Trypsin affinity material as well as preparation method and application thereof

Abstract

The invention belongs to the technical field of trypsin, and particularly relates to a trypsin affinity material as well as a preparation method and application thereof. The preparation method of the trypsin affinity material comprises the following steps: preparing magnetic nanoparticles Fe3O4 (at) PDA by taking Fe3O4 magnetic particles and dopamine hydrochloride as raw materials; a buckwheat trypsin inhibitor is modified, active amino acid is introduced to the N end of the buckwheat trypsin inhibitor, the optimized buckwheat trypsin inhibitor eBTI is obtained, and the active amino acid comprises any one of cysteine, lysine and arginine; and preparing the Fe3O4 (at) PDA (at) eBTI. The buckwheat trypsin inhibitor is modified by analyzing the structure and sequence of the buckwheat trypsin inhibitor, and active groups such as amino and sulfydryl are introduced to realize directional immobilization of the buckwheat trypsin inhibitor at specific sites, so that a trypsin affinity material is provided. The material can be used for purifying animal trypsin.

Description

Technical Field

[0001] The invention belongs to the technical field of trypsin, and specifically relates to a trypsin affinity material and a preparation method and application thereof. Background Art

[0002] Trypsin has a "dual" role. It can not only digest and hydrolyze ordinary proteins, but also plays a key role in its own activation and the activation of other zymogens secreted by the pancreas. At present, trypsin is widely used in light industry, food and pharmaceutical industries, and has important scientific research value. In the field of light industry, it is used for protein hydrolysis, preparation of peptone, etc.; in the field of food, it is used to hydrolyze high-value animal and plant proteins, fats and starch; in the field of medicine, it is used as a debridement agent, anti-inflammatory drug and digestive drug compound; in the field of modern biotechnology, it is used for protein sequencing, cell culture, etc. Especially in the field of medicine and modern biotechnology, high-purity trypsin is required.

[0003] High-purity trypsin is difficult to prepare. Most enzymes exist in the form of inactive zymogens in the pancreas of animals. They become active enzymes after being activated by trypsin. However, most enzymes in the pancreas of animals belong to the serine protease family, among which chymotrypsinogen and trypsinogen have similar physical and chemical properties, making it difficult to separate the two. Traditional methods have low purification efficiency and often require a combination of multiple media and multiple steps to meet product quality requirements, making it difficult to form industrialization.

[0004] The principle of affinity chromatography separation and purification is based on the reversible interaction between the target protein and the carrier-coupled ligand. It has high selectivity, high resolution and high capacity for the target protein, and can be purified up to thousands of times with high activity recovery. Affinity chromatography technology is unique among separation and purification methods because it is a technology for purifying proteins based on biological functions rather than single physical or chemical properties, and is the preferred option for purifying biological enzymes. Early affinity ligands were bound to solid phase carriers through non-covalent bonds such as electrostatic effects, hydrophobic interactions or hydrogen bonds. Although this method is simple to operate, the stability of affinity materials prepared by non-covalent immobilization is limited, and the random fixation orientation may cause the ligand to lose activity.

[0005] Buckwheat trypsin inhibitor (BTI) is derived from buckwheat seeds. It is composed of 69 amino acids and has a protein molecular weight of 7.9kDa. It belongs to Potato I type protease inhibitor and has good water solubility and heat resistance. Compared with soybean trypsin inhibitor, BTI has smaller molecules and better thermal stability. It can specifically inhibit trypsin activity and is more suitable as a ligand to prepare trypsin affinity materials. BTI consists of an α-helix, two parallel β-folds, two irregular structures N-terminal and C-terminal, and a reactive center Loop region. Its active site is Arg45, which interacts with Asp189 in the trypsin binding pocket; the disulfide bond formed by Cys4 and Cys49 maintains spatial conformational stability; the helical region where Trp10 and Ile25 are located and the β-fold region where Val32, Val52 and Pro66 are located form a hydrophobic cavity as a whole, which stabilizes the loop region above.

[0006] Solid phase carriers (immobilized carriers) also have an important influence on the performance of adsorbents. Traditional immobilized carriers such as chitosan and agarose gel have large particle sizes, which seriously affect the binding efficiency of ligands and enzymes. 3 O 4 Magnetic nanoparticles have a large specific surface area, many holes, good biocompatibility, and are easy to recycle. They are increasingly attracting attention and have been used to immobilize proteases, lipases, pectinases, etc. Polydopamine will undergo self-polymerization in oxygen-containing alkaline aqueous solutions, and use covalent and non-covalent bonds to form a polydopamine coating with extremely strong adhesion on the surface of the material. This coating has broadened new ways to functionalize the surface of materials. The polydopamine coating has a large number of catechol and amino, imino and other functional groups, providing a large number of active sites for binding targets. Traut's reagent (2-iminothiolane hydrochloride) can spontaneously react with primary amines in polydopamine at pH 7 to pH 10 to introduce thiol groups.

[0007] Traditional immobilization methods are all random fixation. In the random fixation method, the protein is connected to the carrier at random sites. The number of connection sites and the direction of protein fixation are uncertain, which causes the protein activity to decrease. The main reasons are as follows: First, the protein is intolerant to the chemical reactions that occur during covalent fixation, such as high temperature, oxidants or extreme pH environments; second, multiple sites of the protein can bind to the carrier, and in this process the active center of the protein may be destroyed, resulting in partial or complete loss of protein activity after fixation.

[0008] There are two methods for protein immobilization: physical and chemical. Compared with the physical method, the chemical covalent bonding method has the advantages of strong protein binding and not easy to lose, and is more widely used. However, in the traditional chemical covalent bonding method, the active groups of the protein molecules are randomly covalently bonded to the carrier. If the binding site is close to or just the active center of the protein, it will cause the activity of the fixed protein to be partially or completely lost. In addition, the traditional immobilization method cannot control the directional arrangement of the protein on the surface of the solid phase carrier, that is, the binding mode of the protein and the carrier is random. This random binding enhances the steric hindrance effect between the active site of the immobilized protein and the carrier, which is not conducive to the binding of the ligand and the effector. At present, the traditional covalent bonding method is used in the preparation of trypsin affinity materials. In the process of preparing trypsin affinity materials, there is a problem of reduced or lost activity of the protein affinity ligand after covalent bonding. Summary of the invention

[0009] In order to solve the problem in the prior art that the activity of protein affinity ligands is reduced or lost after covalent bonding during the preparation of trypsin affinity materials, the present invention analyzes the structure and sequence of buckwheat trypsin inhibitors, selects to modify the buckwheat trypsin inhibitors, introduces active groups such as amino groups and thiol groups to achieve directional immobilization of the buckwheat trypsin inhibitors at specific sites, and thus provides a trypsin affinity material and a preparation method and application thereof.

