Oligodeoxynucleotide for preventing and treating cognitive impairment in perioperative period and application thereof

Abstract

The invention discloses an oligodeoxynucleotide for preventing and treating cognitive impairment in a perioperative period and application of the oligodeoxynucleotide. The oligodeoxynucleotide comprises an oligonucleotide unit as shown in SEQ ID NO: 1. The deoxyoligonucleotide drug disclosed by the invention is applied to in-vitro cultured neurons, so that the reduction of alpha-N-catenin expression of neurons caused by contact with anesthetic drugs and inflammatory factors can be smoothly blocked; the decoy medicine can also competitively block the combination of the FoxO3 and the ctnna2 enhancer, so that the transcription inhibition effect of the FoxO3 on the ctnna2 is blocked, and the cognitive impairment in the perioperative period is prevented and treated.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to an oligodeoxynucleotide for preventing and treating perioperative cognitive dysfunction and an application thereof. Background Art

[0002] Perioperative cognitive disorders (PND) are common complications after anesthesia surgery, with an incidence rate as high as 1.9%-31%, affecting 5.89 million to 65 million surgical patients worldwide each year. Although clinical studies have identified a variety of risk factors associated with the occurrence of PND, such as advanced age, major surgery, diabetes, low education level, and longer surgery time, its pathogenic mechanism remains unclear, and there are no effective intervention measures, which seriously affects the long-term recovery of patients. In clinical practice, even in elderly patients who undergo the same major and long-term anesthesia surgery, the time course and severity of their neurological function are very different, suggesting that there are certain intrinsic factors that affect patients' susceptibility to PND. Exploring the intrinsic factors and mechanisms of PND susceptibility and developing targeted prevention and treatment strategies for susceptible patients are key scientific issues in this field.

[0003] In recent years, the relationship between diseases and gene polymorphisms and epigenetic changes has become a research focus, among which single nucleotide polymorphisms (SNPs) have become the key biological basis for explaining the susceptibility of various diseases. In the early stage, a whole genome sequence (GWAS) of peripheral blood was designed to compare elderly patients with PND and those without PND after major general anesthesia surgery for high-risk patients. It was found that 27 SNP mutations were significantly different. Among the 17 SNP mutations associated with increased risk of PND, 6 were related to the ctnna2 gene, which highly suggested that ctnna2 gene SNP mutations may mediate PND susceptibility. Therefore, we developed an oligodeoxynucleotide drug that can specifically bind to and antagonize the protein function that affects ctnna2 transcription for SNP mutations, and verified the functional role of the drug in preventing postoperative cognitive dysfunction in animal models. Summary of the invention

[0004] In order to reveal the intrinsic relationship between gene SNP mutation and PND and effectively prevent and treat perioperative cognitive dysfunction, the present invention provides the following technical solutions:

[0005] In a first aspect, the present invention provides an oligodeoxynucleotide (decoy), wherein the oligodeoxynucleotide comprises an oligonucleotide unit as shown in SEQ ID NO:1.

[0006] Preferably, the number of the oligonucleotide units is 1 to 10, for example: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10.

[0007] Specifically, the sequence shown in SEQ ID NO: 1 is: TTCTGTAAACC.

[0008] Preferably, the sequence of the oligodeoxynucleotide is as shown in SEQ ID NO:2.

[0009] Specifically, the sequence shown in SEQ ID NO: 2 is as follows:

[0010] TGTTCTGTAAACCCTAGTTCTGtAAACCTATTTTTTATAGGTTTACAGAA CTAGGGTTTTACAGAACA.

[0011] In a second aspect, the present invention provides a composition comprising the oligodeoxynucleotide described in the first aspect.

[0012] In a third aspect, the present invention provides a drug for preventing and / or treating perioperative cognitive dysfunction, wherein the drug comprises the oligodeoxynucleotide described in the first aspect or the composition described in the second aspect.

[0013] Preferably, the concentration of the oligodeoxynucleotide in the drug is 0.1 to 10 μM, for example: 0.1 μM, 0.5 μM, 1 μM, 2 μM, 3 μM, 4 μM, 5 μM, 6 μM, 7 μM, 8 μM, 9 μM, 10 μM.

