Fusarium proliferatum and its application in oil degradation

Abstract

The present invention provides a Fusarium proliferatum and its application in oil degradation. Fusarium proliferatum was deposited in the General Microbiological Center of China National Microbiological Culture Collection Administration on November 20, 2023, with a deposit number of CGMCC No. 40988. The provided Fusarium proliferatum can effectively degrade oil.

Description

Technical Field

[0001] The invention relates to the technical field of agricultural microorganisms, and relates to a strain of Fusarium proliferatum and application thereof in oil degradation. Background Art

[0002] Fusarium proliferatum (Fusarium spp.) is an important plant pathogen. It belongs to the asexual fungi and the sexual stage is the Ascomycetes. It has a wide variety of species and is widely distributed. It is commonly found in soil and animal and plant organisms. There are many types of Fusarium mycotoxins. Trichothecenes, fumonisins and zearalenone are the three most important types of Fusarium mycotoxins, which are mainly produced by Fusarium raminearum, Fusarium verticillioides and Fusarium culmorum. In recent years, with the great breakthrough in the whole genome sequencing of Fusarium, the molecular biology research of Fusarium mycotoxins is gradually becoming a research hotspot and has made important progress. A series of related functional genes and gene families involved in regulating the biosynthesis of mycotoxins in the Fusarium genome are being discovered and studied. New functional Fusarium needs to be further discovered.

[0003] In remote rural areas, waste with high oil content, such as kitchen waste, is not easy to transport to towns for unified treatment, and oil-water separation technology has not yet been popularized. The high oil content affects the aerobic fermentation and humification process of kitchen waste and the quality of fertilizer products. There is an urgent need for oil treatment technology similar to this scenario to improve the resource utilization of oil-containing pollutants. Summary of the invention

[0004] The present invention aims to solve one of the technical problems in the related art at least to some extent. The present invention provides a Fusarium proliferatum, which can be used for oil degradation.

[0005] Specifically, the present invention provides the following technical solutions:

[0006] In the first aspect of the present invention, a Fusarium proliferatum is provided, which was deposited in the General Microbiology Center of China Culture Collection Administration on November 20, 2023, with the deposit number CGMCC No. 40988, and the deposit address is: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0007] According to an embodiment of the present invention, the sequence of 18s rDNA of Fusarium proliferatum is shown as SEQ ID NO:1.

[0008] In a second aspect of the present invention, a microbial agent is provided, which is prepared according to the Fusarium proliferatum described in the first aspect.

[0009] According to an embodiment of the present invention, the microbial agent is a dry powder or a bacterial liquid, and the effective viable count of Fusarium proliferatum in the dry powder or the bacterial agent is at least 2×10 10 CFU / mL.

[0010] According to an embodiment of the present invention, the microbial agent is obtained by fermenting the Fusarium proliferatum in an enriched culture medium containing 0.16 wt % to 1.6 wt % of animal and plant fats and oils.

[0011] According to an embodiment of the present invention, the formula of the enrichment medium includes MgSO4·7H2O 0.1-0.5g, (NH4)2SO41-2g, KH2PO4 0.3-1g, K2HPO4 1-2g, NaCl 3-8g, soybean oil 1.6-16g, deionized water 1000mL, pH 7.0-7.2.

[0012] The fermentation culture conditions are as follows: after the Fusarium proliferatum is inoculated into the enrichment culture medium, the culture is fermented at 28-32° C. and 100-150 r / min for 2-7 days.

[0013] The third aspect of the present invention provides a method for degrading oil in a sample or a place, comprising: mixing and culturing the Fusarium proliferatum described in the first aspect or the microbial agent described in the second aspect with the sample, or placing it in a place containing oil, so as to degrade the oil in the sample or the place.

[0014] According to an embodiment of the present invention, the inoculation amount of Fusarium proliferatum is 0.2-5% (w / w) of the amount of the sample.

[0015] According to an embodiment of the present invention, the sample is selected from restaurant kitchen waste, grease-containing waste (such as wastewater, waste gas, waste residue), etc., and the place includes at least one of a grease-containing sewage pipe and a grease-containing pollutant collection place.

[0016] The fourth aspect of the present invention provides a use of the Fusarium proliferatum described in the first aspect or the microbial agent described in the second aspect in the field of oil degradation.

