Preparation method and application of 5-fluorouracil-quercetin-DNA hydrogel

Abstract

The present invention provides a method for preparing a 5-fluorouracil-quercetin-DNA hydrogel, comprising mixing a first DNA primer and a linear template, heating and annealing for assembly, adding a T4 ligase reaction to connect, and forming a circular DNA template; adding dATP, dCTP, dGTP, 5F-dUTP, DTT, DNA polymerase and DNA polymerase buffer to the circular DNA template obtained above, and performing an RCA reaction; adding a second DNA primer and a third DNA primer to the above RCA product, performing a multi-primer chain amplification reaction, and obtaining a 5-fluorouracil-DNA hydrogel; fully mixing and incubating a quercetin solution with the above-mentioned 5-fluorouracil-DNA hydrogel to obtain a 5-fluorouracil-quercetin-DNA hydrogel. The present invention also provides the use of the above-mentioned 5-fluorouracil-quercetin-DNA hydrogel in the preparation of anti-tumor drugs. The present invention solves the problems of severe toxic and side effects of chemotherapeutic drugs and poor immunotherapy effects caused by immunosuppressive tumor microenvironment.

Description

Technical Field

[0001] The invention belongs to the field of biomedicine and relates to a hydrogel, specifically a preparation method and application of a 5-fluorouracil-quercetin-DNA hydrogel. Background Art

[0002] As a representative treatment for triple-negative breast cancer (TNBC), chemoimmunotherapy has not been widely used in clinical practice due to the toxic side effects of chemotherapeutic drugs and the poor immune response caused by the immunosuppressive tumor microenvironment (TME). 5-Fluorouracil (5FU) and its prodrug capecitabine are the main treatments for TNBC. However, in clinical study reports on the use of capecitabine in TNBC patients, most patients experienced treatment-related adverse events. The clinical application of 5FU is also often weakened by its rapid first-pass metabolism and short plasma half-life. Therefore, there is an urgent need to explore new drug delivery methods to prolong its duration of action, improve therapeutic efficacy, and reduce systemic toxicity. Some chemotherapeutic drugs have been shown to enhance cancer immunotherapy by inducing immunogenic cell death (ICD), while TNBC patients usually have a weakened response to immunotherapy due to the immunosuppressive TME. Among them, tumor-associated macrophages (TAMs) are the most abundant immune cells in the TME, inducing immunosuppression through multiple pathways and maintaining a robust immunosuppressive microenvironment. Therefore, strategies to reduce intratumoral macrophage infiltration to reshape the tumor microenvironment may effectively restore the ability of TNBC to induce ICD and promote specific antitumor immune responses.

[0003] C-C motif chemokine ligand 2 (CCL2) is a chemoattractant secreted by tumors and plays an important role in macrophage recruitment. Inhibition of CCL2 secretion can reduce macrophage aggregation by more than 50% and delay tumor progression. Therefore, a two-pronged approach combining induction of ICD to enhance antitumor immunity with blockade of CCL2 to counteract the immunosuppressive TME may be a new potential effective strategy to enhance the effectiveness of immunotherapeutic interventions. Quercetin (Que), as a naturally derived flavonoid, has multifaceted pharmacological effects such as anti-inflammatory and anti-aging properties, as well as a good safety profile. Recent studies have shown that Que can significantly inhibit CCL2 expression, but the limited water solubility and unsatisfactory bioavailability of Que hinder its further clinical application.

[0004] DNA hydrogels have good biocompatibility, biodegradability, and programmable and embeddable properties, which may be a breakthrough in solving the above challenges. By using simple rolling circle amplification (RCA) and multi-primer chain amplification (MCA) to construct a DNA hydrogel, it is expected to achieve efficient drug loading and sustained release, thereby optimizing drug delivery and enhancing the synergistic effect of chemoimmunotherapy. Summary of the invention

[0005] In view of the above technical problems in the prior art, the present invention provides a preparation method and use of a 5-fluorouracil-quercetin-DNA hydrogel. The preparation method and use of the 5-fluorouracil-quercetin-DNA hydrogel are intended to solve the technical problem that the drugs in the prior art are not effective in treating triple-negative breast cancer.