[0014] Preferably, the dosage of the drug is 1 to 20 nM / time, for example: 1 nM / time, 2 nM / time, 5 nM / time, 7 nM / time, 10 nM / time, 13 nM / time, 15 nM / time, 17 nM / time, 20 nM / time.

[0015] Preferably, the drug is administered at a frequency of 1 time / day to 1 time / 2 weeks, for example, 1 time / day, 1 time / 2 days, 1 time / 3 days, 1 time / week, 1 time / 2 weeks.

[0016] Preferably, the drug further comprises a pharmaceutically acceptable carrier. The carrier may be a carrier conventionally used in the field of nucleic acid drugs, such as but not limited to magnetic nanoparticles (such as Fe3O4, Fe2O3), carbon nanotubes, mesoporous silicon, calcium phosphate nanoparticles, polyethyleneimine (PEI), polyamidoamine (PAMAM) dendrimer, poly (L-lysine), chitosan, 1,2-dioleoy l-3-trimethylammonium-propane (DOTAP), poly (D&L-lactic / glycolic acid) copolymer (PLGA), poly (2-aminoethylethylene phosphate) Phosphate), PPEEA) and poly(methacrylate-N,N-dimethylaminoethyl ester) (poly(2-dimethylaminoethylmethacrylate), PDMAEMA) and one or more of their derivatives. The present invention has no particular requirements on the content of the pharmaceutically acceptable carrier.

[0017] Preferably, the drug may further include pharmaceutically acceptable excipients. The excipients may be one or more of various preparations or compounds conventionally used in the art, such as pH buffer, protective agent and osmotic pressure regulator.

[0018] Furthermore, the pH buffer may be a tris(hydroxymethyl)aminomethane hydrochloride buffer with a pH value of 7.5-8.5 and / or a phosphate buffer with a pH value of 5.5-8.5.

[0019] Furthermore, the protective agent may be at least one of inositol, sorbitol, sucrose, trehalose, mannose, maltose, lactose and glucose.

[0020] Furthermore, the osmotic pressure regulator may be sodium chloride and / or potassium chloride.

[0021] Preferably, the drug can be a liquid preparation (such as an injection) or a freeze-dried powder injection, which is mixed with a liquid auxiliary material to prepare a liquid preparation during administration.

[0022] Furthermore, the liquid preparation can be used for, but not limited to, subcutaneous, intramuscular or intravenous administration, and can also be administered to the lungs by spraying (such as nasogastric feeding).

[0023] In a fourth aspect, the present invention provides use of the oligodeoxynucleotide described in the first aspect or the composition described in the second aspect in the preparation of a medicament for preventing and / or treating perioperative cognitive dysfunction.

[0024] Preferably, the application includes at least one of the following:

[0025] (1) Application in the preparation of drugs for inhibiting FoxO3 activity in the nervous system;

[0026] (2) Application in the preparation of drugs for upregulating ctnna2 gene expression;

[0027] (3) Application in the preparation of drugs for promoting neuronal α-N-catenin expression.

[0028] Beneficial effects of the present invention:

[0029] (1) The decoy drug of the present invention can successfully block the decrease in neuronal α-N-catenin expression caused by exposure to anesthetic drugs and inflammatory factors in in vitro cultured neurons.

[0030] (2) The decoy drug of the present invention competitively blocks the binding of FoxO3 to the ctnna2 enhancer, thereby blocking the transcriptional inhibitory effect of FoxO3 on ctnna2, and can prevent and treat perioperative cognitive dysfunction. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 Shown is the binding result of MA0157.1FOXO3 protein and the sequence near ctnna2rs12472215 when the SNPrs12472215 site is T;

[0032] Figure 2 Shown are the results of Barnes maze learning and memory function in normal mice after surgery or non-surgery;

[0033] Figure 3 Shown are representative western blot images and statistical graphs of decreased α-N-catenin expression in the mouse hippocampus after surgery;