[0010] To achieve the above purpose, the present invention adopts the following technical solution.

[0011] The present invention provides a method for preparing a trypsin affinity material, comprising the following steps:

[0012] Fe 3 O 4 Magnetic particles and dopamine hydrochloride were used as raw materials to prepare magnetic nanoparticles Fe 3 O 4 @PDA. 3 O 4 The molar ratio of the magnetic particles to the dopamine hydrochloride is 0.8-1.2:1.

[0013] Buckwheat trypsin inhibitor (BTI) is modified, and active amino acids are introduced into the N-terminus of the buckwheat trypsin inhibitor to obtain an optimized buckwheat trypsin inhibitor; wherein the active amino acids include any one of cysteine, lysine and arginine. 3 O 4 @PDA undergoes chemical bonding, reducing or avoiding the reaction of the key active sites of the inhibitor during immobilization, protecting the ligand and allowing the immobilized ligand to maintain its inhibitory activity.

[0014] The magnetic nanoparticles Fe3 O 4 @PDA and the optimized buckwheat trypsin inhibitor are used as raw materials to prepare the trypsin affinity material. 3 O 4 The volume ratio of the mass of PDA to the optimized buckwheat trypsin inhibitor is 1:8-20.

[0015] The preparation method of the trypsin affinity material provided by the present invention adopts the directional immobilization technology, which is connected with the carrier by the specific site outside the ligand (protein) active site, and the activity of the ligand (protein) after fixation will not be destroyed, which is beneficial to the combination with the effector. Directed immobilization can make the ligand (protein) arranged in a certain direction on the carrier surface, and the three-dimensional structure of the ligand (protein) active site is well maintained, thereby significantly improving the activity of the immobilized ligand (protein), and then in the process of preparing the trypsin affinity material, it will not cause the protein affinity ligand to be covalently bonded after activity reduction or loss. Therefore, the preparation method of the trypsin affinity material provided by the present invention does not have the problem of protein ligand being covalently bonded with the affinity carrier after activity reduction or loss in the process of preparing the trypsin affinity material.

[0016] Preferably, the method for preparing the trypsin affinity material comprises the following steps:

[0017] The magnetic nanoparticles Fe 3 O 4 @PDA and the optimized buckwheat trypsin inhibitor are evenly mixed and reacted at 20°C to 28°C for 10h to 15h to obtain the product.

[0018] The magnetic nanoparticles Fe 3 O 4 The volume ratio of the mass of @PDA to the optimized buckwheat trypsin inhibitor is 1:9-20.

[0019] Preferably, the optimized buckwheat trypsin inhibitor is obtained as follows:

[0020] The vector plasmid pQE30 BTI connected with the buckwheat trypsin inhibitor is used as a template, a mutation primer with an introduction site is designed, and site-directed mutagenesis PCR amplification is performed to obtain a BTI mutant eBTI.

[0021] The vector pQE30 and the BTI mutant eBTI are connected, transformed, and expressed to obtain the target protein eBTI mutant.

[0022] The target protein eBTI mutant is purified and freeze-dried to obtain the optimized buckwheat trypsin inhibitor.

[0023] The target protein eBTI mutant is obtained by introducing the active amino acid into the N-terminus of the buckwheat trypsin inhibitor. The introduction of the active amino acid into the N-terminus does not affect the activity of the buckwheat trypsin inhibitor, while the introduction of the active amino acid into the C-terminus destroys the spatial structure of the buckwheat trypsin inhibitor, thereby significantly reducing the inhibitory activity of the protein, and is no longer suitable for use as a ligand for trypsin affinity materials.

[0024] The active amino acid includes any one of cysteine, lysine and arginine.

[0025] Preferably, the target protein eBTI mutant includes any one of Lys-BTI, Arg-BTI and Cys-BTI. Lys-BTI and Arg-BTI introduce an amino group (NH 2 -), can be directly combined with Fe 3 O 4 @PDA reaction. Cys-BTI introduces a thiol group (-SH), which is the only free thiol group in the ligand protein and can react with Fe modified by Traut's reagent. 3 O 4 @PDA reaction, connecting Cys-BTI to the carrier Fe via a disulfide bond (-SS-) 3 O 4 @PDA, to achieve directional fixation of ligand protein.

[0026] Preferably, the purification method is as follows:

[0027] The expressed target protein eBTI mutant was purified using a Ni-NTA column.

[0028] The present invention also provides a trypsin affinity material prepared by the preparation method of the above-mentioned trypsin affinity material. The trypsin affinity material has good thermal stability and acid and alkali resistance. After being heated at 80°C for 2 hours, it can still retain a relative inhibition rate of 92.06%, and the inhibition activity is maintained at more than 80% in the range of pH 3 to pH 10. The trypsin affinity material has good reusability and can still stably maintain an adsorption rate of 60.62% after 10 batches of use. The trypsin affinity material Fe prepared by the present invention 3 O 4 The adsorption capacity of @PDA@Cys-BTI for trypsin reached 18.22±0.41 mg / g, which was higher than that of the trypsin affinity material Fe prepared with unmutated BTI as ligand. 3 O 4 The adsorption capacity of @PDA@BTI was significantly improved.

[0029] Preferably, the trypsin affinity material is used to specifically purify trypsin.

[0030] The invention also provides application of the trypsin affinity material in purification of animal trypsin.

[0031] Preferably, the trypsin affinity material is mixed with the crude trypsin, and reacted at 20° C. to 28° C. and 180 rpm to 220 rpm for 20 min to 60 min.

[0032] After the reaction is completed, the supernatant is discarded, and the lower layer of solid after the reaction is eluted with 5.8% to 6.2% by volume acetic acid solution.

[0033] The supernatant after elution is the purified trypsin sample.

[0034] The mass ratio of the trypsin affinity material to the volume ratio of the trypsin crude product is 1 g: 1 mL to 10 mL.

[0035] The concentration of the crude trypsin is 1 mg / mL to 4 mg / mL. The content of trypsin in the crude trypsin does not exceed the adsorption capacity of the trypsin affinity material for trypsin. 3 O 4 Taking @PDA@Cys-BTI as an example, if 1g of affinity material is used, the maximum adsorption amount of trypsin is 18.22±0.41mg.

