Application of Penicillium Polish in fermentation for improving flavor of dark tea product

Abstract

The invention belongs to the field of application of a microbial fermentation technology, and particularly relates to application of Penicillium Polish in fermentation for improving the flavor of a dark tea product. The invention discloses a Penicillium pomelo XL6-1, and the preservation number of the Penicillium pomelo XL6-1 is CCTCC (China Center for Type Culture Collection) NO: 2023483. The solid-state fermentation of Penicillium Polish is utilized to significantly change the volatile flavor components of the dark tea, significantly reduce the acerbity components of the dark tea, and enhance the volatile flavor components with sweet pepper fragrance and pea fragrance. Meanwhile, the black tea subjected to solid-state fermentation of the Penicillium baumannii has relatively high activities of peroxidase, polyphenol oxidase and the like, and plays an important role in forming and regulating the quality of the black tea. In conclusion, the strain shows the potential as a dark green tea flavor adjusting leavening agent, and is beneficial to flavor improvement when being applied to fermented dark green tea.

Description

Technical Field

[0001] The invention relates to the application field of microbial fermentation technology, and in particular to the application of a strain of Penicillium polishum in fermentation to improve the flavor of dark tea products. Background Art

[0002] Dark tea is a traditional microbial post-fermented tea in my country. It is deeply loved by the general public for its unique craftsmanship, mellow taste and distinctive flavor. It has good market prospects. Therefore, improving the quality of dark tea is of great significance to the industrial development of dark tea and the exploration of tea functional components.

[0003] Penicillium has been proven to be a key microorganism in the fermentation stage of Fuzhuan tea. It is the dominant fungus in the process of dark tea piling, fermentation and storage, and has a significant effect on the quality of dark tea. Penicillium can produce a variety of enzymes during the fermentation of dark tea. These enzymes can catalyze chemical reactions in tea leaves, transform and degrade tea polyphenols, caffeine, amino acids and other ingredients, thereby changing the taste and aroma of tea leaves and making the taste of dark tea more mellow. Therefore, the selection of Penicillium to carry out directional regulation of the quality formation of fermented foods such as dark tea plays an important role in improving and stabilizing the quality of fermented foods such as dark tea.

[0004] Penicillium is reported to be widely used as a fermentation driver in the food industry. For example, the addition of P. roqueforti extracted from cheese enhanced the production of acids, methyl ketones, and secondary alcohols from protein hydrolysis and fatty acid decomposition, thus giving the characteristic flavor of blue cheese. Similarly, P. lanosum was used for the enhanced fermentation of Mianning ham, and the results showed that the odor activity values ​​of hexanol (rosin aroma) and linalool (floral aroma) were significantly higher, thereby improving the flavor of the ham. Therefore, the study showed that Penicillium showed considerable potential in enhancing product characteristics and improving the quality of fermented foods.

[0005] CN118580966A (A strain of aromatic Penicillium Polishum and its application) discloses the use of Penicillium Polishum (CK2023-1) with good salt tolerance and biosafety, and excellent lipase and protease production capacity in the preparation of fermented bacon, which can effectively increase the aromatic substances in fermented bacon. CN18028117A (Penicillium Polishum and its application) discloses the use of a strain of Penicillium Polishum (FP10) derived from Yongchuan Douchi to effectively control the content of nitrite in fermented meat products, while maintaining the texture, sensory properties and flavor of fermented meat products. CN118805866 (Application of Penicillium Polishum in degrading biogenic amines and preparing fish sauce) discloses that the use of Penicillium Polishum can promote the degradation and conversion of various biogenic amines, and its microbial agent can be used for the fermentation of fish sauce to effectively control the content of biogenic amines in fish sauce. The application of Penicillium Polishum in fermenting black tea has not been used in the prior art. Summary of the invention

[0006] The purpose of the present invention is to provide a strain of Penicillium polonicum XL6-1 derived from Fuzhuan tea and its application in solid-state fermented dark tea. A strain of Penicillium polonicum separated and screened from traditional Fuzhuan tea is applied to dark tea to improve the sour and astringent taste in dark tea and enhance the flavor quality of dark tea.