[0006] The present invention provides a method for preparing a 5-fluorouracil-quercetin-DNA hydrogel, comprising the following steps:

[0007] (1) The first DNA primer and the linear template are mixed, heated and annealed for assembly, T4 ligase is added for ligation to form a circular DNA template (circ-DNA), and then the T4 ligase is inactivated by heating to terminate the reaction;

[0008] The sequence of the first DNA primer is: 5'-TAGGAACATCAAACGACAGCCA-3';

[0009] The sequence of the linear template is: 5'-Phosphate-TCGTTTGATGTTCCTAACGTACCAACGCACACGCAGTATTATGGACTGGTAAAAGCGCAGCATCAGGAACGTCATGGAGCAGGCATTGGCTG-3';

[0010] (2) adding dATP, dCTP, dGTP, 5F-dUTP, DTT, DNA polymerase and DNA polymerase buffer to the circular DNA template obtained in step (1) to perform a rolling circle amplification reaction;

[0011] (3) adding the second DNA primer and the third DNA primer to the product obtained by the above rolling circle amplification (RCA) reaction to perform a multi-primer chain amplification reaction to obtain a 5-fluorouracil-DNA hydrogel, and then heating to inactivate the DNA polymerase to terminate the reaction;

[0012] The sequence of the second DNA primer is: 5'-ACGCAGTATTATGGACTG-3'

[0013] The sequence of the third DNA primer is: 5'-GCTCCATGACGTTCCTGATGCTGC-3;

[0014] (4) The quercetin solution is fully mixed with the above-mentioned 5-fluorouracil-DNA hydrogel and incubated to obtain 5-fluorouracil-quercetin-DNA hydrogel.

[0015] Furthermore, in step (1), the concentrations of the first DNA primer and the linear template reaction were both 0.5 μM, the reaction solution for the DNA primer and linear template assembly was 1×T4 ligase buffer, and the conditions for the heating annealing assembly were heating at 95°C for 2 min and heating at -1°C for 1 min. -1 The rate is gradually cooled from 95°C to 4°C;

[0016] The concentration of T4 ligase used was 10 U μL -1 The ligation reaction conditions are incubation at 4°C overnight. In step (1), the reaction termination condition is heating at 65°C for 10 min.

[0017] Furthermore, in step (2), the final reaction volume is 100 μL, of which the circular DNA template reaction volume is 20 μL;

[0018] The reaction concentrations of dATP, dCTP, dGTP, and 5F-dUTP were all 100 mM, and the volumes were all 2.5 μL;

[0019] The DTT reaction concentration was 100 mM, and the volume was 2 μL;

[0020] EquiPhi29 DNA polymerase working concentration is 10UμL -1 , volume 1 μL;

[0021] The reaction solution was 1× EquiPhi29 DNA polymerase buffer;

[0022] The RCA reaction conditions are incubation at 30-42°C for 4 hours.

[0023] Furthermore, in step (3), the reaction concentrations of the second DNA primer and the third DNA primer are both 500 μM, and the volumes are both 1 μL;

[0024] The MCA reaction conditions are incubation at 30-42°C for 16 hours; in step (3), the reaction termination condition is heating at 65°C for 10 minutes.

[0025] Furthermore, in step (4), the concentration of the quercetin solution is 4 mg mL -1 ;

[0026] The incubation volume ratio of quercetin solution to 5-fluorouracil-DNA hydrogel was 1:1;

[0027] The quercetin and 5-fluorouracil-DNA hydrogel incubation conditions are incubation at room temperature in the dark for 6 hours.

[0028] The present invention also provides a 5-fluorouracil-quercetin-DNA hydrogel obtained by the above-mentioned preparation method.

[0029] The present invention also provides the use of the above 5-fluorouracil-quercetin-DNA hydrogel in the preparation of anti-tumor drugs.

[0030] Furthermore, the tumor is triple-negative breast cancer.

[0031] The present invention is based on multi-primer amplification technology, adopts rolling circle amplification (RCA) and multi-primer chain amplification (MCA) methods, and uses nucleoside analog 5FU to replace traditional nucleoside units as raw materials for amplification reaction to construct DNA hydrogel without changing the DNA molecular structure. At the same time, quercetin can be embedded in the DNA groove, and quercetin and DNA hydrogel are compounded to improve the delivery efficiency and water solubility of quercetin, and finally a 5-fluorouracil-quercetin-DNA hydrogel (5FU-QueDNAgel) is obtained.