[0036] Compared with the prior art, the present invention has the following beneficial effects:

[0037] 1. The method for preparing a trypsin affinity material provided by the present invention does not have the problem of activity reduction or loss after covalent bonding of protein affinity ligands in the process of preparing the trypsin affinity material. The present invention selects to modify the buckwheat trypsin inhibitor by analyzing the structure and sequence of the buckwheat trypsin inhibitor, and introduces active groups such as amino and thiol groups to achieve directional immobilization of the buckwheat trypsin inhibitor at a specific site.

[0038] 2. The present invention also uses Fe modified by Traut reagent 3 O 4 @PDA is used as a solid phase carrier to prepare trypsin affinity materials through directional immobilization, and the prepared trypsin affinity materials are characterized and their properties are determined for application in the purification of animal trypsin. Through the above innovations, the research and application fields of trypsin inhibitors are broadened, providing a certain theoretical basis for improving the utilization value of animal viscera, and at the same time, it is conducive to the discovery of animal trypsin from different sources.

[0039] 3. The protein used in the present invention has good thermal stability and acid-base stability, and can tolerate chemical reactions of covalent fixation. On the other hand, the present invention adopts directional immobilization technology, which is connected to the carrier through a specific site outside the protein active site, and will not destroy the activity of the protein after fixation, which is conducive to combining with the effector. Directed immobilization can arrange the protein in a certain direction on the carrier surface, and the three-dimensional structure of the protein active site is well maintained, thereby significantly improving the activity of the immobilized protein. The trypsin affinity material prepared by the protein used in the present invention and the immobilization technology has good thermal stability, acid-base stability and solvent tolerance. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] Figure 1 This is the enzyme digestion verification of pQE30-Lys-BTI and pQE30-Arg-BTI in the present invention.

[0041] Figure 2 This is the sequencing determination of pQE30-Lys-BTI in the present invention.

[0042] Figure 3 This is the sequencing determination of pQE30-Arg-BTI in the present invention.

[0043] Figure 4 The SDS-PAGE diagram of the Lys-BTI and Arg-BTI induced expression in the present invention.

[0044] Figure 5 The SDS-PAGE pattern of purified Lys-BTI in the present invention.

[0045] Figure 6 The figure is the SDS-PAGE pattern of the purified Arg-BTI in the present invention.

[0046] Figure 7 This is a study on the thermal stability of Lys-BTI and Arg-BTI in the present invention.

[0047] Figure 8 This is a study on the pH stability of Lys-BTI and Arg-BTI in the present invention.

[0048] Fig. 9 This is the restriction enzyme digestion verification of pQE30-Cys-BTI in the present invention.

[0049] Fig.10 This is the sequencing determination of pQE30-Cys-BTI in the present invention.

[0050] Fig.11 The SDS-PAGE pattern of the induced expression of Cys-BTI in the present invention.

[0051] Fig.12The SDS-PAGE pattern of the purified Cys-BTI in the present invention.

[0052] Fig.13 This is a study on the thermal stability of Cys-BTI in the present invention.

[0053] Fig.14 This is a study on the pH stability of Cys-BTI in the present invention.

[0054] Fig.15 This is the effect of the Cys-BTI volume to carrier mass ratio on the immobilization efficiency in the present invention.

[0055] Fig.16 This is the effect of the immobilization time on the immobilization efficiency of Cys-BTI in the present invention.

[0056] Fig.17 This is the effect of pH value on the immobilization efficiency of Cys-BTI in the present invention.

[0057] Fig.18 In the present invention, Fe 3 O 4 Effect of particle size on the immobilization efficiency of Cys-BTI.

[0058] Fig.19 In the present invention, Fe 3 O 4 @PDA@Lys-BTI and Fe 3 O 4 SDS-PAGE image of @PDA@Arg-BTI purified trypsin; Fig.19 Figure A in the figure is Fe 3 O 4 @PDA@Lys-BTI purified trypsin electrophoresis profile; Fig.19 Figure B shows Fe 3 O 4 @PDA@Arg-BTI purified trypsin electrophoresis spectrum; Mr: Marker; Lane 1: unpurified trypsin; Lane 2: purified trypsin.

[0059] Fig. 20 In the present invention, Fe 3 O 4 SDS-PAGE profile of @PDA@Cys-BTI purified trypsin. Mr: Marker; Lane 1: Unpurified trypsin; Lane 2: Fe 3 O 4 @PDA@Cys-BTI purified trypsin.

[0060] Fig.21 In the present invention, Fe3 O 4 Thermal stability of @PDA@Cys-BTI.

[0061] Fig. 22 In the present invention, Fe 3 O 4 pH stability of @PDA@Cys-BTI.

[0062] Fig.23 In the present invention, Fe 3 O 4 Repeated use stability of @PDA@Cys-BTI. DETAILED DESCRIPTION

[0063] The present invention is described in detail below in conjunction with the accompanying drawings and specific examples, but should not be construed as limiting the present invention. Unless otherwise specified, the technical means used in the following examples are conventional means well known to those skilled in the art, and the materials, reagents, etc. used in the following examples, unless otherwise specified, can be obtained from commercial sources.

[0064] Example 1: Trypsin affinity material: Fe 3 O 4 Preparation of @PDA@Lys-BTI

[0065] 1. Preparation of BTI mutant: Lys-BTI

[0066] This example screened for mutation sites of buckwheat trypsin inhibitor and introduced Lys at the N-terminus of buckwheat trypsin inhibitor. Buckwheat trypsin inhibitor is also called BTI. The specific steps are as follows:

[0067] The nucleotide sequence encoding buckwheat trypsin inhibitor is shown in SEQ ID No. 1:

[0068] GGATCCCTGCGTCAGTGCTCCGGTAAACAAGAATGGCCAGAGCTCGTTGGAGAGAGGGTCCAAGGCTGCCAAGATCATCGAAAACGAGAACGAAGACGTGCGAGCTATCGTCTTGCCTGAGGGTAGCGCGGTGCCTAGAGACCTCCGATGTGACCGTGTGTGGGTTTTCGTAGACGAGCGAGGAGTTGTTGTTGATACTCCTGTTGTTATGTGATAAAAGCTT.