[0017] The beneficial effects achieved by the present invention are at least:

[0018] The Fusarium proliferatum provided by the present invention can effectively degrade oils and fats, and its main function is to accelerate the oil metabolism process. In addition, the Fusarium proliferatum provided can improve the original microbial community structure and microecology, and reduce the pollution of oil-containing pollutants to the environment. The Fusarium proliferatum provided can be prepared into a solid powder or liquid exogenous microbial agent as needed, and used in the field of oil degradation.

[0019] Deposit certificate

[0020] Fusarium proliferatum, the deposit number is CGMCC No.40988, the deposit institution is: General Microbiology Center of China Culture Collection Administration, the deposit date is: November 20, 2023, and the deposit address is: No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 A schematic diagram of the colony characteristics of Fusarium proliferatum provided according to an embodiment of the present invention.

[0022] Figure 2 This is a schematic diagram of the morphological characteristics of Fusarium proliferatum provided according to an embodiment of the present invention.

[0023] Figure 3 This is a diagram of oil degradation according to an embodiment of the present invention.

[0024] Figure 4 This is a growth trend chart of Fusarium proliferatum provided according to an embodiment of the present invention.

[0025] Figure 5 This is a pH trend graph of Fusarium proliferatum provided according to an embodiment of the present invention.

[0026] Figure 6 This is a temperature change diagram of Fusarium proliferatump composting according to an embodiment of the present invention.

[0027] Figure 7 This is a graph showing changes in the oil content of Fusarium proliferatump according to an embodiment of the present invention. DETAILED DESCRIPTION

[0028] Embodiments of the present invention are described in detail below. Examples of the embodiments are shown in the accompanying drawings. The embodiments described below with reference to the accompanying drawings are exemplary and are intended to be used to explain the present invention, but should not be construed as limiting the present invention.

[0029] The present invention provides a Fusarium proliferatum, which was deposited in the General Microbiology Center of China Microorganism Culture Collection Administration on November 20, 2023, with a deposit number of CGMCC No.40988, and a deposit address of No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing.

[0030] The sequence of 18s rDNA of Fusarium proliferatum is shown in SEQ ID NO:1.

[0031] Its 18s rDNA sequence is as follows:

[0032] AAACTCGATAATGATCCCTCCGTAGGTGAACCTGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCCTGTGAACATACCAATTGTTGCCTCGGCGGATCAGCCCGCTCCCGGTAAAACGGGACGGCCCGCCAG AGGACCCCTAAACTCTGTTTCTATATGTAACTTCTGAGTAAAACCATAAATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCAAAATGCGATAAGTAATGTGAATTGCAGAAT TCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCCCGGGTTTGGTGTTGGGGATCGGCGAGCCCTTGCGGCAAGCCGGCCC CGAAATCTAGTGGCGGTCTCGCTGCAGCTTCCATTGCGTAGTAGTAAAACCCTCGCAACTGGTACGCGGCGCGCCCAAGCCGTTAAACCCCCAACTTCTG-AAGTTGACCTCGGATCAGGTAGGAATACCCGCT(SEQ ID NO:1)

[0033] The provided Fusarium spp. is obtained by taking food waste and step-by-step gradient screening through a culture medium containing animal and vegetable oils. After gradient acclimation through an enrichment medium containing animal and vegetable oils, the Fusarium spp. is obtained by streaking separation. The animal and vegetable oils mentioned include but are not limited to soybean oil, corn oil, peanut oil, lard, etc. According to a preferred embodiment, the vegetable oil mentioned is soybean oil.

[0034] The present invention also provides a microbial agent, which is prepared according to the above-mentioned Fusarium solani. According to a specific embodiment, the microbial agent can be prepared in the form of dry powder or bacterial liquid, and the effective viable bacteria count of the Fusarium solani in the dry powder or bacterial agent is at least 2×10 10 CFU / mL, for example, about 3×10 10 CFU / mL, 4×10 10 CFU / mL, 5×10 10 CFU / mL, 6×10 10 CFU / mL, 7×10 10 CFU / mL, 8×10 10CFU / mL, 9×10 10 CFU / mL, etc. Before use, the dry powder can be activated with a certain amount of sterile water or special culture solution in advance, for example, it can be activated for 2 to 8 hours.