[0032] The 5-fluorouracil-quercetin-DNA hydrogel preparation method proposed in the present invention is obtained by using RCA and MCA two-step amplification reactions. In the traditional DNA amplification reaction, dNTP (dATP, dTTP, dCTP and dGTP) is an essential component. The present invention uses 5F-dUTP instead of dTTP, one of the raw materials, to form a DNA hydrogel composed of 5-fluorouracil, and the product is translucent at this time. Further, incubation with a quercetin solution is performed to achieve loading of quercetin, and the final product is a brown-yellow hydrogel. The hydrogel is composed of densely arranged, uniformly sized (3 to 5 μm) nanoflowers intertwined with each other. The hydrogel can be continuously delivered through a 1mL syringe needle without clogging, and remains in a gel state after injection, and is suitable for subsequent in vivo injection administration.

[0033] After local administration, the DNA hydrogel of the present invention can be gradually degraded by enzymes to maintain the sustained release of 5-fluorouracil and quercetin, minimizing the damage to healthy tissues and organs caused by off-target effects. The released quercetin reduces the recruitment of macrophages by tumors by downregulating the secretion of CCL2, thereby reversing and reshaping the immunosuppressive microenvironment. At the same time, 5-fluorouracil can inhibit tumor cell proliferation and induce ICD to enhance tumor immunogenicity. The DNA hydrogel can stimulate a significant specific anti-tumor immune response, thereby enhancing the anti-tumor efficacy.

[0034] Compared with the prior art, the present invention has the following beneficial effects:

[0035] (1) The 5-fluorouracil-quercetin-DNA hydrogel obtained by the present invention fully utilizes the characteristics of DNA hydrogel to achieve the loading of multiple drugs. On the one hand, the principle that fluorouracil replaces thymine does not affect the complementary pairing of DNA bases. In the amplification reaction, 5-fluorouracil is used to replace the reaction raw material dTTP to achieve the loading of 5-fluorouracil. On the other hand, the embeddability of DNA is utilized to embed quercetin into the DNA groove to achieve the loading of quercetin.

[0036] (2) The preparation method of the present invention is simple and suitable for large-scale production. The hydrogel is injectable and can be degraded by enzymes at the tumor site to achieve sustained release of drugs.

[0037] (3) The DNA hydrogel of the present invention can load and continuously release two drugs, quercetin and 5-fluorouracil. Through a two-pronged approach, it can solve the problems of serious toxic side effects of chemotherapy drugs and adverse immune responses caused by immunosuppressive tumor microenvironment, improve the effect of tumor chemotherapy immunotherapy, and provide a safe and effective treatment strategy for TNBC, which has good clinical transformation prospects. On the one hand, quercetin downregulates CCL2 secretion, reduces tumor recruitment of macrophages, and reshapes the immunosuppressive TME. On the other hand, local administration of 5-fluorouracil inhibits tumor cell proliferation while reducing systemic toxicity, and induces ICD to enhance tumor immunogenicity. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 This is a real image of 5FU-Que DNA gel.

[0039] Figure 2 This is the non-denaturing polyacrylamide gel electrophoresis characterization diagram of 5FU-Que DNAgel.

[0040] Figure 3 This is a scanning electron microscopy image of 5FU-Que DNA gel.

[0041] Figure 4 The scanning electron microscopy images of 5FU-Que DNAgel after incubation with DNase I enzyme and the release rate statistics of 5FU and quercetin.

[0042] Figure 5 This is the cell viability statistics after 4T1 tumor cells were treated with 5FU-Que DNAgel.

[0043] Figure 6 This is a test of 5FU-Que DNA gel-induced ICD in 4T1 tumor cells.

[0044] Figure 7It is the detection of CCL2 expression level after 4T1 tumor cells were treated with 5FU-Que DNAgel.

[0045] Figure 8 This is a test of the inhibition of macrophage migration by 5FU-Que DNAgel.

[0046] Fig. 9 Tumor volume statistics and tumor images during 5FU-Que DNAgel treatment of 4T1 tumor-bearing mice.

[0047] Fig.10 The biosafety of 5FU-Que DNAgel during treatment of 4T1 tumor-bearing mice. DETAILED DESCRIPTION

[0048] The present invention is further described below in conjunction with specific examples. It should be understood that the following examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples that do not specify specific conditions are selected according to conventional methods and conditions or according to the product specifications, and the raw materials can be obtained from public commercial channels unless otherwise specified.

[0049] Example 1 DNA sequence design for 5FU-Que DNA gel synthesis process. The DNA sequence in the table can be replaced by other DNA sequences while ensuring that the linear template and primers can hybridize to perform subsequent amplification reactions.