[0007] To achieve the above object, the present invention adopts the following technical solutions:

[0008] A strain of Penicillium polonicum XL6-1 was isolated from traditional Fuzhuan tea and is suitable for use as a fermentation agent for fermenting dark tea. It is classified and named Penicillium polonicum XL6-1, and its preservation number is CCTCC NO: 2023483. It was deposited in the China Center for Type Culture Collection (CCTCC) on April 6, 2023, and the preservation address is: Wuhan University, Wuhan, China.

[0009] Application of a strain of Penicillium polonicum XL6-1 or a microbial preparation containing Penicillium polonicum XL6-1 in fermented products.

[0010] Preferably, the fermented product includes but is not limited to black tea.

[0011] At the same time, the present invention also provides a method for preparing dark tea by solid-state fermentation of Penicillium polonicum XL6-1, which comprises the following steps:

[0012] (1) Preparing a microbial preparation of Penicillium polonicum XL6-1;

[0013] (2) The microbial preparation prepared in step (1) is mixed with dark tea and subjected to solid-state fermentation.

[0014] Preferably, the concentration of Penicillium polonicum XL6-1 in the microbial preparation is 10 7 CFU / mL.

[0015] Preferably, the specific steps of preparing the Penicillium polonicum XL6-1 fermentation agent in step (1) are as follows: aseptically inoculating Penicillium polonicum XL6-1 into a modified Czapek medium for subculture; aseptically transferring the activated strain to a modified Czapek medium, culturing at 28°C for 5 to 7 days until a large number of spores grow in the medium; aseptically, using an inoculation loop to hook an appropriate amount of spores and inoculate them into the modified Czapek medium, and subculture at 28°C for 7 days until a large number of spores grow. Use a sterile spatula to gently scrape the hyphae and spores on the surface of the culture medium, then wash the hyphae and spores with sterile water, filter through sterile absorbent cotton into a conical flask containing an appropriate amount of glass beads, and shake appropriately to evenly disperse the spores in the sterile water to obtain 10 7 CFU / mL of spore suspension for later use.

[0016] Preferably, the specific steps of step (2) are: wetting the tea leaves with water and then sterilizing them with high pressure steam, cooling them to room temperature, and then inoculating them with Penicillium polonicum XL6-1 or a microbial preparation containing the same, and fermenting them at 28° C. for 2-22 days.

[0017] Beneficial effects of the present invention:

[0018] (1) The strain of the present invention is derived from traditional Fuzhuan tea, has the characteristics of natural greenness, and is more easily recognized by modern consumers. In addition, the solid-state fermentation process conditions are easy to control, the operation is simple, the preparation process is energy-saving and environmentally friendly, no wastewater, waste gas, and waste are generated, and large-scale production is easy to achieve.

[0019] (2) The fermented black tea prepared by the present invention can transform the overall flavor of the black tea into a unique aroma of pea and sweet pepper. After being metabolically transformed by Penicillium polonicum XL6-1, the flavor characteristics of the black tea can be significantly improved, the bitter taste is reduced, the color of the tea soup is brown-red, and the black tea is endowed with a unique color, aroma and taste.

[0020] (3) The application of the strain provided by the present invention in the production of fermented foods such as dark tea has far-reaching significance for reducing production costs and improving the quality and quality of fermented dark tea products. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 The identification information of strain XL6-1 includes colony morphology on modified Czapek solid medium (28°C, 7 days) (1A); microscopic characteristics (1B); conidiophores (1C); conidia (1D) and phylogenetic tree constructed by maximum likelihood method based on ITS, BenA and CaM genes (1E).

[0022] Figure 2 The changes in the activities of peroxidase (2A), polyphenol oxidase (2B), tannase (2C) and β-glucosidase (2D) secreted by Penicillium polishi during solid-state fermentation of dark tea.

[0023] Figure 3 The information of volatile compounds of Penicillium polonicum XL6-1 fermented dark tea (PDT) prepared by the present invention at different fermentation times based on gas chromatography-mass spectrometry (GC-MS) analysis. The number of different types of volatile compounds (3A), Venn diagram of all volatile compounds (3B). The percentage relative content of different types of volatile compounds (3C) and the content change trend (3D). Partial least squares discriminant analysis (PLS-DA) (3E) and heat map (standardized by log2 (relative abundance) value) and hierarchical cluster analysis (HCA) (3F) of volatile compounds based on GC-MS analysis.