[0069] 1. Construction, expression and purification of pQE30-Lys-BTI

[0070] 1.1. Construction of pQE30-Lys-BTI: Using the vector plasmid pQE30-BTI as a template, site-directed mutagenesis PCR amplification was performed, and the site-directed mutagenesis PCR amplification product was subjected to 1.5% agarose gel electrophoresis and gel recovery to obtain the BTI mutant gene fragment. The BTI mutant gene fragment is also called the target fragment-BTI mutant gene.

[0071] Subsequently, the target fragment-BTI mutant gene and vector pQE30 were digested with restriction endonucleases HindIII and BamHI, and the digestion products were subjected to agarose gel electrophoresis and gel recovery. Finally, the vector pQE30 and the target fragment Lys-BTI were connected at 23°C for 3h using T4 ligase to obtain the complete plasmid pQE30-Lys-BTI.

[0072] Restriction endonucleases HindIII and BamHI were purchased from New England Biolabs.

[0073] The source of Lys was obtained by designing primers, and the nucleotide sequence of the downstream primer used was shown in SEQ ID No.2:

[0074] 5'-GGGAAGCTTTTATCACATAACAACAGGAGTATC-3'.

[0075] The nucleotide sequence of the upstream primer used for Lys is shown in SEQ ID No.3:

[0076] 5'-CGCGGATCCCTGAAGCGTCAGTGCTCCGGTAAACAAG-3'.

[0077] The reaction system for site-directed mutagenesis PCR amplification is shown in Table 1:

[0078] Table 1 Site-directed mutagenesis PCR reaction system

[0079] 2×TaqPCRMasterMix 12.5μL Upstream primer, 10 μM 1μL Downstream primer, 10 μM 1μL DNA template: vector plasmid pQE30-BTI 1μL Sterile deionized water 9.5μL

[0080] The site-directed mutagenesis PCR amplification conditions were as follows: thermal denaturation at 94°C for 15 seconds, annealing at 65°C for 15 seconds, extension at 72°C for 1 min, and 30 cycles of amplification.

[0081] The enzyme digestion system is: plasmid / PCR gel recovery product: 30 μL; HindIII: 3.5 μL; BamHI: 3.5 μL; buffer: 5 μL; sterile water: 8 μL, a total of 50 μL. Digestion at 37°C for 2 hours.

[0082] The ligation system was: T4 ligase: 1 μL; T4 Buffer: 1 μL; Lys-BTI: 6 μL; vector pQE30: 2 μL. Ligation was carried out at 23°C for 3 h.

[0083] Add 10 μL of the above ligation product to 100 μL E.coli M15 competent cells and place on ice for 30 minutes. Heat shock at 42°C for 90 seconds, and quickly place on ice for 2 minutes. Add 800 μL LB medium and gently shake and culture in a shaker at 37°C for 60 minutes. Centrifuge at 5000 rpm for 5 minutes, discard part of the supernatant, blow up the precipitate, and evenly spread it on LB solid medium containing a final concentration of 100 μg / mL Amp and 50 μg / mL Kan. Culture at 37°C for about 12 hours. Pick a single colony and culture it in LB liquid medium containing Amp and Kan, culture it at 37°C and 200 rpm for 12 hours, and recover the bacteria. Use the high-purity plasmid small-scale rapid extraction kit of Adlai Biology to extract the plasmid, and after double enzyme digestion verification, it will be handed over to Sangon Biotechnology Co., Ltd. for further sequencing verification. The verified strains will be preserved by glycerol method.

[0084] Among them, the pQE30-Lys-BTI restriction enzyme digestion verification diagram is as follows Figure 1 The sequence determination results are shown in Figure 2 As shown. Figure 1 and Figure 2 It can be seen that pQE30-Lys-BTI was successfully constructed.

[0085] 1.2. Expression of Lys-BTI: The bacteria containing the pQE30-Lys-BTI plasmid were inoculated into LB liquid medium containing 50 μg / mL Kan and 100 μg / mL Amp. After shaking culture at 37°C and 180 r / min until the logarithmic growth phase, the inducer isopropyl-β-D-thiogalactoside with a final concentration of 0.4 mmol / L was added, and the shaking culture was continued for 4 h. The bacteria were collected by centrifugation at 8000 r / min, washed three times with 20 mmol / L, pH 7.3 Tris-HCl buffer, suspended with the same Tris-HCl buffer, and ultrasonically disrupted with a cell disruptor under ice bath conditions until the bacterial suspension changed from viscous to transparent, and centrifuged at 12000 r / min for 20 min. The supernatant was taken to obtain the target protein Lys-BTI.

[0086] Among them, the English abbreviation of isopropyl-β-D-thiogalactoside is IPTG.

[0087] The preparation method of Tris-HCl buffer is as follows: weigh 0.24g Tris, dilute to 100mL with water, and then adjust the pH to 7.3 with HCl. Finally, 20mmol / LTris-HCl, pH 7.3 is obtained.

[0088] The SDS-PAGE image of Lys-BTI is as follows Figure 4 As shown. Figure 4It can be seen that Lys-BTI can be expressed in a soluble form under the induction conditions of 37°C and 0.4mmol / L IPTG.

[0089] 1.3. Purification of Lys-BTI: The target protein Lys-BTI was purified by Ni-NTA column, desalted by Sephadex G-25 column, and freeze-dried to obtain the target protein Lys-BTI. The target protein Lys-BTI is the optimized buckwheat trypsin inhibitor. The target protein Lys-BTI is also referred to as Lys-BTI.

[0090] Among them, the purification method of the target protein Lys-BTI is as follows: connect the Ni-NTA column to the protein purification system, balance the chromatography column with buffer 1, then load the sample onto the Ni-NTA column, control the flow rate to 1 mL / min, wash away impurities with buffer 2, replace buffer 2 with elution buffer, and collect the elution peak components.

[0091] Among them, Ni-NTA nickel column was purchased from Shanghai Bioengineering.

[0092] The formula composition of buffer 1 is: 20mmol / L Tris-HCl, 500mmol / L NaCl, 10mmol / L imidazole, pH 7.5.

[0093] The formula composition of buffer 2 is: 20mmol / LTris-HCl, 500mmol / LNaCl, 50mmol / Limidazole, pH7.5.

[0094] The formula composition of the elution buffer is: 20mmol / L Tris-HCl, 500mmol / L NaCl, 300mmol / L imidazole, pH 7.5.

[0095] 2. Identification of the purity of Lys-BTI by SDS-PAGE

[0096] The optimized target protein Lys-BTI was identified by SDS-PAGE using 12.5% ​​separation gel.