[0050] Table 1 DNA sequences involved in the examples

[0051]

[0052] Example 2 Preparation of 5FU-Que DNA gel

[0053] The reaction mixture for synthesizing circular DNA template (circ-DNA) consisted of 0.5 μM linear template, 0.5 μM first DNA primer, and 1× T4 ligation buffer. -1 The rate was gradually cooled from 95°C to 4°C. After annealing, T4 DNA ligase (10 U μL -1 , NEB) and incubated at 4°C overnight.

[0054] Furthermore, T4 DNA ligase was inactivated by heating at 65°C for 10 min.

[0055] The circ-DNA synthesized in the above steps (sequence is the same as the linear template) was used as the RCA template. The final volume of each reaction was 100 μL, including circ-DNA template (20 μL), dATP (100 mM, 2.5 μL), dCTP (10 mM, 2.5 μL), dGTP (100 mM, 2.5 μL), 5F-dUTP (100 mM, 2.5 μL), DTT (100 mM, 2 μL), EquiPhi29 DNA polymerase (1 μL, 10 U μL -1 ) and EquiPhi29 DNA polymerase buffer (10×, 10 μL). The reaction mixture was mixed thoroughly and incubated at 40° C. for 4 h for the following reaction.

[0056] Further, the second DNA primer (500 μM, 1 μL) and the third DNA primer (500 μM, 1 μL) were added to the above RCA product and the reaction was continued for 16 h, which was the MCA reaction. The EquiPhi29 DNA polymerase was inactivated by heating at 65° C. for 10 min to obtain 5-fluorouracil-DNA hydrogel (5FU DNAgel).

[0057] Furthermore, quercetin solution (4 mg mL -1 , 100 μL) was fully mixed with 5FU DNAgel (100 μL), and incubated at room temperature for 6 h to obtain the 5-fluorouracil-quercetin-DNA hydrogel (5FU-Que DNAgel) of the present invention.

[0058] The experimental results are as follows Figure 1 As shown, after the reaction of RCA and MCA, the translucent hydrogel 5FU DNAgel was successfully synthesized, and the 5FU DNAgel was incubated with the quercetin solution at room temperature in the dark for 6 hours to obtain the 5FU-Que DNAgel of the present invention.

[0059] After quercetin loading, the translucent hydrogel was observed to change into a uniform brown-yellow hydrogel ( Figure 1 a). 5FU-Que DNA gel was drawn and injected using a 1 mL syringe. The product was able to pass through the needle continuously without clogging and remained in a gel state after injection, indicating that the 5FU-Que DNA gel of the present invention is suitable for in vivo injection ( Figure 1 b).

[0060] Example 3 Characterization of 5FU-Que DNA gel

[0061] To verify the success of template cyclization and RCA reaction, DNA marker, linear template, first DNA primer, circular DNA template, RCA product and 5F-dUTP RCA product were electrophoresed in 10% non-denaturing polyacrylamide gel electrophoresis at 100 V for 2 hours. The gel was stained with 4SGelred dye according to the manufacturer's operating procedures, and luminescence and analysis were performed using Bio-red chemiluminescence instrument (Bio-Rad, USA).

[0062] The synthesized 5FU-Que DNA gel was characterized by scanning electron microscopy (SEM). The synthesized hydrogel was treated with gradient ethanol solution and then completely dehydrated using EM CPD300 critical point dryer (Leica, Germany) for SEM analysis. SEM images were obtained using SU8230 scanning electron microscope (Hitachi, Japan).

[0063] The experimental results are as follows Figure 2 As shown, polyacrylamide gel electrophoresis analysis revealed the formation of circular DNA products. Due to structural changes, the band migration rate of circular DNA templates was slower than that of linear DNA templates. RCA reaction was carried out in the presence of EquiPhi29 DNA polymerase. The results of polyacrylamide gel electrophoresis showed that the products formed by 5F-dUTP were blocked in the gel pores, similar to the products formed by conventional dTTP raw materials, indicating that the amplification reaction proceeded smoothly.

[0064] The experimental results are as follows Figure 3 As shown, Figure 3 a is a large field of view of the DNA hydrogel under a scanning electron microscope. Figure 3 b is a partial magnified scanning electron microscope image of the DNA hydrogel. The scanning electron microscope image shows that the DNA hydrogel of the present invention is composed of densely arranged nanoflowers, which are characterized by uniform size (3-5 μm) and intertwined microstructures.

