Application of LW6 in preparation of medicine for preventing and treating neuroinflammation

Abstract

The invention discloses application of LW6 in preparation of drugs for preventing and treating neuroinflammation and protecting microglial cells. Cell experiments prove that the LW6 can inhibit the expression of HIF-1alpha protein in LPS-induced microglial cells BV2, can inhibit the mRNA expression level of inflammatory factors IL-1beta and IL-6 in the microglial cells BV2, and can inhibit the mRNA expression level of microglial cell inflammatory enzyme iNOS, which indicates that the LW6 can protect the microglial cells and prevent and treat neuroinflammation, and has a significant effect on degenerative diseases such as Alzheimer's disease. The compound has certain significance in treating Parkinson's disease, and can be used for preparing medicines for preventing and treating neuroinflammation and medicines for protecting microglial cells.

Description

Technical Field

[0001] The present invention belongs to the technical field of drug development, and specifically relates to the use of LW6 in preparing drugs for preventing and treating neuroinflammation. Background Art

[0002] Neurodegenerative diseases are disease states characterized by loss of neurons in the brain and spinal cord, including 11 major categories of diseases such as Alzheimer's disease and Parkinson's disease. Neurodegenerative diseases are chronic and common diseases that seriously threaten human health and quality of life. Studies have shown that inflammation plays an important role in the occurrence and development of neurodegenerative diseases. Protein aggregation is a very common pathological phenomenon in neurodegenerative lesions, which can induce neuroinflammation, thereby further aggravating protein aggregation and neurodegenerative lesions. In the occurrence and development of neurodegenerative diseases, there is always an inflammatory response in the brain characterized by glial cell activation. Activated glial cells mediate neurodegenerative lesions caused by neuroinflammation by releasing molecules such as inflammatory cytokines and reactive oxygen free radicals.

[0003] Microglia, as the main immune response cells of the central nervous system, constantly monitor the microenvironment and are important regulatory cells of neuroinflammatory responses. The activation or polarization of microglia is usually divided into M1 or M2 types. Among them, the M1 type activation is characterized by the simultaneous activation of TLR and IFN-γ signaling pathways, the production of proinflammatory cytokines and chemokines, such as TNF-α, IL-6, IL-1β and CCL2, the release of a series of proinflammatory factors by microglia, and the occurrence of oxidative stress response, which further aggravates the necrosis and loss of neurons and induces neurodegenerative diseases.

[0004] The HIF protein complex is a heterodimer formed by α subunits and β subunits. HIF-1α is widely expressed in various tissues of the body, while HIF-2α and HIF-3α are expressed in certain specific tissues of the body. The α subunit is regulated by cellular oxygen levels, while the β subunit is constitutively expressed. The HIF pathway plays an important role in the development and disease processes of various organs and tissues, including the nervous system. Studies have shown that HIF increases macrophage aggregation, invasion and movement, and drives the expression of pro-inflammatory cytokines.

[0005] According to research data, there is a lack of drugs for the prevention and treatment of neuroinflammation in clinical practice, and there is also a lack of specific drugs for the treatment of a series of neurodegenerative diseases. As mentioned in the previous background, neuroinflammation plays a vital role in the progression of neurodegenerative diseases. Chronic and persistent neuroinflammation can also cause neuronal death, further worsening the course of neurodegenerative diseases. Therefore, the development of drugs for the control of neuroinflammation will become an important research direction for the prevention and treatment of neurodegenerative diseases. LW6 (3-[[[4-(adamantan-1-yl)phenoxy]acetyl]amino]-4-hydroxybenzoic acid methyl ester, chemical structure as shownFigure 1 As shown in the figure, CAS number: 934593-90-5) is a novel HIF-1α inhibitor. LW6 can promote the degradation of HIF-1α protein without affecting the expression of HIF-1β. However, it is still unknown whether LW6 has an effect in microglia and whether it can degrade inflammatory factors such as HIF-1α protein to inhibit neuroinflammation. Summary of the invention

[0006] In view of this, one of the objects of the present invention is to provide Figure 1 The compound LW6 shown is used in the preparation of drugs for preventing and treating neuroinflammation.

[0007] Preferably, the prevention and treatment is to inhibit the increase of HIF-1α protein in microglia.

[0008] Preferably, the prevention and treatment is to inhibit the expression of microglial inflammatory factors IL-6 and IL-1β genes.

[0009] Preferably, the prevention and treatment is to inhibit the expression of the microglial inflammatory enzyme iNOS gene.

[0010] A second object of the present invention is to provide Figure 1 The compound is used for preparing a drug for protecting microglia.

[0011] Preferably, the LW6 is used to inhibit the production of HIF-1α protein by the microglia induced by lipopolysaccharide.