[0097] The results of SDS-PAGE identification are as follows Figure 5 As shown, Lys-BTI can achieve electrophoretic purity after purification by Ni-NTA column.

[0098] 3. Determination of the inhibitory activity of Lys-BTI on trypsin

[0099] The inhibitory activity determination method is as follows: first add 60 μL of 0.2 mg / mL trypsin to 0.9 mL of the activity test buffer, add 100 μL of the inhibitor, mix well and preheat in a 37°C constant temperature water bath for 10 min. Then add 5 μL of BApNA, mix well and react at 37°C for 10 min. Finally, add 100 μL of 33% acetic acid solution to terminate the reaction. Measure the absorbance value at a wavelength of 410 nm. Calculate the inhibition rate according to Formula 1.

[0100] Formula 1: Inhibition rate (%) = (A 1 -A 2 ) / A 1 ×100%;

[0101] Among them, A 1 is the absorbance value of the control group (the same volume of sample buffer instead of inhibitor sample); A 2 is the absorbance value of the inhibitor sample group.

[0102] The composition of the activity assay buffer is: 0.1 mol / L Tris-HCl, pH 8.0, containing 10 mmol / L CaCl 2 , the solvent is water.

[0103] 5μL BApNA: The concentration is 0.15mol / L, and the solvent is dimethyl sulfoxide. The Chinese name of BApNA is N-benzoyl-arginine p-nitrobenzamide.

[0104] The source of trypsin is porcine trypsin, which was purchased from Beijing Biotoda Technology Co., Ltd.

[0105] Lys-BTI was determined to have inhibitory activity.

[0106] 4. Determination of thermal stability and pH stability of Lys-BTI

[0107] Lys-BTI was placed in a water bath at 30°C, 40°C, 50°C, 60°C, 70°C, and 80°C for 2 hours, and then the inhibitory activity was measured to investigate its thermal stability. The relative inhibitory activity was calculated with the maximum inhibitory activity as 100%.

[0108] Lys-BTI was treated in buffers of pH 3, pH 4, pH 5, pH 6, pH 7, pH 8, pH 9, and pH 10 at 37°C for 2 hours, and then the inhibitory activity was measured. The relative inhibitory activity was calculated with the maximum inhibitory activity as 100%.

[0109] Among them, the buffers of pH 3, pH 4, pH 5 and pH 6 are 20mmol / L acetic acid-sodium acetate buffers of pH 3, pH 4, pH 5 and pH 6 respectively; the buffers of pH 7 and pH 8 are 20mmol / L Tris-HCl buffers of pH 7 and pH 8 respectively; the buffers of pH 9 and pH 10 are 20mmol / L glycine-sodium hydroxide buffers of pH 9 and pH 10 respectively.

[0110] The results of the thermal stability study of Lys-BTI are as follows Figure 7 The results of the pH stability study of Lys-BTI are shown in Figure 8 shown.

[0111] Depend on Figure 7 and Figure 8 It can be seen that Lys-BTI has good thermal stability in the range of 30°C, 40°C, 50°C, 60°C, 70°C, and 80°C, and after being treated at 80°C for 2h, it still retains a relative inhibition rate of more than 70%;

[0112] Lys-BTI has good acid-base stability in the pH 3-pH 10 range, and its relative inhibition rate can be maintained above 80%.

[0113] 2. Magnetic Nanoparticles Fe 3 O 4 Preparation of @PDA

[0114] Take 6g Fe 3 O 4 The magnetic particles were ultrasonicated in 180 mL of deionized water for 20 min. 3 O 4 Dopamine hydrochloride was added at a molar ratio of 1:1 to the magnetic particles, and the pH was adjusted to 8.5 with 0.1 mol / L NaOH solution. The mixture was stirred at 37 °C for 12 h, and the magnetic particles were washed with deionized water until the supernatant was colorless. The magnetic nanoparticles Fe were obtained after vacuum freeze drying. 3 O 4 @PDA, store at 4℃.

[0115] Among them, Fe 3 O 4 The magnetic particles were purchased from Aladdin Biotechnology Co., Ltd., with a size of 20 nm and a spherical shape.

[0116] Dopamine hydrochloride was purchased from Sangon Biotechnology (Shanghai) Co., Ltd.

[0117] 3. Fe 3 O 4 Preparation of @PDA@Lys-BTI

[0118] Take 1g Fe 3 O 4 @PDA magnetic nanoparticles were placed in a centrifuge tube and 10 mL of Lys-BTI was added. The reaction was oscillated at 37 °C for 12 h, and the material was washed with deionized water until the supernatant did not contain free inhibitors. Fe 3 O 4 @PDA@Lys-BTI, sealed and stored at 4℃. 3 O 4 @PDA@Lys-BTI is trypsin affinity material.

[0119] Example 2: Trypsin affinity material: Fe 3 O 4 Preparation of @PDA@Arg-BTI

[0120] 1. Preparation of BTI mutant: Arg-BTI

[0121] This example screened for mutation sites of buckwheat trypsin inhibitor and introduced Arg at the N-terminus of buckwheat trypsin inhibitor. The specific steps are as follows:

[0122] 1. Construction, expression and purification of pQE30-Arg-BTI

[0123] 1.1. Construction of pQE30-Arg-BTI:

[0124] The method for constructing, expressing and purifying pQE30-Lys-BTI in Example 1 is the same, except that the nucleotide sequence of the upstream primer used in this example is shown in SEQ ID No. 4:

[0125] 5'-CGCGGATCCCTGAGACGTCAGTGCTCCGGTAAACAAG-3'.

[0126] Among them, the pQE30-Arg-BTI restriction enzyme digestion verification diagram is as follows Figure 1 As shown in , the sequence determination results are shown in 3. Figure 1 and Figure 3 It can be seen that pQE30-Arg-BTI was successfully constructed.

[0127] 1.2. Expression of Arg-BTI:

[0128] Same as Example 1.

[0129] 1.3. Purification of Arg-BTI:

[0130] Same as Example 1.

[0131] 2. SDS-PAGE to identify the purity of Arg-BTI

[0132] Arg-BTI was identified by SDS-PAGE using 12.5% ​​separating gel.

[0133] The results of SDS-PAGE identification are as follows Figure 6 As shown, Arg-BTI can achieve electrophoretic purity after purification by Ni-NTA column.