[0034] Figure 4The figure shows the effect of constructing and bilaterally injecting ctnna2 interference virus into the hippocampus on the spatial learning and memory function of mice. A. Schematic diagram of the infection range of fluorescent injection with mCherry; B. Western blot and statistical graph of α-N-catenin protein expression in hippocampal tissue 3 weeks after virus expression; C. Statistical graph of the average time for the two groups of mice to find the hiding hole during the Barnes maze learning process; D. Statistical graph of the latency of the two groups of mice to find the hiding hole during the short-term (1d) and long-term (8d) memory test of the Barnes maze;

[0035] Figure 5 Shown are the effects of FoxO3 acting on the enhancer site near rs12472215 on ctnna2 expression in human H293T cells; A. The effect of FoxO3 on the expression of plasmids introducing sequences near rs12472215; B. The effect of FoxO3 plasmid on the A>T mutant sequence and wild-type sequence at the rs12472215 site;

[0036] Figure 6 Shown is the decoy chromatographic identification result;

[0037] Figure 7 Shown is the decoy mass spectrometry identification result;

[0038] Figure 8 The figure shows the effect of different concentrations of TNF-α simulating neuroinflammation and 1.4% Isoflurane stimulation for 2 hours on the expression of α-N-catenin in primary cortical neurons of mice;

[0039] Fig. 9 Shown is the effect of Decoy drug on α-N-catenin expression;

[0040] Fig.10 The figure shows the effect of decoy on the expression of α-N-catenin in the hippocampus after surgery; A. Fluorescence expression in the mouse brain after nasal instillation of decoy-FITC for 2 hours; B. Fluorescence expression in the mouse brain after tail vein injection of decoy-FITC for 2 hours; C. Effect of tail vein injection of decoy on the expression of α-N-catenin in the hippocampus of mice 3 days after surgery;

[0041] Fig.11 The figure shows the effect of tail vein injection of decoy on the learning and memory function of mice in the Barnes maze test after surgery;

[0042] Fig.12 Shown are the levels of liver and kidney function indicators in mice injected with decoy via tail vein one day;

[0043] Fig.13 Shown is a schematic diagram of the decoy structure;

[0044] In the figure, * indicates P<0.01, ** indicates P<0.01, and **** indicates P<0.0001. DETAILED DESCRIPTION

[0045] The technical solution of the present invention is further described below in conjunction with the embodiments and drawings, and the advantages and features of the present invention will become clearer with the description. However, it should be understood that the embodiments are only exemplary and do not limit the scope of the present invention.

[0046] Example 1 Screening and determination of mutation sites for intervention in differential ctnna2 transcription after surgical anesthesia

[0047] 1.1 Screening of intervention sites and bioinformatics analysis of potential transcription factors

[0048] The binding ability prediction of the human 20bp (TAATGATTTGAAAACAATCT (SEQ ID NO: 3)) nucleotide sequence centered on the rs12472215 site with the FOX family was retrieved from the JASPAR database and ranked by the predicted binding score; at the same time, the types of transcription factors enriched in neurons of the nervous system were retrieved from the human protein atlas database. As shown in Tables 1, 2 and Figure 1 As shown, when the rs12472215 site is A, the 20bp sequence does not bind to MA0157.2.FOXO3, while when the rs12472215 site is T, the 20bp sequence has the highest prediction score of binding to MA0157.2.FOXO3, up to 8.98. Therefore, it is predicted that the mutation may affect the transcription of the ctnna2 gene by affecting the binding ability of the sequence to FoxO3.

[0049] Table 1 Ranking results of the predicted scores of the binding ability between the nearby 20 bp sequences and FOX family proteins when the SNPrs12472215 site in Ctnna2 is A

[0050]

[0051] Table 2 Ranking results of the predicted scores of the binding ability between the nearby 20 bp sequences and FOX family proteins when the SNPrs12472215 site in Ctnna2 is T

[0052]

[0053]

[0054] Example 2: Ctnna2 gene expression affects postoperative cognitive function in mice

[0055] 2.1 Establishment of animal model

[0056] Adult C57 mice were randomly divided into a control group and an experimental group. The experimental group underwent simulated laparotomy and

[0057] The mice were anesthetized with 1.4% isoflurane for 2 hours. The open field test was performed on the 6th day after surgery to detect the basal motor function of the mice. The Barnes maze test was performed on the 7th to 11th day and the 18th day after surgery to detect the spatial learning and memory function of the mice.