[0024] Figure 4 The volatile compound fingerprints of dark tea samples fermented by Penicillium polonicum XL6-1 at different fermentation stages detected by HS-GC-IMS (4A), the number of different types of volatile compounds (4B), the percentage relative content of different types of volatile compounds (4C), the content change trend (4D) and the differential volatile compounds at different fermentation stages (4E).

[0025] Figure 5 The present invention provides tea soup color photos (5A) and tea soup color difference change analysis (5B) of dark tea fermented by Penicillium polonicum XL6-1 at different fermentation stages, as well as the changes in the contents of theaflavins (5C), thearubigins (5D) and theabrownins (5E).

[0026] Figure 6 The principal component analysis (6A) and radar chart (6B) of the electronic tongue data of dark tea samples fermented by Penicillium polonicum XL6-1 at different fermentation stages prepared by the present invention. DETAILED DESCRIPTION

[0027] The present invention is further described below in conjunction with the examples. It should be understood that the specific examples described herein are only used to explain the present invention and are not intended to limit the present invention. The experimental methods without specifying specific conditions are usually in accordance with the known means in the art. The test materials used in the following examples, unless otherwise specified, are purchased from conventional biochemical reagent stores.

[0028] Example 1: Identification and preservation of Penicillium polishum

[0029] 1. Modified Czapek solid medium: 2.0 g / L sodium nitrate, 0.7 g / L potassium dihydrogen phosphate, 0.3 g / L potassium hydrogen phosphate, 0.5 g / L potassium chloride, 0.5 g / L magnesium sulfate, 0.01 g / L ferrous sulfate, 30 g sucrose, 0.5 g / L Tween, 15 g / L technical agar powder; pH value is adjusted to 6.0-6.5 at 25°C. Heat and stir distilled water to dissolve, and sterilize in a high-pressure steam sterilizer at 121°C for 20 min for later use.

[0030] 1. Morphological identification of strain XL6-1

[0031] The strain XL6-1 was inoculated on a modified Czapek medium plate and cultured at 28°C for 7 days before observing the growth, morphology and color of the hyphae. The hyphae were picked in the center of a clean glass slide and stained with lactic acid cotton blue dye. After covering with a cover glass, the hyphae were observed under an optical microscope for septa and spore production. The strain XL6-1 was classified in combination with Fungal Taxonomy and Fungal Identification Manual.

[0032] The isolated XL6-1 strain was inoculated into a modified Czapek solid medium and cultured at 28°C for seven days. The colony was 30-40 mm in diameter and approximately circular. The colony showed a velvety or flocculent texture with a dense center. The hyphae were distributed radially from dark smoke green to bean green, and the appearance was dry and rough, without exudate, the reverse side was white, and no pigment was diffused into the culture medium ( Figure 1 A). Observed under an optical microscope, the hyphae of XL 6-1 are mainly composed of hyphae with transverse septa, without foot cells at the base and without swell bodies at the top. Multicellular conidiophores are produced at the top of the hyphae ( Figure 1 B), the tip of the stalk branches 2-3 times. The terminal cell of each branch divides into a string of conidia ( Figure 1 C), forming a broom shape. Conidia are spherical and ellipsoidal ( Figure 1 D).

[0033] 2. Molecular biological identification of strain XL6-1

[0034] The sequence of strain XL6-1 obtained based on ITS rRNA determination is shown in SEQ ID NO.1, specifically:

[0035] CTTCCCGTAGGGGGGACCTGCGGAAGGATCATTACCGAGTGAGGGCCCTTTGGGTCCAACCTCCCACCCGTGTTTTATTTTACCTTGTTGCTTCGGCGGGCCCGCCTTTACTGGCCGCCGGGGGGCTCACGCCCCCGGGCCCGCGCCC GCCGAAGACACCCCCGAACTCTGTCTGAAGATTGAAGTCTGAGTGAAAATAAATTATTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAAATTCAGT GAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCCAAGCCCGGCTTGTGTTGGGCCCCGTCCTCCGATTCCGGGGGACGGGCCCGAAAGGCAGCGGCGGC ACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGATCAACCCAAATTTTTATCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGG

[0036] The sequences were compared in the NCBI GenBank database, multiple sequence alignment was performed using ClusterX software, and the biological software MEGA-X was used to construct a phylogenetic tree.