[0134] 3. Determination of the inhibitory activity of Arg-BTI

[0135] The method is the same as in Example 1.

[0136] Arg-BTI was determined to have inhibitory activity.

[0137] 4. Determination of thermal stability and pH stability of Arg-BTI

[0138] The method is the same as in Example 1.

[0139] The results of the thermal stability study of Arg-BTI are shown in Figure 7 The results of the pH stability study of Arg-BTI are shown in Figure 8 shown.

[0140] Depend on Figure 7 and Figure 8 It can be seen that Arg-BTI has good thermal stability in the range of 30°C, 40°C, 50°C, 60°C, 70°C and 80°C, and after being treated at 80°C for 2h, it still retains a relative inhibition rate of more than 70%;

[0141] Arg-BTI has good stability in the range of pH 3-pH 10, and its relative inhibition rate can be maintained above 80%.

[0142] 2. Magnetic Nanoparticles Fe 3 O 4 Preparation of @PDA

[0143] Same as Example 1.

[0144] 3. Fe 3 O 4 Preparation of @PDA@Arg-BTI

[0145] Take 1g Fe 3 O 4 @PDA magnetic nanoparticles were placed in a centrifuge tube and 10 mL of Arg-BTI was added. The reaction was oscillated at 37 °C for 12 h, and the magnetic nanomaterials were washed with deionized water until the supernatant did not contain free inhibitors. The Fe 3 O 4 @PDA@Arg-BTI, sealed and stored at 4℃. 3O 4 @PDA@Arg-BTI is trypsin affinity material.

[0146] Example 3: Trypsin affinity material: Fe 3 O 4 Preparation of @PDA@Cys-BTI

[0147] 1. Preparation of BTI mutant: Cys-BTI

[0148] This example screened for mutation sites of buckwheat trypsin inhibitor and introduced Cys at the N-terminus of buckwheat trypsin inhibitor. The specific steps are as follows:

[0149] 1. Construction, expression and purification of pQE30-Cys-BTI

[0150] 1.1. Construction of pQE30-Cys-BTI:

[0151] The method for constructing, expressing and purifying pQE30-Lys-BTI in Example 1 is the same, except that the nucleotide sequence of the upstream primer used in this example is shown in SEQ ID No. 5:

[0152] 5'-CGCGGATCCCTGTGCCGTCAGTGCTCCGGTAAACAAG-3'.

[0153] Among them, the pQE30-Cys-BTI restriction enzyme digestion verification diagram is as follows Fig. 9 The sequencing results are shown in Fig.10 .Depend on Fig. 9 and Fig.10 It can be seen that pQE30-Cys-BTI was successfully constructed.

[0154] 1.2. Expression of Cys-BTI:

[0155] Same as Example 1. SDS-PAGE identification results are as follows Fig.11 As shown, Cys-BTI was expressed in a soluble form.

[0156] 1.3. Purification of Cys-BTI:

[0157] Same as Example 1.

[0158] 2. Identification of the purity of Cys-BTI by SDS-PAGE

[0159] Cys-BTI was identified by SDS-PAGE using 12.5% ​​separation gel.

[0160] The results of SDS-PAGE identification are as follows Fig.12As shown, Cys-BTI can achieve electrophoretic purity after purification by Ni-NTA column.

[0161] 3. Determination of the inhibitory activity of Cys-BTI

[0162] The method is the same as in Example 1.

[0163] Cys-BTI was determined to have inhibitory activity.

[0164] 4. Determination of thermal and pH stability of Cys-BTI

[0165] Cys-BTI was heated in 20 mmol / L Tris-HCl buffer (pH 7.3) at 30°C, 40°C, 50°C, 60°C, 70°C and 80°C for 2 h, and then the inhibitory activity was measured to investigate the thermal stability. The relative inhibitory activity was calculated with the maximum inhibitory activity as 100%.

[0166] The thermal stability of Cys-BTI was studied as follows Fig.13 As shown; pH stability study of Cys-BTI as shown Fig.14 shown.

[0167] Depend on Fig.13 and Fig.14 It can be seen that Cys-BTI has good thermal stability in the range of 30-80℃, and retains 96.24% relative inhibition rate after 2h at 80℃. Cys-BTI has good stability in the range of pH 3-pH 10, and its relative inhibition rate can be maintained above 90%.

[0168] 2. Fe 3 O 4 Preparation of @PDA-SH

[0169] Add 50 mL of 2 mg / mL Traut's reagent to 1 g Fe 3 O 4 @PDA, the mixture was shaken at 25 ° C for 12 h, and the magnetic particles were washed with deionized water until the supernatant was colorless. After vacuum freeze drying, the magnetic particles with thiol groups were obtained. 3 O 4 @PDA-SH, store at 4℃.

[0170] Among them, the chemical name of Traut is 2-iminothiolane hydrochloride.

[0171] 3. Fe 3 O 4 Preparation of @PDA@Cys-BTI

[0172] Take Fe 3 O 4@PDA-SH was placed in a centrifuge tube, Cys-BTI was added, and the reaction was carried out at 25°C for a certain period of time. The magnetic nanomaterials were washed with deionized water until the supernatant did not contain free inhibitors. Fe 3 O 4 @PDA@Cys-BTI, sealed and stored at 4℃. 3 O 4 @PDA@Cys-BTI is trypsin affinity material.

[0173] 1. In order to make the Cys-BTI of the present invention in Fe 3 O 4 @PDA-SH achieves better immobilization efficiency. The present invention selects the volume of Cys-BTI and Fe 3 O 4 @PDA-SH mass ratio, immobilization time, pH value and Fe 3 O 4 The particle size is optimized. The specific experiment is as follows:

[0174] 1.1 Cys-BTI volume and Fe 3 O 4 Mass ratio of @PDA-SH

[0175] 1g Fe 3 O 4 PDA-SH and different volumes of Cys-BTI (1 mg / mL) were mixed and stirred at 25°C and 200 rpm for 5 h. The supernatant was discarded and the particles were washed with deionized water until the supernatant was colorless. The inhibitory activity was measured at 37°C.

[0176] like Fig.15 As shown, Fe 3 O 4 When the mass volume ratio of @PDA-SH to Cys-BTI was 1:10, the immobilization effect was the best.

[0177] 1.2 Fixation time:

[0178] In 1g Fe 3 O 4 @PDA-SH was added with 10 mL of Cys-BTI and fixed at 25°C and 200 rpm for 2 h, 4 h, 6 h, 8 h, 10 h, and 12 h, respectively. The particles were washed with deionized water until the supernatant was colorless, and the inhibitory activity was determined at 37°C.

