plate, incubate at 37° C. for 30 min, and wash the plate 5 times with PBST after incubation;

[0020] Add 100 μL of 5000-fold diluted enzyme-labeled secondary antibody to each reaction well and incubate at 37°C for 30 min. After incubation, wash the plate 5 times with PBST;

[0021] Add 100 μL of color development solution to each reaction well and react in the dark until the solution turns obviously blue;

[0022] After adding 50 μL of stop solution to each reaction well to terminate the reaction, read the OD value using a microplate reader. 450 Value, according to OD 450 The value determines the test result.

[0023] Furthermore, when the OD of the sample to be tested 450 When the value is ≥0.213, it is judged as positive. 450 When the value is less than 0.213, it is judged as negative.

[0024] The present invention discloses the following technical effects:

[0025] Based on the analysis of the specificity of the non-structural protein of bovine infectious rhinotracheitis virus, the present invention selects the non-structural protein BICP0 that is efficiently expressed in Escherichia coli after codon optimization as the coating antigen. The ELISA method of the bovine infectious rhinotracheitis virus infection antibody can not only be used to detect the infection of bovine infectious rhinotracheitis in unimmunized cattle farms, but also can be used to screen wild virus-infected cattle in cattle farms immunized with the inactivated bovine infectious rhinotracheitis vaccine with high throughput, and can combine immunization with detection elimination to improve the efficiency and effect of preventing and controlling bovine infectious rhinotracheitis.

[0026] The indirect ELISA kit for detecting bovine infectious rhinotracheitis virus infection antibodies provided by the present invention can specifically detect bovine infectious rhinotracheitis wild virus infection antibodies and has no cross reaction with other virus infection antibodies; positive control serum and negative control serum are set, and the experimental conditions are strictly controlled to improve the accuracy and reliability of the detection, and the bovine infectious rhinotracheitis virus infection in inactivated vaccine immunized cattle farms and non-immunized cattle farms can be accurately detected. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0028] Figure 1 is the BLASTP alignment of BICP0 protein;

[0029] Figure 2 This is the electrophoresis diagram of the purification of BICP0 protein;

[0030] Figure 3 The positive and negative samples detected by the ELISA test kit in Example 4;

[0031] Figure 4 This is the ROC curve of the detection results of the self-constructed ELISA detection kit of the present invention in Example 4. DETAILED DESCRIPTION

[0032] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0033] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0034] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0035] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0036] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0037] Example 1

[0038] 1. Bioinformatics analysis of BICP0

[0039] The protein sequence of BICP0 was obtained from the NCBI website, and its full length and antigen epitope were analyzed by BLASTP ( Figure 1 ) to determine its specificity as an antigen.

[0040] 2. Preparation of recombinant BICP0 protein

[0041] According to the gene sequence of bovine infectious rhinotracheitis BICP0 protein (SEQ ID NO.1), codon optimization was performed to obtain a gene sequence (SEQ ID NO.2) that can be efficiently expressed in Escherichia coli. After gene synthesis, the gene was inserted into the pET28a expression vector and transfected into BL21 (DE3) Escherichia coli. After culture, the protein was induced by IPTG and affinity purified to prepare a high-purity recombinant BICP0 protein.

[0042] SEQ ID NO.1:

[0043] atgcgcgacctgggccataaaagccccgcgcatgcgcgagcagttactttcggtttggggatgacagcggcgactgcggctcgaaagttaagtatgcaggctgggggtcgcaaatacacggcggtgcggtgtggtgggctgcgggtcgcggagtgggtgggcggggagccggccgcggcgattattgccgccaggcgctgccgccgctgcagcggccgagcagcccggccaggctcgggccctggcgaccgcctggctgcggcgccagggccgcgctgctgcggcggggggtccccaggaggctttctcgcacccaggcggccacttccatttcggtgcgccgcctcttctgcgccgagctctcggggccggggtccaggtcgccccgcgccatggcgctcgctggccttctctcccggccggggttgccattgcggccgacctcggcccgggcggctccggccagggccggagcgccggcccgccgggggtcggcggcaggggcgcggccggcgggagacggggtcggggctcgggtggaaatag;

[0044] SEQ ID NO.2:

[0045] .