[0037] The results showed that the ITS rRNA gene sequences of XL6-1 and Penicillium polishum were naturally clustered, with a similarity of 99%. 14 phylogenetic trees with high similarity were constructed. Figure 1 E, XL6-1 and Penicillium polonicum clustered into one group, indicating that LK-1 and Penicillium polonicum were most closely related. Therefore, XL6-1 was identified as Penicillium polonicum.

[0038] Based on the above morphological observations and ITS rRNA sequence analysis results, it can be determined that this strain is Penicillium polonicum, which is named Penicillium polonicum XL6-1.

[0039] 3. Preservation of Penicillium polonicum XL6-1

[0040] Penicillium polonicum XL6-1 was deposited in the China Center for Type Culture Collection on April 6, 2023, with the deposit number CCTCC NO: 2023483, and the deposit location: Wuhan University, Wuhan, China.

[0041] Example 2: Preparation of dark tea fermented by Penicillium polonicum XL6-1

[0042] In order to verify the performance of Penicillium polonicum XL6-1 in dark tea fermentation, the strain was used to produce dark tea by solid-state fermentation. The dark tea production process of the present invention is divided into two parts: the production of microbial preparations and the production of dark tea by solid-state fermentation. The raw tea raw materials for producing dark tea of ​​the present invention are provided by Jiuyang Tea Industry Co., Ltd. (Hunan, China).

[0043] 1. Preparation of Penicillium polonicum XL6-1 microbial preparation

[0044] Penicillium polonicum XL6-1 was inoculated into a modified Czapek medium under sterile conditions for subculture; the activated strain was transferred to a modified Czapek medium under sterile conditions, and cultured at 28°C for 5 to 7 days until a large number of spores grew in the medium; under sterile conditions, an appropriate amount of spores were hooked with an inoculation loop and inoculated into the modified Czapek medium, and subcultured at 28°C for 7 days until more spores grew. Use a sterile spatula to gently scrape the hyphae and spores on the surface of the culture medium, then wash the hyphae and spores with sterile water, filter through sterile absorbent cotton into a conical flask containing an appropriate amount of glass beads, shake appropriately to disperse the spores evenly in the sterile water, count the spores in the spore suspension on a hemocytometer, and adjust the concentration of the spore suspension with sterile water to obtain 10 7 CFU / mL of spore suspension for later use.

[0045] 2. Penicillium polonicum XL6-1 solid-state fermented dark tea products

[0046] The dark tea solid-state fermented by Penicillium polonicum XL6-1 was prepared according to the following steps. Briefly, 20 g of dark tea leaves were placed in a glass bottle, 9 mL of pure water was sprayed evenly, the glass bottle was sealed, and sterilized at 121°C for 20 minutes. After cooling to room temperature, 4 mL of Penicillium polonicum XL6-1 microbial preparation was inoculated in each bottle of tea leaves. The glass bottle was kept in a microbial incubator at 28°C for a period of time for fermentation. Samples were taken on the second day of fermentation (PDT2), the fourth day of fermentation (PDT4), the eighth day of fermentation (PDT8), the tenth day of fermentation (PDT10), the fifteenth day of fermentation (PDT15), and the twenty-second day of fermentation (PDT22), and the dark tea extracted on day 0 (PDT0) was used as a control. The finished product obtained after fermentation was vacuum freeze-dried, sealed and stored at -20°C for use in the next step of detection and analysis.

[0047] Example 3: Detection and characterization of dark tea fermented by Penicillium polonicum XL6-1

[0048] 1. Hydrolytic enzyme activity secreted by Penicillium polonicum XL6-1 during solid-state fermentation of dark tea

[0049] (1) Detection method

[0050] Accurately weigh samples of different fermentation times and put them into a conical flask, then add ultrapure water at a solid-liquid ratio of 1:20 (w / v) (2g + 40mL water) and mix thoroughly. Place the conical flask in a water bath shaker and extract at 30°C, 160rpm for 1h. Centrifuge at 4°C, 8000rpm for 10min, collect the supernatant, and make up to 50mL with ultrapure water to complete the preparation of crude enzyme solution. Determine the activities of α-amylase, β-glucosidase, polyphenol oxidase, tannase, peroxidase and cellulase.