[0179] The effect of different immobilization times on the immobilization efficiency Fig.16 As shown in Figure 2, with the extension of immobilization time, Fe 3 O 4The relative inhibition rate of @PDA@Cys-BTI showed an upward trend. When the immobilization time was extended to 10 hours, the relative inhibition rate reached the highest. When the immobilization time was further extended to 12 hours, there was no significant change in the fixed amount. Therefore, the optimal immobilization time was 10 hours.

[0180] 1.3 pH value:

[0181] In 1g Fe 3 O 4 10 mL of Cys-BTI was added to PDA-SH and fixed at 25°C and 200 rpm for 10 h at pH 7, pH 8, pH 9, and pH 10, respectively. The particles were washed with deionized water until the supernatant was colorless, and the inhibitory activity was measured at 37°C.

[0182] Effects of different pH values ​​on immobilization efficiency Fig.17 As shown, the immobilization effect was best at pH 10.

[0183] 1.4Fe 3 O 4 Particle size

[0184] The Fe particles with diameters of 20 nm, 50 nm, and 100 nm were modified by Traut's reagent. 3 O 4 @PDA magnetic nanoparticles, and then immobilized Cys-BTI under optimal conditions, and the inhibitory activity was measured at 37°C.

[0185] Effects of magnetic nanoparticles with different particle sizes of 20nm, 50nm, and 100nm on the immobilization efficiency Fig.18 As shown in the figure, it is shown that as the particle size increases, the inhibition rate decreases significantly, so the optimal particle size is 20nm.

[0186] Example 4

[0187] In order to illustrate the effect of the protease affinity material and the preparation method thereof provided by the present invention, the present invention selects the Fe prepared in Example 1 3 O 4 @PDA@Lys-BTI, Fe prepared in Example 2 3 O 4 @PDA@Arg-BTI and Fe prepared in Example 3 3 O 4 @PDA@Cys-BTI conducted a purification test of porcine trypsin. The specific test is as follows:

[0188] 1. Fe 3 O 4 @PDA@Lys-BTI and Fe 3 O 4Purification of porcine trypsin by @PDA@Arg-BTI

[0189] Take 0.5g Fe 3 O 4 @PDA@Lys-BTI and Fe 3 O 4 The @PDA@Arg-BTI samples were mixed with 2.5 mL 2 mg / mL commercial porcine trypsin, reacted at 37°C, 200 rpm for 30 min, and the supernatant was discarded. The samples were washed with distilled water for 3 times, and then eluted with 6% acetic acid solution. The supernatant was the purified sample. SDS-PAGE analysis results.

[0190] Among them, the source of porcine trypsin was purchased from Beijing Biotoda Technology Co., Ltd.

[0191] Fe 3 O 4 @PDA@Lys-BTI and Fe 3 O 4 @PDA@Arg-BTI purified trypsin protein electrophoresis Fig.19 shown.

[0192] Depend on Fig.19 It can be seen that Fe 3 O 4 @PDA@Lys-BTI and Fe 3 O 4 @PDA@Arg-BTI can specifically purify trypsin.

[0193] 2. Fe 3 O 4 Purification of porcine trypsin by @PDA@Cys-BTI

[0194] Take 0.5g Fe 3 O 4 The @PDA@Cys-BTI sample was mixed with 2.5 mL of 2 mg / mL commercial porcine trypsin, reacted at 25°C, 200 rpm for 30 min, and the supernatant was discarded. The sample was washed with distilled water for 3 times, and then eluted with 6% acetic acid solution. The supernatant was the purified sample. SDS-PAGE analysis results.

[0195] Fe 3 O 4 The results of @PDA@Cys-BTI purification of trypsin are as follows Fig. 20 shown.

[0196] Depend on Fig. 20 It can be seen that Fe 3 O 4@PDA@Cys-BTI can specifically purify trypsin.

[0197] 3. Fe 3 O 4 Thermal and pH stability of @PDA@Cys-BTI

[0198] Fe 3 O 4 @PDA@Cys-BTI was incubated in 20 mmol / L Tris-HCl buffer at pH 7.3 at 30°C, 40°C, 50°C, 60°C, 70°C and 80°C for 2 h, and then the inhibitory activity was measured to investigate the thermal stability. The relative inhibitory activity was calculated with the maximum inhibitory activity as 100%.

[0199] Fe 3 O 4 Thermal stability study of @PDA@Cys-BTI Fig.21 As shown; Fe 3 O 4 The pH stability of @PDA@Cys-BTI is as follows Fig. 22 shown.

[0200] Depend on Fig.21 and Fig. 22 It can be seen that Fe 3 O 4 @PDA@Cys-BTI has good thermal stability in the range of 30℃~80℃, and can still retain a relative inhibition rate of 92.06% after being exposed to 80℃ for 2h.

[0201] Fe 3 O 4 @PDA@Cys-BTI has good stability in the range of pH 3-pH 10, and the inhibitory activity is maintained above 80%.

[0202] 4. Fe 3 O 4 Reusability of @PDA@Cys-BTI

[0203] Weigh 0.5g Fe 3 O 4 @PDA@Cys-BTI purified trypsin, and after the reaction was completed, the reaction was terminated with a 6% by volume acetic acid solution, and then washed with deionized water 5 times, and the inhibitory activity of the affinity material was measured. Repeat 10 batches, and measure the inhibitory activity of the affinity material after each purification of trypsin. The initial inhibitory activity was taken as 100% to calculate the remaining inhibition rate, which reflects the adsorption rate of the affinity material to trypsin.

[0204] Repeated use stability results are as follows Fig.23 shown.

[0205] Depend on Fig.23 It can be seen that with the increase of the number of uses, Fe 3 O 4 The remaining inhibition rate of @PDA@Cys-BTI showed a downward trend, but after repeated use of 6 batches, the inhibition rate of the material on trypsin no longer decreased. After 10 batches, it still retained an inhibition rate of 60.62%, that is, the adsorption amount of trypsin was 60.62% of the first time.