[0065] Example 4 Enzyme-responsive release of 5FU-Que DNA gel

[0066] The 5FU-Que DNA gel of the present invention was co-incubated with a 2U / ml deoxyribonuclease I (DNase I) solution for different time points (12, 24 and 48 hours), and the morphological changes of the hydrogel were observed by scanning electron microscopy. Furthermore, the 5FU-Que DNA gel was incubated with 2U / ml DNase I for 4, 8, 12, 24, 36, 48 and 72 hours, and the release rates of quercetin and 5-fluorouracil were measured.

[0067] The experimental results are as follows Figure 4As shown in Figure a, 5FU-Que DNA gel was co-incubated with DNase I. As the reaction time increased, the nanoflowers in the DNA hydrogel gradually degraded and the structure collapsed, indicating that the DNA hydrogel of the present invention can be effectively degraded by the enzyme. Furthermore, as the 5FU-Que DNA gel degraded, quercetin and 5-fluorouracil were gradually released ( Figure 4 b).

[0068] Example 5 The killing effect of 5FU-Que DNA gel on 4T1 tumor cells

[0069] Breast cancer cells 4T1 (purchased from the Chinese Academy of Sciences Cell Bank) in the logarithmic growth phase were plated in a 96-well plate at a density of 6000 cells / well, with 100 μL of culture medium per well, and cultured overnight at 37°C, 5% CO2. 5FU-Que DNAgel was diluted with 100 μL of culture medium to different concentrations (0, 18.75 μg / mL, 37.5 μg / mL, 75 μg / mL, 150 μg / mL, 300 μg / mL) and added to the culture wells for incubation for different times (24h, 48h and 72h). CCK-8 kit (Dojindo, Japan) was subsequently used to detect cell viability.

[0070] According to the manufacturer's operating procedures, the supernatant in the culture wells was discarded, and the wells were washed once with PBS buffer. Then, 100 μL of CCK-8 culture medium containing 10 μL was added to each well, and the wells were incubated in a 37°C incubator in the dark for 1-2 h. The absorbance at 450 nm was measured and counted using a Synergy H1 microplate reader (BioTek, USA).

[0071] The experimental results are as follows Figure 5 As shown, the inhibitory effect of 5FU-Que DNAgel on 4T1 cells is concentration- and time-dependent, indicating that 5FU-Que DNAgel has obvious cytotoxicity to tumor cells.

[0072] Example 6 ICD induction effect of 5FU-Que DNA gel on 4T1 tumor cells

[0073] The induction of ICD involves the translocation of calreticulin (CRT) from tumor cells to the cell membrane, the secretion of high-mobility group protein B1 (HMGB1) and adenosine triphosphate (ATP), etc.

[0074] The concentration of HMGB1 secreted by 4T1 cells after 5FU-Que DNA gel treatment was detected using an ELISA kit (PH406, Shanghai Biotech). The content of ATP in the cell culture medium was detected using an ATP detection kit (S0027, Shanghai Biotech). All operations were performed according to the manufacturer's instructions.

[0075] The experimental results are as follows Figure 6 As shown, Figure 6 a is the ATP expression level measured after different groups treated 4T1 tumor cells. Figure 6 b is the expression level of HMGB1 measured after 4T1 tumor cells were treated with different groups. ATP ( Figure 6 a) and HMGB1( Figure 6 b) had the highest release level, and 5FU-Que DNAgel effectively induced ICD response and enhanced tumor immunogenicity.

[0076] Example 7 Detection of CCL2 expression level in 4T1 tumor cells using 5FU-Que DNA gel

[0077] The CCL2 mRNA expression level in 4T1 tumor cells was detected by Q-PCR.

[0078] Total RNA was extracted from the treated 4T1 cells using Trizol reagent, and Q-PCR was performed using a reverse transcription kit (RR055B, purchased from Bio-Tech Co., Ltd.) and TB GreenTM Premix Ex TaqTMII reagent (TaKaRa, Japan) in a LightCycler 480 system (Roche, Switzerland).

[0079] The primer sequences used are as follows:

[0080] CCL2 Forward Primer:5'-AGGTCCCTGTCATGCTTCTG-3' (SEQ ID NO.5);

[0081] CCL2 Reverse Primer: 5'-TCTGGACCCATTCCTTCTTG-3' (SEQ ID NO. 6).