[0051] 1) β-glucosidase activity assay

[0052] Add 0.15mL (5mM) p-nitrobenzene-β-D-glucoside and 1.2mL (100mM, pH 5.0) acetate buffer to the test tube, add 0.15mL enzyme solution to react at 50℃ for 30min, add 3mL (1M) Na2CO3 solution to terminate the reaction, and measure the released p-nitrophenol at 405nm. The crude enzyme solution inactivated in a 100℃ water bath for 10min was used as a blank control. β-glucosidase activity is defined as: under the reaction conditions, the amount of enzyme required for β-glucosidase to catalyze the substrate to produce 1μmol p-nitrophenol per minute is one enzyme activity unit. The experimental results are expressed as the number of enzyme activities per gram of fermentation sample (dry weight) (U / g).

[0053] 2) Tannase activity assay

[0054] Mix 100μL of crude enzyme solution and 100μL of propyl gallate solution, and react at 30℃ for 5min. Then add 120μL of methanol rhodanine solution and mix, and react for 5min. Add 80μL of 0.5mol / L KOH and react for 5min. Dilute the reaction solution with 1.6mL of ultrapure water, react at 30℃ for 10min, and measure the absorbance at 520nm. The amount of enzyme required to produce 1μmol gallic acid per minute is defined as one enzyme activity unit (U / g).

[0055] 3) Determination of polyphenol oxidase activity

[0056] Add 6mL (pH=6.0) 0.2M disodium hydrogen phosphate-0.1M citric acid buffer and 1mL 0.5% catechol solution to the test tube, preheat in a 30℃ constant temperature water bath, add 1mL enzyme solution, react for 5min, heat in a boiling water bath to inactivate the enzyme to terminate the reaction, centrifuge at 5000rpm for 10min, take the supernatant and measure the absorbance at 410nm. Use the enzyme solution after boiling water bath as the control. 410 A change of 0.01 is one unit (U) of polyphenol oxidase activity.

[0057] Polyphenol oxidase activity = (A 410 ×V T ) / (W×V s ×0.01×t)[U / (g×min)]

[0058] Where: A 410 : change in absorbance during reaction time, W: sample fresh weight g, t: reaction time min, V T : Total volume of enzyme solution extracted, mL; Vs: Volume of enzyme solution used in determination, mL.

[0059] 4) Peroxidase

[0060] Add 50mL (100mmol / L, pH=6.0) phosphate buffer to a beaker, add 28μL guaiacol, heat and stir on a magnetic stirrer until guaiacol is dissolved, add 19μL 30% hydrogen peroxide after the solution cools, mix well, and store in a refrigerator. Add 3mL of the above reaction mixture, 1mL of sample enzyme solution, and inactivated enzyme solution as a control to a test tube, immediately start recording time, use a microplate reader to measure the absorbance value, read once every 1 minute, measure at a wavelength of 470nm, and change 0.01 absorbance per minute as a unit enzyme activity (U / g).

[0061] (2) Results Analysis

[0062] In this invention, the hydrolytic enzymes secreted by Penicillium polonicum XL6-1 during the solid-state fermentation process were evaluated. Figure 2 AD). During the fermentation process, microorganisms not only participate in the metabolism of dark tea contents, but also produce flavors by secreting extracellular enzymes on various substrates. Polyphenol oxidase (PPO) and peroxidase (POD) show significantly higher activity than other hydrolases. PPO is essential for converting flavonol glycosides in tea leaves, while POD enhances the oxidation of flavonol glycosides induced by PPO. Polyphenol oxidase produced by cells is essential for giving dark tea its unique sensory characteristics and health benefits. Tannase produced by Penicillium polonicum XL6-1 initially increased significantly during fermentation (PDT0-PDT4), then decreased in subsequent fermentations (PDT4-PDT8), and remained stable during subsequent fermentations. Tannase plays a key role in hydrolyzing ester catechins to produce non-ester catechins and gallic acid. In addition, the color of tea soup is changed under its action. The activity of β-glucosidase also maintained a stable and slightly increasing trend during the fermentation of Penicillium polonicum XL6-1. Therefore, the hydrolase produced by Penicillium polonicum XL6-1 is crucial for the transformation of substances during the fermentation of dark tea.