[0206] 5. Adsorption capacity of affinity materials for trypsin

[0207] Load excess trypsin onto the adsorption material and determine the adsorption capacity of the affinity material. For example, load 15 mL of crude porcine trypsin with a concentration of 4 mg / mL onto 1 g of affinity material, adsorb at 25°C, 200 rpm for 30 min, discard the supernatant, wash the material 3 times with distilled water, and elute with 6% acetic acid solution. Adjust the pH of the eluate to 7 with 1M NaOH solution, determine the protein concentration with a BCA kit, and calculate the mass m of trypsin in the eluate, which is the adsorption capacity of the affinity material in mg / g. The results are shown in Table 2.

[0208] Table 2 Adsorption capacity of four affinity materials for trypsin

[0209] Affinity Materials Maximum adsorption capacity for trypsin (mg / g) <![CDATA[Fe 3 O 4 @PDA@BTI]]> <![CDATA[13.78±0.34mg / g c ]]> <![CDATA[Fe 3 O 4 @PDA@Lys-BTI]]> <![CDATA[15.54±0.03mg / g b ]]> <![CDATA[Fe 3 O 4 @PDA@Arg-BTI]]> <![CDATA[15.77±0.025mg / g b ]]> <![CDATA[Fe 3 O 4 @PDA@Cys-BTI]]> <![CDATA[18.22±0.41mg / g a ]]>

[0210] Note: Among them, a , b , c Indicates significant difference (P<0.05).

[0211] As shown in Table 2, the trypsin affinity materials prepared with the optimized inhibitors Lys-BTI, Arg-BTI and Cys-BTI as ligands have significantly higher adsorption capacity for trypsin than the unoptimized BTI. 3 O 4 The adsorption capacity of @PDA@Cys-BTI for trypsin reached 18.22±0.41 mg / g.

[0212] From the above experimental results, it can be seen that the trypsin affinity material and preparation method provided by the present invention are a method for immobilizing a directional immobilized buckwheat trypsin inhibitor. In the process of preparing the trypsin affinity material, the immobilization method provided by the present invention does not have the problem of activity reduction or loss after the protein affinity ligand is covalently bonded.

[0213] The immobilization method provided by the present invention is to screen the mutation site of BTI and introduce cysteine ​​at the N-terminus of BTI, so that the buckwheat trypsin inhibitor is fixed to the magnetic nanoparticles modified by Traut reagent through the cysteine ​​binding site, thereby avoiding the inhibitor from losing its inhibitory activity due to chemical reaction at the active site, thereby significantly improving the activity of the immobilized buckwheat trypsin inhibitor and the adsorption amount of trypsin. 3 O 4 @PDA@Cys-BTI still retained 60.62% of the residual inhibition rate after repeated use of 10 batches. 3 O 4 The adsorption capacity of @PDA@Cys-BTI for trypsin reached 18.22±0.41 mg / g, which was significantly higher than that of Fe 3 O 4 @PDA@BTI.

[0214] It should be noted that when the claims of the present invention involve numerical ranges, it should be understood that the two endpoints of each numerical range and any numerical value between the two endpoints can be selected. In order to avoid redundancy, the present invention describes a preferred embodiment.

[0215] Although the preferred embodiments of the present invention have been described, those skilled in the art may make additional changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.

[0216] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include these modifications and variations.

Claims

1. A method for preparing a trypsin affinity material, characterized in that: The steps include: Using Fe3O4 magnetic particles and dopamine hydrochloride as raw materials, magnetic nanoparticles Fe3O4@PDA are prepared; the molar ratio of the Fe3O4 magnetic particles to the dopamine hydrochloride is 0.8-1.2:1; The buckwheat trypsin inhibitor is modified, and an active amino acid is introduced into the N-terminus of the buckwheat trypsin inhibitor to obtain an optimized buckwheat trypsin inhibitor; wherein the active amino acid includes any one of cysteine, lysine and arginine; The trypsin affinity material is prepared by taking the magnetic nanoparticles Fe3O4@PDA and the optimized buckwheat trypsin inhibitor as raw materials; the mass ratio of the magnetic nanoparticles Fe3O4@PDA to the volume ratio of the optimized buckwheat trypsin inhibitor is 1:8-20.

2. The method for preparing the trypsin affinity material according to claim 1, characterized in that: The preparation method of the trypsin affinity material comprises the following steps: The magnetic nanoparticles Fe3O4@PDA and the optimized buckwheat trypsin inhibitor are mixed evenly, and reacted at 20°C to 28°C for 10h to 15h to obtain; The volume ratio of the mass of the magnetic nanoparticles Fe3O4@PDA to the optimized buckwheat trypsin inhibitor is 1:9-20.

3. The method for preparing a trypsin affinity material according to claim 1, characterized in that: The process for obtaining the optimized buckwheat trypsin inhibitor is as follows: Using the vector plasmid pQE30 BTI connected with the buckwheat trypsin inhibitor as a template, designing mutation primers with introduction sites, performing site-directed mutagenesis PCR amplification, and obtaining the BTI mutant eBTI; Connecting the vector pQE30 and the BTI mutant eBTI, transforming, and expressing to obtain the target protein eBTI mutant; Purifying the target protein eBTI mutant and freeze-drying it to obtain the optimized buckwheat trypsin inhibitor; The target protein eBTI mutant is obtained by introducing the active amino acid into the N-terminus of the buckwheat trypsin inhibitor; The active amino acid includes any one of cysteine, lysine and arginine; The target protein eBTI mutant includes any one of Lys-BTI, Arg-BTI and Cys-BTI.

4. The method for preparing a trypsin affinity material according to claim 3, characterized in that: The purification method is as follows: The expressed target protein eBTI mutant was purified using a Ni-NTA column.

5. The trypsin affinity material prepared by the method for preparing a trypsin affinity material according to any one of claims 1 to 4.

6. The trypsin affinity material according to claim 5, characterized in that The trypsin affinity material is used for specific purification of trypsin.

7. Use of the trypsin affinity material according to claim 6 in the purification of animal trypsin.

8. The use according to claim 7, characterized in that: The trypsin affinity material and the trypsin crude product are mixed and reacted at 20° C. to 28° C. and 180 rpm to 220 rpm for 20 min to 60 min; After the reaction is completed, the supernatant is discarded, and the lower layer of solid after the reaction is eluted with 5.8% to 6.2% by volume acetic acid solution; The supernatant after elution is the purified trypsin sample; The mass ratio of the trypsin affinity material to the volume ratio of the trypsin crude product is 1 g: 1 mL to 10 mL.

9. The use according to claim 8, characterized in that: The concentration of the crude trypsin is 1 mg / mL to 4 mg / mL.

Images