[0082] The ELISA kit (RK00381, Wuhan Abotek) was used to detect the secretion level of CCL2 protein, and all operations were performed according to the manufacturer's instructions.

[0083] The experimental results are as follows Figure 7 As shown, Figure 7 a is the mRNA expression level of CCL2 measured after different groups treated 4T1 tumor cells. Figure 7 b shows the protein expression level of CCL2 measured after 4T1 tumor cells were treated with different groups. 5. CCL2 mRNA in 4T1 cells after FU-Que DNA gel treatment ( Figure 7 a) and protein ( Figure 7 b) The expression level was reduced. This indicates that the quercetin component in 5FU-Que DNAgel can effectively reduce the expression and secretion of chemokine CCL2 in cells.

[0084] Example 8 Inhibitory effect of 5FU-Que DNA gel on migration of macrophages

[0085] Transwell assays were performed in 24-well plates with 8 μm pore size (Corning, USA) to evaluate the effect of 5FU-Que DNA gel on macrophage migration.

[0086] 10 5 4T1 cells were inoculated into the lower chamber of the Transwell chamber, cultured at 37°C, 5% CO2 for 24 hours, and then treated with drugs for 24 hours.

[0087] Furthermore, 5×10 4 Raw 264.7 macrophages were inoculated into the upper chamber of the Transwell chamber and cultured in serum-free DMEM medium for 6 hours. The cells in the upper chamber were fixed with 4% paraformaldehyde and stained with crystal violet. Different fields of view were selected under a microscope for observation and statistics, and the migration effect of macrophages was evaluated based on the number of cells that passed through.

[0088] The experimental results are as follows Figure 8 As shown in the figure, after 5FU-Que DNAgel treatment, the number of macrophages passing through the Transwell chamber decreased and the migration ability of macrophages was inhibited, indicating that the reduction of CCL2 mediated by quercetin in 5FU-Que DNAgel can affect the recruitment of macrophages by tumor cells.

[0089] Example 9 The therapeutic effect of 5FU-Que DNA gel on 4T1 tumor-bearing mice

[0090] 10 6 4T1 cells were injected into the fourth mammary gland on the right side of 6-week-old female BALB / c mice to establish a 4T1 tumor-bearing mouse model.

[0091] After 10 days, when the tumor volume reached 100 mm 3 The mice were randomly divided into Control group, Que group, 5FU group, 5FU-DNAgel group and 5FU-Que DNAgel group, with 5 mice in each group.

[0092] The control group, 5FU DNA gel group and 5FU-Que DNA gel group were injected with 100 μL PBS, 5FU DNA gel and 5FU-Que DNA gel peritumorally, and the Que group was orally administered with free Que (2 mg mL-1 , 100μL), and the 5FU group was intravenously injected with free 5FU (2.5mM, 100μL).

[0093] The drug was administered once every 3 days for a total of 4 times, and the changes in tumor volume were recorded every 2 days to observe the inhibitory effect of 5FU-QueDNAgel on tumor growth. After 12 days of treatment, the mice were euthanized, and the tumors were removed and weighed and recorded.

[0094] The experimental results are as follows Fig. 9 As shown, Fig. 9 a is a picture of mouse tumor. Fig. 9 b is the tumor volume measured on different days. Compared with the PBS group (769.0±64.6mm 3 ) compared with other groups, 5FU-Que DNAgel (305.4±80.2mm 3 ) has the highest anti-tumor effect and significantly inhibits tumor growth. This shows that the combined use of 5-fluorouracil and quercetin can effectively improve the efficacy of chemotherapy, and the 5FU-Que DNA gel of the present invention shows unique advantages in tumor treatment.

[0095] Example 10 Biosafety of 5FU-Que DNA gel in the treatment of 4T1 tumor-bearing mice

[0096] During the drug treatment of 4T1 tumor-bearing mice, the weight changes of the mice were measured and detected. After the treatment, the heart, liver, spleen, lung and kidney tissues of the mice were collected and made into wax blocks and stained with hematoxylin-eosin (H&E) for pathological examination.

[0097] The experimental results are as follows Fig.10 As shown, the body weight of mice remained relatively stable throughout the treatment period ( Fig.10 a). H&E staining results of the main organs of mice show that the structures of the tissue sections of each organ are clear and complete, with no obvious physiological or morphological changes ( Fig.10 b). This indicates that 5FU-Que DNAgel has good in vivo biocompatibility.