[0035] The microbial agent can be obtained by fermentation. According to a specific embodiment, the microbial agent is obtained by fermenting the Fusarium solani using an enrichment medium containing 0.16wt% to 1.6wt% animal and plant oils and fats (soybean oil according to a preferred embodiment). The fermentation and culture conditions are as follows: after the Fusarium solani is inoculated into the enrichment medium, the fermentation and culture is carried out for 2 to 7 days at 28 to 32°C and 100 to 150r / min. For example, the fermentation and culture is carried out for 5 to 7 days.

[0036] According to an embodiment of the present invention, the formula of the enrichment medium includes MgSO4·7H2O 0.1-0.5g, (NH4)2SO41-2g, KH2PO4 0.3-1g, K2HPO4 1-2g, NaCl 3-8g, soybean oil 1.6-16g, deionized water 1000mL, pH 7.0-7.2.

[0037] The above-mentioned Fusarium solani or the above-mentioned microbial agent can be added to the basic fertilizer to obtain a microbial fertilizer, so as to be used in places where oil degradation is required. The basic fertilizer mentioned can be a compost organic fertilizer. The compost organic fertilizer mentioned can be domestic garbage compost (using raw garbage (food waste) generated in the kitchen for composting); or some dead wood compost (adding chicken manure or oil residue and other fermentation auxiliary materials to the bark for composting); or leaf mold compost (obtained from fallen leaves of deciduous broad-leaved trees), etc.

[0038] The present invention also provides a method for degrading grease in a sample or a place, comprising: mixing and culturing the above-mentioned Fusarium solani or the above-mentioned microbial agent or the above-mentioned microbial fertilizer with the sample, or placing the sample in a place containing grease, so as to degrade the grease in the sample or the place. The mentioned place includes but is not limited to a place for collecting restaurant (kitchen waste) garbage, restaurant (kitchen waste) garbage that is difficult to transport for centralized treatment in remote rural areas, and sewage pipes rich in grease.

[0039] The above-mentioned Fusarium solani or microbial agent can be applied in the field of oil degradation, and the oil degradation efficiency thereof is at least above 90%, for example, above 91%, above 92%, or even above 93%, or above 95%.

[0040] The technical scheme of the present invention is described below by specific examples. It should be noted that these examples are only used to facilitate the understanding of those skilled in the art and should not be regarded as limiting the scope of protection of the present invention. Unless otherwise specified, the reagents used in the examples can be obtained commercially.

[0041] Example 1

[0042] Example 1 A strain of Fusarium spp. was obtained by screening by the following method, which specifically includes:

[0043] Materials in the high-temperature composting period were obtained from a restaurant kitchen waste treatment company in Suzhou, China Agricultural University. 5 g of the sample was weighed and placed in 250 mL of enrichment medium (the first concentration of soybean oil gradient: 1.6 g / L, 2.4 g / L, 3.2 g / L, 4 g / L, 4.8 g / L), and cultured at 30 °C and 120 r / min for 6 to 7 days. Then 5 mL of the bacterial solution was taken and placed in 250 mL of new enrichment medium (the second concentration of soybean oil gradient: 1.6 g / L, 2.4 g / L, 3.2 g / L, 4 g / L, 4.8 g / L), and cultured under the same conditions for 6 to 7 days. 7 days, and 6 cycles of gradient acclimation (the third concentration of soybean oil gradient: 3.2g / L, 4g / L, 4.8g / L, 5.6g / L, 6.4g / L; the fourth concentration of soybean oil gradient: 3.2g / L, 4.8g / L, 5.6g / L, 6.4g / L, 8g / L; the fifth concentration of soybean oil gradient: 6.4g / L, 9.6g / L, 11.2g / L, 12.8g / L, 16g / L; the sixth concentration of soybean oil gradient: 6.4g / L, 9.6g / L, 11.2g / L, 12.8g / L, 16g / L). Then the bacterial solution of the 6th cycle was gradiently diluted and inoculated on neutral red medium respectively, and cultured at 30℃ for 48 hours to observe whether the colony turns red. If it turns red, it means that the strain can degrade oil and produce fatty acids.

[0044] The reddish colonies were screened and picked with an inoculation loop for streak separation. The purified strains were stored in beef extract peptone solid slant medium for later use.