[0063] 2. Analysis of Volatile Organic Compounds by Gas Chromatography-Mass Spectrometry (GC-MS)

[0064] (1) Detection method

[0065] 10 μL of ethyl decanoate (10 ppm) was added as an internal standard compound in the headspace extraction bottle, followed by 0.5 g of black tea powder, 5 mL of boiled ultrapure water and 0.5 g of sodium chloride. Then, a 50 / 30 μm DVB / CAR / PDMS extraction head was inserted into the extraction bottle placed on a magnetic stirrer at 80°C, and the extraction head was kept 1 cm away from the sample. After 10 min of equilibration, the fiber head was pushed out and extracted for 50 min. Then, the fiber head was placed in the GC-MS injector and desorbed in a non-splitting mode at 250°C for 5 min. The GC conditions were as follows: the initial temperature was maintained at 40°C for 3 min, then increased to 90°C at a rate of 2°C / min, then increased to 150°C at a rate of 3°C / min, then increased to 180°C at a rate of 5°C / min, and finally increased to 230°C at a rate of 15°C / min and maintained for 5 min. The mobile phase was high-purity helium (>99.99%) with a flow rate of 1.0 mL / min. The MS conditions were as follows: the mass spectrometer was operated in positron ionization mode at 70 eV, the ion source temperature was 230 °C, the scan range was m / z 35-400, the transfer line temperature was 250 °C, the detector voltage was 1.2 kV, the quadrupole temperature was 150 °C, and the mass spectra were collected in full scan mode. The retention index (RI) of volatile organic compounds was calculated based on n-alkanes (C7-C40). The concentration of volatiles in dark tea was calculated using the internal standard method. The mass spectra of all detected metabolites were compared with the NIST 2017 database, and the compounds were identified based on retention time, retention index, literature data, etc.

[0066] Relative Odor Activity Value (rOAV) Analysis: Compounds with rOAV>1 are generally considered to be aroma-active compounds that contribute significantly to the overall aroma characteristics of the sample. rOAV is calculated by using the ratio of the concentration (Ci) of each VOC to the odor threshold (OTi) of the VOC in water. OT was obtained from an earlier report using the formula: OAV = Ci / OTi.

[0067] (2) Results Analysis

[0068] A total of 100 volatile compounds were detected in dark tea samples fermented by Penicillium polonicum XL6-1 by solid phase microextraction combined with gas chromatography-mass spectrometry. Specifically, 54, 54, 55, 51, 52, 50 and 48 volatile compounds were found in dark tea samples without fermentation (PDT0), fermented for 2 days (PDT2), fermented for 4 days (PDT4), fermented for 10 days (PDT10), fermented for 15 days (PDT15) and fermented for 22 days (PDT22), respectively. Figure 3 A). All these identified volatile compounds were classified into nine categories, including alcohols, ketones, aldehydes, esters, methoxybenzenes, hydrocarbons, heterocyclics, lactones, and phenols ( Figure 3 B). Among them, alcohols, ketones and hydrocarbons had the largest number of species, accounting for 20%, 23% and 22% of all identified volatile compounds, respectively. During the fermentation process, the contents of various volatile compounds changed greatly. It was found that a considerable number of volatile organic compounds disappeared or were newly formed during the solid-state fermentation of Penicillium polonicum XL6-1, which may be attributed to the Maillard reaction, glycoside hydrolysis or carotenoid or lipid degradation during the fermentation process. The proportion and content of volatile organic compounds were different at different fermentation periods. Alcohols, ketones, aldehydes and hydrocarbons are the main volatile substances ( Figure 3 C). In addition, the total content of volatile compounds increased significantly from non-fermentation (PDT0) to fermentation day 4 (PDT4), and then fluctuated downward from fermentation day 4 (PDT4) to fermentation day 15 (PDT15). The total content of volatile compounds reached a maximum on fermentation day 22 (PDT22). Figure 3 D). It is noteworthy that the percentage and content of methoxybenzenes and heterocyclic substances both showed an increasing trend during the fermentation of dark tea by Penicillium polonicum XL6-1.