[0058] like Figure 2 As shown, the spatial learning and memory functions of mice after surgery were significantly lower than those of the control group, indicating that the animal model was successfully constructed.

[0059] 2.2 Expression of α-N-catenin in the hippocampus of mice after anesthesia and surgery

[0060] Adult C57 mice were randomly divided into a control group and an experimental group. The treatment of each group was the same as in 2.1. The hippocampal tissues were obtained by perfusion at 3 hours, 1 day, 3 days and 7 days after surgery, and the protein (α-N-catenin) expression was detected by western blot.

[0061] like Figure 3 As shown in the figure, compared with the control group, the expression of α-N-catenin in the experimental group mice was significantly decreased after surgery.

[0062] 2.3 Effects of siRNA interference virus inhibition of ctnna2 gene expression on cognitive function of mice

[0063] The mice were randomly divided into shCTNNA2 group and scramble group, and AAV virus was injected into bilateral hippocampus 3 weeks in advance. The viruses used were shCTNNA2 (downregulating ctnna2 gene transcription) and scramble (control). After the virus was stably expressed, no surgical anesthesia was performed. The open field test was performed on the 6th day to detect the basal motor function of the mice, and the Barnes maze test was performed on the 7th-11th day and the 18th day to detect the spatial learning and memory function of the mice.

[0064] like Figure 4 As shown, compared with the control group, the expression level of α-N-catenin and the spatial learning and memory function of mice in the shCTNNA2 group were significantly decreased, indicating that inhibiting the expression of the ctnna2 gene reduced the cognitive function of mice.

[0065] Example 3 Effect of FoxO3 on ctnna2 transcription before and after the rs12472215 A>T mutation in ctnna2

[0066] 3.1 In human H293T cells, the effect of FoxO3 on the transcription of the pGL3-rs12472215 enhancer region sequence near rs12472215 was verified: the enhancer sequence near the rs12472215 site was inserted into the pgl3 promoter plasmid. HEK 293T cells were seeded into 96-well plates, Lipo2000 (0.5 μL) and pGL3-rs12472215 promoter (0.1 μL), or empty plasmid (0.1 μL) was added to each well, and different concentrations of FoxO3 overexpression plasmids and internal reference TK gene plasmids were transferred at the same time. After 6 hours, the cells were transferred to complete medium containing 10% FBS and co-cultured for 48 hours. The expression of the reporter gene was detected using a reporter gene kit (Invitrogen, Carlsbad, CA).

[0067] 3.2 Comparison of the difference in the effect of FoxO3 on the original sequence and the A>T mutant sequence: Two different enhancement sequences near the rs12472215 site (A or T) were inserted into the pgl3 promoter plasmid (defined as wt or A>T mut). HEK293T cells were seeded into 96-well plates, and Lipo2000 (0.5 μL) and pGL3-rs12472215 (A or T) (0.1 μL) were added to each well, and a uniform concentration of FoxO3 overexpression plasmid and an internal reference TK gene plasmid were transferred at the same time. After 6 hours, the cells were transferred to complete medium containing 10% FBS and co-cultured for 48 hours. The expression of the reporter gene was detected using a reporter gene kit.

[0068] like Figure 5 As shown, FoxO3 dose-dependently regulated the expression of pGL3-rs12472215 plasmid, and pGL3-rs12472215 (T, i.e. Figure 5 B) was significantly more affected by FoxO3 transcriptional repression than pGL3-rs12472215 (A, Figure 5 The wt group in B) is stronger.