[0046] Example 2 Establishment of an indirect ELISA kit for detecting antibodies to bovine infectious rhinotracheitis virus infection

[0047] The ELISA plate was coated with BICP0 protein, and then incubated with the serum to be tested and HRP-labeled goat anti-bovine IgG for color development, and the OD was read with an ELISA reader. 450 value and make a decision on the result.

[0048] Specifically, the present invention provides an ELISA antibody detection kit for bovine infectious rhinotracheitis, comprising the following components:

[0049] ELISA plate: ELISA plate coated with antigen (recombinant BICP0 protein prepared in Example 1, concentration of 1 μg / mL);

[0050] Washing and dilution solution: PBST solution;

[0051] Enzyme-labeled secondary antibody: HRP-labeled goat anti-bovine IgG;

[0052] Color developing solution: TMB solution;

[0053] Stop solution: 10% (V / V) sulfuric acid solution;

[0054] Standard IBRV-positive serum;

[0055] Standard IBRV negative serum.

[0056] The preparation method of the ELISA plate coated with antigen is as follows:

[0057] 100 μL of carbonate buffer solution containing 1 μg / mL recombinant BICP0 protein was added to a 96-well microplate, and the plate was placed in a 37°C incubator for 1 hour for coating. Then, 200 μL of PBST containing 5% skimmed milk powder was added and the plate was blocked at 37°C for 1 hour to obtain an antigen-coated ELISA plate.

[0058] The judgment threshold of the result is OD 450 =0.213. When the OD of the sample 450 It was considered positive when the value was ≥0.213, otherwise it was considered negative.

[0059] Example 3

[0060] The indirect ELISA kit for detecting bovine infectious rhinotracheitis virus infection antibodies established in Example 2 was used to detect the positive and negative sera of cattle (15 wild-type positive sera, 42 IBRV immune positive sera and negative sera) and positive sera of common infectious diseases (pasteurellosis, mannenberg disease, Clostridium perfringens disease, foot-and-mouth disease, BVDV, nodular dermatosis, mycoplasma disease). The specific method is as follows:

[0061] Add 20-fold diluted standard IBRV positive serum, standard IBRV negative serum or the sample to be tested to the ELISA plate coated with antigen, incubate at 37°C for 30 min, and wash the plate 5 times with PBST after incubation;

[0062] Then, 100 μL of 5000-fold diluted enzyme-labeled secondary antibody (HRP-labeled goat anti-bovine IgG) was added to each reaction well and incubated at 37°C for 30 min. After incubation, the plate was washed 5 times with PBST; the diluent for serum and secondary antibody was PBST solution containing 5% skim milk powder;

[0063] Add 100 μL of colorimetric solution (TMB solution) to each reaction well and color for 20 min in the dark until the solution turns a distinct blue color;

[0064] After adding 50 μL of stop solution (10% sulfuric acid solution) to each reaction well to terminate the reaction, the OD was read using an ELISA reader. 450 Value, OD of the test sample 450 It was considered positive when ≥0.213.

[0065] The results are shown in Table 1. Only the wild-type positive serum OD 450≥0.213, the test result is positive, and the test results of immune-positive serum and other positive serum are all negative, showing the accuracy of the test.

[0066] Table 1 Test results of positive and negative serum of cattle and positive serum of common infectious diseases

[0067]

[0068] Example 4 Compliance Detection

[0069] The indirect ELISA test kit for bovine infectious rhinotracheitis wild virus antibodies established in Example 2 was used in conjunction with the IBRS-5P ID The bovine infectious rhinotracheitis virus ELISA antibody test kit was used to test serum samples from 96 non-immunized cattle farms, and the results were based on the commercial kit, e.g. Figure 3 , Figure 4 As shown, the accuracy of the self-built ELISA detection kit was 96%, the sensitivity was 100%, and the specificity was 96%, showing a good detection effect.