[0069] During the fermentation process of Penicillium polonicum XL6-1, alcohols accounted for the highest proportion of VOCs, and their content was relatively stable, ranging from 34.64% to 48.18%. Alcohols, as an important aroma in tea, have a distinct fragrance. They have unique odors such as woody, sweet and floral, which greatly contribute to the flavor of tea. Alcohols in dark tea fermented by Penicillium polonicum XL6-1 are mainly composed of linalool, (E)-linalool oxide (furan) and (Z)-linalool oxide (furan), all of which have floral aromas. These three glycoside-derived alcohols showed a fluctuating increase trend during the fermentation process. After 22 days of fermentation, linalool and (Z)-linalool oxide (furan) increased by 1.81 times and 24.87 times, respectively. (E)-linalool oxide (furan) was not detected in dark tea (PDT0). However, after 22 days of fermentation, it accounted for 17.74% of the flavor compounds. It was found that the β-glucosidase secreted by Penicillium polonicum XL6-1 showed consistently high activity during the fermentation period ( Figure 2A). Moderate concentrations of higher alcohols, such as 2-ethyl-1-hexanol (heavy, earthy, slightly floral), provided desirable complexity to the aroma. Our results suggest that this substance is newly produced by Penicillium polonicum XL6-1, as it was not detected in the early stages of fermentation and showed a fluctuating downward trend from PDT4 to PDT22. α-Terpineol, which has a woody and aged aroma, reached its maximum level on day 4 of the solid-state fermentation process of Penicillium polonicum XL6-1.

[0070] In black tea (PDT0), ketones ranked second (20.75%) and aldehydes ranked third (15.24%). After 22 days of fermentation, both showed a significant downward trend, with the relative content of ketones decreasing by 82.57% and the relative content of aldehydes decreasing by 76.27%. In the first 4 days of fermentation, the contents of α-ionone and (E)-β-ionone were both high. However, after the fourth day of fermentation, the content of (E)-β-ionone dropped significantly. On the fourth day of fermentation, the concentration of α-ionone was 1.77 times higher than that of unfermented (PDT0). After 22 days of fermentation, the content of α-ionone decreased by 40.98%. Dihydro-α-ionone can be formed from α-ionone and cannot be detected from PDT0 to PDT4, but begins to accumulate in the later stages of fermentation. A previous study showed that alcohols and ketones are highly positively correlated with Penicillium. Among the aldehydes detected, hexanal (0.76%-18.04%) and benzaldehyde (0.46%-5.95%) were found in relatively high levels. Hexanal, responsible for providing the characteristic green smell to Fuzhuan tea, reached a peak on the fourth day of fermentation (PDT4), reaching 82.30 times that of unfermented black tea (PDT0), and then showed a downward trend as fermentation progressed. Benzaldehyde, which has an almond-like aroma, was found in the highest content in unfermented black tea (5.95%), and decreased by about 60% after 22 days of fermentation.

[0071] Most of the methoxybenzene volatiles in tea are concentrated in black tea. During the solid-state fermentation of black tea by Penicillium polonicum XL6-1, five new methoxybenzene compounds that were not detected in black tea (PDT0) were produced. These compounds include 2-methylanisole, 4-ethylanisole, 1,4-dimethoxybenzene, 1,3-dimethoxy-2-methyl-benzene and 5-methoxy-6,7-dimethyl-benzofuran. 1,4-Dimethoxybenzene (0.30%-18.51%) showed a fluctuating increase trend during the fermentation process, which can provide green and sweet aromas. In this invention, the content of methoxybenzene increased significantly. Methoxybenzene is the main volatile that causes the unique aged aroma of black tea. In addition, floral, fruity, woody and sweet aromas were also detected in methoxybenzene, further supplementing the aged aroma. The tannins produced by the microorganisms can catalyze the hydrolysis of esterified catechins into gallic acid, which is a key precursor for the synthesis of methoxybenzenes. In the present invention, we further identified that Penicillium polonicum XL6-1 can secrete tannins ( Figure 2 B), thereby biosynthesizing methoxybenzene compounds in dark tea.