[0069] Example 4 Preparation of oligodeoxynucleotide drugs (decoys) that specifically block FoxO3 from ctnna2 transcription

[0070] 4.1Decoy design: design, synthesis and sequencing of conjugated antisense oligonucleotides

[0071] Take the sequence containing the rs12472215 site and predicted on Jaspar to bind to FoxO3 after the A>T mutation: GTAAAC, and extend the original sequence in the human ctnna2 gene sequence by 4 bp before and 1 bp after (to center the rs12472215 site), a total of 11 bp in length (TTCTGTAAACC). Start with 5'-tg, repeat the 11 bp sequence twice, connect with ctag in the middle, form the circular part of the hairpin DNA with ttttt, and connect with the antisense complementary base repeated twice, ending with ca-3', forming the following Fig.13 Hairpin oligodeoxynucleotide DNA drug shown.

[0072] 4.2 Synthesis and identification of decoy

[0073] Deoxy oligonucleotides (decoy) were synthesized by Yangling Tianrun Aoke Biotechnology Co., Ltd. The HPLC detection wavelength was 260 nm, and the detection conditions are shown in Table 3. Figure 6 As shown in Figure 4, the peak time of decoy was 11.791 min, the purity of the final single-stranded DNA product was >98%, and the structure was identified by ESI-MS. The detection conditions are shown in Table 4. Figure 7 As shown, the molecular weight of decoy is 20609.53, and the sequence length is 67 nt.

[0074] Table 3 Decoy chromatographic identification conditions

[0075]

[0076] Table 4 Decoy mass spectrometry identification conditions

[0077]

[0078]

[0079] Example 5 Effect of decoy on α-N-catenin expression after anesthesia stimulation in mice in vitro and in vivo

[0080] 5.1 In vitro model of neuronal injury induced by simulated surgical anesthesia and the effect of such stimulation on α-N-catenin expression

[0081] The cultured primary neurons of C57 mice were randomly divided into a control group (sham), a simulated surgical anesthesia TNF-α (20 ng / mL) dosage group, and a simulated surgical anesthesia TNF-α (40 ng / mL) dosage group. The simulated surgical anesthesia group was added with the corresponding dose of TNF-α and placed in a sealed jar. The anesthesia machine was connected to adjust the isoflurane concentration in the jar to 1.4% and then sealed. The sealed jar was placed in a 37°C constant temperature incubator for 2 hours. After the gas in the jar was exhausted, the ordinary culture medium was replaced and the jar was continued to be cultured in a cell culture incubator for 24 hours. After that, the cells were collected for Western blot experiment to detect protein expression.

[0082] like Figure 8 As shown, 20 or 40 ng / mL of TNFα+1.4% isoflurane significantly inhibited the protein expression of neuronal α-N-catenin.

[0083] 5.2 Effect of decoy on surgical anesthesia on α-N-catenin expression

[0084] The cultured primary neurons of C57 mice were randomly divided into a control group (sham), a simulated surgical anesthesia group, and a Decoy intervention simulated surgical anesthesia group. First, 1 μL of 5 nmol of Decoy reaction was added to the Decoy intervention simulated surgical anesthesia group for 30 minutes. Then, TNF-α (40 ng / mL) was added to the simulated surgical anesthesia group and the Decoy intervention simulated surgical anesthesia group and placed in a sealed jar. The anesthesia machine was connected to adjust the isoflurane concentration in the jar to 1.4% and then sealed. The sealed jar was placed in a 37°C constant temperature incubator for 2 hours. After the gas in the jar was exhausted, the ordinary culture medium was replaced and the jar was cultured in a cell culture incubator for 24 hours. After that, the cells were collected for Western blot experiment to detect protein expression.

[0085] like Fig. 9 As shown, Decoy drug significantly reversed the decrease in α-N-catenin expression caused by surgical anesthesia (TNF-α+1.4% isoflurane).

[0086] 5.3 Effects of Decoy nasogastric or intravenous injection into the brain and intravenous injection on the expression of α-N-catenin in the hippocampus of mice after surgery

[0087] The decoy drug labeled with FITC was administered by nasogastric administration of 0.2 OD or by tail vein injection of 1 OD (1.6 nmol) for a total of 160 μL. Brain slices were observed 6 hours after administration. Fig.10 As shown in A and 10B, there were different degrees of fluorescence imaging in the brains of mice injected by nasogastric or tail vein, indicating that the drug could enter the nervous system through the blood-brain barrier.