[0098] The above description is only a preferred embodiment of the present invention and is not intended to limit the scope of the present invention. The above embodiment of the present invention can be modified in various ways. That is, any simple, equivalent changes and modifications made according to the claims and the contents of the specification of the present invention fall within the scope of protection of the claims of the present invention. The contents not described in detail in the present invention are all conventional technical contents.

Claims

1. A method for preparing 5-fluorouracil-quercetin-DNA hydrogel, characterized in that The following steps are involved: (1) mixing the first DNA primer and the linear template, heating and annealing for assembly, adding T4 ligase for ligation reaction to form a circular DNA template, and then heating to inactivate the T4 ligase to terminate the reaction; The sequence of the first DNA primer is: 5'-TAGGAACATCAAACG ACAGCCA-3'; the sequence of the linear template is: 5'-Phosphate-TCGTTTGATGTTCCTAACGTACCAACGCACACGCAGTATTATG GACTGGTAAAAGCGCAGCATCAGGAACGTCATGGAGCAGGCATTGGCTG-3'; (2) adding dATP, dCTP, dGTP, 5F-dUTP, DTT, DNA polymerase and DNA polymerase buffer to the circular DNA template obtained in step (1) to perform a rolling circle amplification reaction; (3) adding the second DNA primer and the third DNA primer to the product obtained by the above rolling circle amplification reaction, performing a multi-primer chain amplification reaction to obtain a 5-fluorouracil-DNA hydrogel, and then heating to inactivate the DNA polymerase to terminate the reaction; The sequence of the second DNA primer is: 5'-ACGCAGTATTATGGACTG-3'; The sequence of the third DNA primer is: 5'-GCTCCATGACGTTCCTGATGCTGC-3'; (4) The quercetin solution is fully mixed with the above-mentioned 5-fluorouracil-DNA hydrogel and incubated to obtain 5-fluorouracil-quercetin-DNA hydrogel.

2. The method for preparing a 5-fluorouracil-quercetin-DNA hydrogel according to claim 1, characterized in that: In step (1), the concentrations of the first DNA primer and the linear template reaction were both 0.5 μM, the reaction solution for the DNA primer and linear template assembly was 1×T4 ligase buffer, and the heating annealing assembly conditions were 95°C for 2 min and -1°C for 1 min. -1 The rate is gradually cooled from 95°C to 4°C; The concentration of T4 ligase used was 10 U μL -1 , the ligation reaction conditions were incubation at 4°C overnight; The reaction was terminated by heating at 65°C for 10 min.

3. The method for preparing a 5-fluorouracil-quercetin-DNA hydrogel according to claim 1, characterized in that: In step (2), the final reaction volume is 100 μL, of which the circular DNA template reaction volume is 20 μL; The reaction concentrations of dATP, dCTP, dGTP, and 5F-dUTP are all 100 mM, and the volumes are all 2.5 μL; the reaction concentration of DTT is 100 mM, and the volume is 2 μL; The working concentration of DNA polymerase is 10UμL -1 , volume 1 μL; The reaction solution was 1× DNA polymerase buffer; The rolling circle amplification reaction conditions are incubation at 30-42°C for 4 hours; The reaction was terminated by heating at 65°C for 10 min.

4. The method for preparing a 5-fluorouracil-quercetin-DNA hydrogel according to claim 1, characterized in that: In step (3), the reaction concentrations of the second DNA primer and the third DNA primer are both 500 μM, and the volumes are both 1 μL; The multi-primer chain amplification reaction conditions are incubation at 30-42° C. for 16 hours.

5. The method for preparing a 5-fluorouracil-quercetin-DNA hydrogel according to claim 1, characterized in that: In step (4), the concentration of the quercetin solution is 4 mg mL -1 ; The incubation volume ratio of quercetin solution to 5-fluorouracil-DNA hydrogel was 1:1; The quercetin and 5-fluorouracil-DNA hydrogel incubation conditions are incubation at room temperature in the dark for 6 hours.

6. 5-Fluorouracil-quercetin-DNA hydrogel obtained by the preparation method according to claim 1.

7. Use of the 5-fluorouracil-quercetin-DNA hydrogel according to claim 6 in the preparation of anti-tumor drugs.

8. The use according to claim 7, characterized in that The tumor is triple-negative breast cancer.

Images