[0070] Example 5 Diagnosis of infectious rhinotracheitis infection in unimmunized cattle

[0071] In a cattle farm that has not been immunized with inactivated bovine infectious rhinotracheitis vaccine, blood was collected from the jugular vein of 30 cattle, and the serum was separated by centrifugation. A blind test was performed according to the method of Example 3.

[0072] Results: 6 serum test results were positive, indicating that 6 cows had been infected with bovine infectious rhinotracheitis virus. After PCR verification, the test results of the present invention were consistent with the actual infection situation of the animals.

[0073] Example 6 Detection of infectious rhinotracheitis infection in cattle on immunized cattle farms

[0074] In a cattle farm that had been immunized with an inactivated bovine infectious rhinotracheitis vaccine, blood was collected from the jugular vein of 50 cattle, and the serum was separated by centrifugation. A blind test was performed according to the method of Example 3.

[0075] Results: Two serum test results were positive, indicating that two cows had antibodies to bovine infectious rhinotracheitis virus infection and had been infected with bovine infectious rhinotracheitis virus. After PCR verification, the test results of the present invention were consistent with the actual infection situation of the animals.

[0076] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. An indirect ELISA kit for detecting bovine infectious rhinotracheitis infection antibodies, characterized in that: The kit includes an ELISA plate coated with an antigen; The antigen is recombinant BICP0 protein; The coding gene sequence of the recombinant BICP0 protein is shown in SEQ ID NO.

2.

2. The kit according to claim 1, characterized in that The antigen-coated ELISA plate is prepared by the following steps: A carbonate buffer solution containing recombinant BICP0 protein was added to a 96-well microplate, and the plate was coated at 37°C for 1 hour. Then, PBST containing 5% skimmed milk powder was added, and the plate was blocked at 37°C for 1 hour. The plate was washed and patted dry.

3. The kit according to claim 2, characterized in that In the carbonate buffer solution, the concentration of the recombinant BICP0 protein was 1 μg / mL.

4. The kit according to claim 1, characterized in that It also includes washing solution, diluent, enzyme-labeled secondary antibody, color development solution, stop solution, standard IBRV-positive serum and standard IBRV-negative serum.

5. The kit according to claim 4, characterized in that The washing solution and diluent are both PBST solutions; The enzyme-labeled secondary antibody is HRP-labeled goat anti-bovine IgG; The color developing solution is TMB solution; The stop solution is 10% sulfuric acid solution.

6. A method for detecting bovine infectious rhinotracheitis infection antibodies for non-disease diagnosis purposes, characterized in that: The method comprises the step of using the kit described in any one of claims 1 to 5 to detect bovine infectious rhinotracheitis infection antibodies.

7. The method according to claim 6, characterized in that The following steps are involved: Add 20-fold diluted standard IBRV positive serum, standard IBRV negative serum and the sample to be tested to the antigen-coated ELISA plate, incubate at 37° C. for 30 min, and wash the plate 5 times with PBST after incubation; Add 100 μL of 5000-fold diluted enzyme-labeled secondary antibody to each reaction well and incubate at 37°C for 30 min. After incubation, wash the plate 5 times with PBST; Add 100 μL of color development solution to each reaction well and react in the dark until the solution turns obviously blue; After adding 50 μL of stop solution to each reaction well to terminate the reaction, read the OD value using a microplate reader. 450 Value, according to OD 450 The value determines the test result.

8. The method according to claim 7, characterized in that When the OD of the sample to be tested 450 When the value is ≥0.213, it is judged as positive. 450 When the value is less than 0.213, it is judged as negative.

Images