[0088] In addition, the mice were randomly divided into 4 groups: control DNA group (no surgical anesthesia), Decoy group (no surgical anesthesia), control DNA + surgical anesthesia group, and Decoy + surgical anesthesia group. The control DNA + surgical anesthesia group and the Decoy + surgical anesthesia group underwent simulated laparotomy and inhaled 1.4% isoflurane for 2 hours. After the operation, 1.6 nmol control DNA or an equal volume (160 μL) of Decoy was immediately injected through the tail vein. Three days later, the hippocampal tissue was perfused and the expression of α-N-catenin protein was detected.

[0089] like Fig.10 As shown, decoy drugs can significantly reverse the decrease of α-N-catenin expression in the hippocampus of mice after surgery.

[0090] The DNA sequence of the control group is as follows:

[0091] TgTCAACTgTACTCTAgTCAACTgTACTTATTTTTTATAAgTACAgTTgACT AgAgTACAgTTgACA (SEQ ID NO: 4)

[0092] 5.4 Effects of Decoy tail vein injection on postoperative cognitive function in mice

[0093] The mice were randomly divided into a Decoy intervention group and a control group. Both groups underwent simulated laparotomy and inhaled 1.4% isoflurane for 2 hours. Immediately after the operation, Decoy 1OD (1.6nmol, 160μL) or an equal volume of solvent were injected through the tail vein. The open field test was performed on the 6th day after surgery to detect the basal motor function of the mice, and the Barnes maze test was performed on the 7th to 11th day and the 18th day to detect the spatial learning and memory function of the mice.

[0094] like Fig.11 As shown, compared with the control group, Decoy can significantly improve the postoperative cognitive function of mice.

[0095] Example 6 Toxicity test of decoy in mice

[0096] The mice were randomly divided into a control group and a Decoy group. The Decoy group was injected with 160 μL of 1.6 nmol Decoy through the tail vein, and the control group was injected with 160 μL of normal saline. After 24 hours, whole blood was collected and allowed to stand for 2 hours, then centrifuged and serum was extracted for biochemical detection.

[0097] like Fig.12 As shown in the figure, one day after a single injection of 1.6 nmol of decoy was given to mice through the tail vein, the liver and kidney function indexes of the mice increased slightly, except for ALP, which indicated that the mice had good tolerance to decoy drugs.

[0098] The preferred embodiments of the present invention are described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the technical concept of the present invention, a variety of simple modifications can be made to the technical solution of the present invention, and these simple modifications all belong to the protection scope of the present invention.

Claims

1. An oligodeoxynucleotide, characterized in that: The oligodeoxynucleotide comprises an oligonucleotide unit as shown in SEQ ID NO: 1, and the number of the oligonucleotide units is 1 to 10.

2. The oligodeoxynucleotide according to claim 1, characterized in that: The sequence of the oligodeoxynucleotide is shown in SEQ ID NO:

2.

3. A composition, characterized in that: The composition comprises the oligodeoxynucleotide according to any one of claims 1-2.

4. A drug for preventing and / or treating perioperative cognitive dysfunction, characterized in that: The drug comprises the oligodeoxynucleotide according to any one of claims 1-2 or the composition according to claim 3.

5. The drug according to claim 4, characterized in that: The concentration of the oligodeoxynucleotide in the drug is 0.1-10 μM.

6. The drug according to claim 4, characterized in that: The administration method of the drug includes nasogastric feeding, subcutaneous injection, intramuscular injection or intravenous injection.

7. The drug according to claim 4, characterized in that: The dosage of the drug is 1-20 nM, and the administration frequency is 1 / day to 1 / 2 week.

8. Use of the oligodeoxynucleotide according to any one of claims 1 to 2 or the composition according to claim 3 in the preparation of a medicament for preventing and / or treating perioperative cognitive dysfunction.

9. The use according to claim 8, characterized in that: The application includes at least one of the following: (1) Application in the preparation of drugs for inhibiting FoxO3 activity in the nervous system; (2) Application in the preparation of drugs for upregulating ctnna2 gene expression; (3) Application in the preparation of drugs for promoting neuronal α-N-catenin expression.

Images