[0012] Preferably, the LW6 is used to inhibit the microglia from producing inflammatory factors IL-6 and IL-1β induced by lipopolysaccharide.

[0013] Preferably, the LW6 is used to inhibit the production of NO messenger molecules in microglia

[0014] The present invention provides the use of LW6 in preparing drugs for preventing and treating neuroinflammation. Cell experiments confirm that LW6 can inhibit HIF-1α protein in microglial cells BV2 induced by LPS, can inhibit the mRNA expression levels of inflammatory factors IL-1β and IL-6 in microglial cells BV2, and can inhibit the mRNA expression level of microglial inflammatory enzyme iNOS, indicating that LW6 can protect microglial cells, reduce microglial inflammatory reactions, prevent and treat neuroinflammation, and has certain significance for the treatment of degenerative diseases such as Alzheimer's disease and Parkinson's disease. Therefore, LW6 can be used to prepare drugs for preventing and treating neuroinflammation and drugs for protecting microglial cells. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 is the chemical structural formula of LW6 of the present invention;

[0016] Figure 2 Microglial cells BV2 (10×) used in the experiments of the present invention;

[0017] Figure 3 The protein expression level of HIF-1α after LW6 of the present invention treats microglial cells BV2;

[0018] Figure 4 The LW6 of the present invention inhibits the expression of mRNA levels of inflammatory factors IL-6 and IL-1β produced by LPS-induced activation of microglial cells BV2;

[0019] Figure 5 The LW6 of the present invention inhibits the expression of the mRNA level of the inflammatory enzyme iNOS produced by LPS-induced activation of microglial BV2 cells. DETAILED DESCRIPTION

[0020] The present invention will be described in detail below in conjunction with examples. These examples are only illustrative and are not intended to limit the scope of application of the present invention. The present invention is not limited to the following embodiments or examples. Any modifications and variations that do not violate the spirit of the present invention should be included in the scope of the present invention. The experimental materials used in the following examples are commercially available unless otherwise specified. LW6 (chemical structure as shown in the following examples) used in the following examples Figure 1 As shown, the cells were purchased from MedChemExpress, and microglial cells BV2 were purchased from Procell.

[0021] Example 1: Culture of microglial BV2 cells and overall method of neuroinflammation experiment

[0022] BV2 cells were cultured with culture medium (DMEM medium + 10% FBS + 1% P / S) and subcultured at a ratio of 1:3. After culturing BV2 cells for 2-3 generations, the cells were seeded on a 12-well plate at a density of 2×10 5 pcs / well and then incubate at 37°C, 5% CO 2 The BV2 cells were cultured in a constant temperature incubator and subjected to different treatments and tests for subsequent experiments after 24 hours. Figure 2 As shown, this embodiment uses multiple generations of BV2 cells to perform repeated experiments to ensure the repeatability of the experiments.

[0023] In order to study whether LW6 has an inhibitory effect on neuroinflammation, a neuroinflammation model needs to be established. Lipopolysaccharide (LPS) is a common endotoxin that can activate mononuclear macrophages, endothelial cells, epithelial cells, etc. through the cell signal transduction system in the body to synthesize and release a variety of cytokines and inflammatory mediators, thereby causing a series of reactions in the body. Therefore, this embodiment uses LPS to induce microglial BV2 inflammatory response to study the role and effect of LW6.

[0024] Example 2: Effect of LW6 on HIF-1α protein in LPS-induced inflammatory response of microglial BV2 cells

[0025] After culturing BV2 cells in 12-well plates for 24 h, the medium was removed, 1 mL of fresh medium was added to each well, and then 1 μL / well of 10 mM LW6 (LW6 was dissolved in DMSO solvent) was added for pretreatment for 1 h (DMSO pretreatment without LW6 was used as the control), and then 1 μL / well of 1 mg / mL LPS was added for further treatment for 4 h or 8 h (addition of H 2 O treatment as control), extracted protein (RIPA lysate) was used for WB detection with HIF-1α antibody, β-actin was used as internal reference, all data were analyzed using the mean ± standard deviation method, and each analysis was repeated at least three times. The WB test results and statistical graphs are shown in Figure 3 shown.

[0026] Depend on Figure 3 It can be seen that after 4h or 8h of LPS treatment, the 2 O group ( Figure 3 DMSO H 2 O" group means pre-treated with DMSO and H 2 Compared with the DMSO LPS group, the HIF-1α protein level in the DMSO LPS group was significantly increased; the HIF-1α expression level in the LW6 LPS group pretreated with LW6 was significantly decreased compared with that in the DMSO LPS group, indicating that LPS can increase the production of HIF-1α protein in BV2 cells, and LW6 can inhibit the increase of HIF-1α protein level caused by LPS in microglia.