[0045] The enrichment medium formula used includes: basic medium and soybean oil with a certain concentration gradient. The basic medium includes: MgSO4·7H2O 0.1g, (NH4)2SO41.0 g, KH2PO4 0.3g, K2HPO4 1.5g, NaCl 5.0g, deionized water 1000mL, pH 7.0-7.2. Soybean oil with a certain concentration gradient (using soybean oil as the only carbon source for gradient screening and domestication of microorganisms), the mass concentration increases gradually with the domestication cycle (as shown above).

[0046] The beef extract peptone solid culture medium used is formulated as follows: beef extract 5g, NaCl 5g, peptone 10g, agar powder 20g, deionized water 1000mL, pH 7.0. It includes two types: flat plate and slant plate.

[0047] The formula of the neutral red culture medium used is: add 1 mL of 1.6% (mass fraction) neutral red aqueous solution and 5.0 g of soybean oil to beef extract peptone solid culture medium.

[0048] The strain obtained by this method was named NHYJZ3. The obtained strain was then subjected to the following morphological characterization:

[0049] (1) Colony characteristics

[0050] like Figure 1 As shown, the strain was cultured in solid medium for 3 days, and the growth diameter was about 10-30 mm, and the overall shape was round or oblate with irregular edges. The texture was white hyphae, of varying lengths, and the concentration decreased from the center to the periphery.

[0051] (2) Microscope observation results

[0052] like Figure 2 As shown in the figure, under the microscope, this strain appears as a long hyphae with spores of different sizes growing around it. The spores are oval in shape. The hyphae are long and of varying lengths, ranging from 10 to 200 μm, and the length of the spores is about 5 μm.

[0053] (3) Identification of strains

[0054] The genome was extracted using a DNA extraction kit (manufacturer: Beijing Boyushun Biotechnology Co., Ltd.). The extracted DNA was used as a PCR template, and PCR amplification was performed using primers (commissioned to be synthesized by BGI) and a PCR instrument (Tgradient produced by Biometra) to obtain PCR amplification products. The Taq DNA polymerase and other amplification reagents were purchased from TaKaRa.

[0055] The universal primers used include:

[0056] 27F: AGAGTTTGATCCTGGCTCAG (SEQ ID NO: 2);

[0057] 1492R: TACGGCTACCTTGTTACGACTT (SEQ ID NO: 3).

[0058] The PCR amplification system was as follows: treated sample (20 ng / μL), template 2 μL, dNTP mixture (2.5 mM) 2.5 μL, primers (20 μM) 1.5 μL each, 10×ExTaq buffer (Mg 2+ plus) 5 μL, ExTaq enzyme (5U / μL) 0.2 μL, and ddH2O to 50 μL.

[0059] The PCR amplification program was as follows: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 45 s, 30 cycles; and extension at 72°C for 5 min.

[0060] After the PCR amplification product was detected by 1.5% agarose, the target band was recovered and purified using a PCR purification kit (manufacturer: Promega), and then bidirectional sequencing was performed using amplification primers (manufacturer: ABI company sequencer 3730xl). After the sequencing results were spliced, they were input into GenBank and compared online using Blast. Finally, this strain was identified as Fusarium proliferatum, and the sequence of its 18s rDNA is shown in SEQ ID NO: 1.

[0061] Example 2

[0062] Example 2 The oil degradation ability of the strain prepared in Example 1 was identified.

[0063] (1) Oil degradation ability

[0064] In order to enhance the oil degradation ability of this strain, the strain was tested for performance using an enrichment medium (the formula of the base medium is the same as in Example 1 above, except that the amount of soybean oil added is 10 g / L) and cultured at 30°C and 120 r / min. It was finally found that the oil degradation efficiency of the strain on the 6th day could reach 93.72%. Figure 3 shown.

[0065] (2) Growth

[0066] The growth rate of the bacteria was evaluated by OD600. The strain was cultured in an enrichment medium (the formula of the basic medium was the same as in Example 1 above, and the amount of soybean oil added was 10 g / L) at 30°C and 120 r / min for 6 days, and the OD600 reached 9.17. Figure 4 shown.

[0067] (3) Acid production capacity

[0068] In order to explore the acid-producing ability of the bacteria, pH value was used to evaluate this indicator.

[0069] like Figure 5 As shown, this strain was cultured in an enriched medium (the basic medium formula of the medium was the same as that in Example 1 above, and the amount of soybean oil added was 10 g / L) at 30° C. and 120 r / min for the 6th day, and the pH value was 3.19.

[0070] Example 3

[0071] Example 3 verifies the oil degradation ability of the provided strain.

[0072] Prepare a fermentation tank with a volume of 85L and fill it with a mixture of food waste and corn straw (food waste: corn straw = 4:1 mass ratio). The filling rate is 60-80% when full, and then inoculate Fusarium proliferatum at an inoculation rate of 0.2% (W / W). The viable count of the bacteria before inoculation is 2×10 10 CFU / mL, 850mL was inoculated. Two experiments were set up. During the composting period, samples were taken on days 0, 3, 7, 13, 20, 27, 35, and 40. The ventilation rate was 5L / min, and the interval was 30min ventilation every 30min.

[0073] (1) Temperature

[0074] like Figure 6 As shown in the figure, the temperature of the fermentation process showed a trend of first rising and then falling. Compared with the blank control group CK, the high temperature period of the M group with Fusarium proliferatum added was extended to 7 days, 3 days longer than the CK group. Figure 6 Medium room temperature represents indoor temperature, M represents the experimental group with added microbial agents, and CK represents the control group without added microbial agents.

[0075] (2) Oil content

[0076] like Figure 7 As shown, after 40 days of aerobic fermentation, the oil degradation rate of the M group with the addition of Fusarium proliferatum was higher, at 95.67%, compared with 84.67% in the CK group, an increase of 11%.

[0077] In the description of this specification, reference to terms such as "one embodiment", "some embodiments", "specific implementation", or "some examples" means that the specific features, structures, materials or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the present invention.

[0078] Although the embodiments of the present invention have been shown and described above, it is to be understood that the above embodiments are exemplary and are not to be construed as limitations of the present invention. A person skilled in the art may change, modify, replace and vary the above embodiments within the scope of the present invention.

Claims

1. A Fusarium proliferatum, which was deposited in the General Microbiology Center of China National Microbiological Culture Collection Administration on November 20, 2023, with a deposit number of CGMCC No.40988.

2. The Fusarium proliferatum according to claim 1, characterized in that The sequence of 18s rDNA of Fusarium proliferatum is shown in SEQ ID NO:

1.

3. A microbial agent, characterized in that: The microbial agent is prepared according to the Fusarium proliferatum according to claim 1 or 2.

4. The microbial agent according to claim 3, characterized in that: The microbial agent is a dry powder or a bacterial liquid, and the effective viable bacteria count of Fusarium proliferatum in the dry powder or the bacterial liquid is at least 2×10 10 CFU / mL.

5. The microbial agent according to claim 3, characterized in that: The microbial agent is obtained by fermenting the Fusarium proliferatum in an enriched medium containing 0.16wt% to 1.6wt% of animal and plant fats and oils; Optionally, the formula of the enrichment medium includes MgSO4·7H2O 0.1-0.5g, (NH4)2SO4 1-2g, KH2PO4 0.3-1g, K2HPO4 1-2g, NaCl 3-8g, soybean oil 1.6-16g, deionized water 1000mL, pH 7.0-7.

2.

6. The microbial agent according to claim 5, characterized in that: The fermentation culture conditions are as follows: after the Fusarium proliferatum is inoculated into the enrichment culture medium, the culture is fermented at 28-32° C. and 100-150 r / min for 2-7 days.

7. A method for degrading grease in a sample or a place, characterized in that: include: The Fusarium proliferatum according to claim 1 or 2 or the microbial agent according to any one of claims 3 to 6 is mixed and cultured with the sample, or placed in a place containing oil, so as to degrade the oil in the sample or the place.

8. The method according to claim 7, characterized in that The inoculation amount of the Fusarium proliferatum is 0.2-5% (w / w) of the sample.

9. The method according to claim 7, characterized in that: The sample is selected from at least one of kitchen waste and grease-containing waste, and the location is selected from at least one of a grease-containing sewage pipeline and a grease-containing pollutant collection location.

10. Use of the Fusarium proliferatum according to claim 1 or 2 or the microbial agent according to any one of claims 3 to 6 in the field of oil degradation.

Images