[0027] Example 3: Effect of LW6 on the mRNA expression levels of inflammatory factors IL-6 and IL-1β released by LPS-induced microglial BV2 activation

[0028] After culturing BV2 cells in 12-well plates for 24 h, the medium was removed, 1 mL of fresh medium was added to each well, and then 1 μL / well of 10 mM LW6 (LW6 was dissolved in DMSO solvent) was added for pretreatment for 1 h (DMSO pretreatment without LW6 was used as the control), and then 1 μL / well of 1 mg / mL LPS was added for further treatment for 4 h or 8 h (addition of H 2 O treatment as a control), RNA was extracted and reverse transcribed into cDNA for qPCR detection of the expression of inflammatory factors IL-6 (interleukin-6) and IL-1β (interleukin-1β) genes. The primer sequences are shown in Table 1. All data were analyzed using the mean ± standard deviation method. Each analysis was repeated at least three times. The results are shown in Figure 4 shown.

[0029] Table 1 Primers for qPCR detection of inflammatory factors

[0030]

[0031] Depend on Figure 4 It can be seen that after 4h or 8h of LPS treatment, compared with the DMSO LPS group, the BV2 cell inflammatory factors IL-6 and IL-1β in the LW6 LPS group pretreated with LW6 were significantly decreased at the mRNA level, indicating that the inflammation of BV2 cells was inhibited.

[0032] Example 4: Effect of LW6 on the oxidative stress response induced by LPS-induced activation of microglial BV2 cells

[0033] Nitric oxide (NO) is an important mediator of inflammatory response, and excessive NO accumulation is an important sign of LPS-induced inflammation. iNOS (inducible nitric oxide synthase) is an important inflammatory enzyme that produces NO.

[0034] After culturing BV2 cells in 12-well plates for 24 h, the medium was removed, 1 mL of fresh medium was added to each well, and then 1 μL / well of 10 mM LW6 (LW6 was dissolved in DMSO solvent) was added for pretreatment for 1 h (DMSO pretreatment without LW6 was used as the control), and then 1 μL / well of 1 mg / mL LPS was added for further treatment for 4 h or 8 h (addition of H 2 O treatment as control), RNA was extracted and reverse transcribed into cDNA for qPCR detection of inflammatory enzyme iNOS expression (18S gene was also used as internal reference), and the primer sequence of iNOS gene was:

[0035] F: TCACGCTTGGGCCTTGTT, R: CAGGTCACTTTGGTAGGATTTG;

[0036] All data were analyzed using the mean ± standard deviation method, and each analysis was repeated at least three times. Figure 5 shown.

[0037] Depend on Figure 5 It can be seen that after 4h or 8h of LPS treatment, the mRNA expression level of iNOS was significantly increased; while the mRNA expression level of iNOS in the LW6 LPS group pretreated with LW6 was significantly decreased compared with the DMSO LPS group, indicating that a certain concentration of LW6 can effectively reduce the increase in iNOS mRNA level in BV2 cells caused by LPS.

[0038] In summary, LW6 can protect microglia and has a significant inhibitory effect on microglial inflammation. LW6 can be used to prepare drugs for preventing and treating neuroinflammation and protecting microglia.

[0039] The conventional techniques and schemes not described in detail in the above embodiments are well known in the art, so they will not be described in detail here. The above embodiments and / or experimental examples describe the preferred embodiments of the present invention in detail, but the present invention is not limited to the specific details in the above embodiments. Within the scope of the technical concept of the present invention, the technical scheme of the present invention can be subjected to a variety of simple modifications, and these simple modifications all belong to the protection scope of the present invention.

Claims

1. Use of the compound LW6 as shown in formula (I) in the preparation of drugs for preventing and treating neuroinflammation, 2. The use according to claim 1, characterized in that The prevention and treatment is to inhibit the increase of HIF-1α protein in microglia.

3. The use according to claim 1, characterized in that The prevention and treatment is to inhibit the expression of microglial inflammatory factors IL-6 and IL-1β genes.

4. The use according to claim 1, characterized in that The prevention and treatment is to inhibit the expression of microglial inflammatory enzyme iNOS gene.

5. Use of the compound LW6 represented by formula (I) in the preparation of a drug for protecting microglia 6. The use according to claim 5, characterized in that The LW6 is used to inhibit the production of HIF-1α protein by the microglia induced by lipopolysaccharide.

7. The use according to claim 5, characterized in that The LW6 is used to inhibit microglia from producing inflammatory factors IL-6 and IL-1β.

8. The use according to claim 5, characterized in that The LW6 is used to inhibit the production of NO messenger molecules in microglia.

Images