[0072] Table 1 lists the odor description, odor threshold and relative odor activity values ​​of aroma active compounds in the solid-state fermentation of dark tea by Penicillium polonicum XL6-1. During the fermentation process, 19 volatile organic compounds had rOAV values ​​greater than 1, which were the key aroma substances in the solid-state fermentation of dark tea by Penicillium polonicum XL6-1. In the early stage of fermentation (PDT0-PDT4), (E)-β-ionone, (E)-β-damascene ketone and linalool, which have floral and fruity aromas, had high relative odor activity values ​​and were the main key aroma substances in the early stage of fermentation. Their contents first showed a decreasing trend in the early stage of fermentation and then increased. Nevertheless, in the middle stage of fermentation, their rOAVs decreased by 89.70%, 55.76% and 35.48%, respectively, indicating that the influence of floral, fruity and sweet aromas on the overall flavor characteristics of PDT was weakened. On the contrary, as the fermentation progressed, the key aroma substances underwent substantial changes. During the mid to late fermentation phase, the rOAV of methoxypyrazines (including 2-isopropyl-3-methoxypyrazine, 2-methoxy-3-sec-butylpyrazine, and 2-methoxy-3-isobutylpyrazine) increased significantly, shifting the flavor profile toward more earthy, bell pepper, and green pea notes, replacing earlier floral or fruity characteristics. Their increased concentration during fermentation greatly affected the sensory attributes of Penicillium polonicum XL6-1 solid-state black tea, contributing more to the overall flavor as fermentation progressed. To our knowledge, methoxypyrazines are rarely detected in black teas but are commonly found in grapes and wines, as well as in some green tea varieties. The characteristic aroma compounds of Longjing tea include 2-methoxy-3-isobutylpyrazine, which imparts a mung bean-like aroma and enhances the perception of "maltiness," "toastiness," and "freshness" during tea steeping. 2-Methoxy-3-isobutylpyrazine, which has an extremely low sensory detection threshold (0.0062 μg / L), was identified in black tea for the first time, a compound previously reported only in green tea.

[0073]

[0074] The obvious separation of different fermentation times can be clearly observed by the partial least squares discriminant analysis (PLS-DA) model, indicating that the fermentation time plays a significant role in the flavor changes of Penicillium polonicum XL6-1 black tea ( Figure 3 E). In order to intuitively reveal the differences in volatile compounds in black tea at seven different time points, a heat map ( Figure 3F). The results showed that there were significant differences in the volatile compounds of dark tea at 7 different time points. The hierarchical clustering of the heat map of volatile compounds at different fermentation times was established using the average linkage clustering method. The hierarchical clustering heat map of the concentrations of all volatile compounds showed that the entire fermentation process could be divided into four stages: dark tea (0d, PDT0), early fermentation (0d-4d, PDT0-PDT4), mid-fermentation (4d-10d, PDT4-PDT10) and late fermentation (10d-22d, PDT10-PDT22). Therefore, four representative time points (PDT0, PDT4, PDT10 and PDT22) were selected for further comprehensive analysis of volatile compounds using gas chromatography-ion mobility spectrometry (GC-IMS).

[0075] 3. Analysis of volatile organic compounds by headspace gas chromatography-ion mobility spectrometry (HS-GC-IMS)

[0076] (1) Detection method

[0077] A GC-IMS instrument equipped with a MXT-WAX capillary column (30 m × 0.53 mm × 1.0 μm) was used. GAS, Germany) analyzed the volatile flavor substances of the samples. Briefly, 1 g of black tea powder was weighed and placed in a 20 mL headspace bottle, 20 μL of internal standard (100 ppm, 2-octanol) was added, and incubated at 80 °C, 500 r / min for 15 min. After the incubation, the syringe heated to 85 °C was automatically injected into the headspace in splitless mode (500 μL). The column temperature was set to 60 °C. The carrier gas was nitrogen (purity ≥ 99.99%), and the procedure was as follows: the initial flow rate was 2.0 mL / min for 2 min, linearly increased to 10.0 mL / min within 8 min, and linearly increased to 100.0 mL / min within 10 min, and maintained for 30 min. The chromatographic run time was 50 min, and the injection port temperature was 80 °C. The IMS conditions were as follows: in the IMS ionization chamber, ionization was performed using a 3H ionization source in positive ion mode. The obtained ions are then driven into the drift tube at a stable voltage (5 kV) and a stable temperature (45 ° C). Nitrogen (purity ≥ 99.99%) is used as the IMS drift gas at a flow rate of 75.0 mL / min. Using orthoketone C4-C9 as an external standard, a calibration curve of retention time and retention index is established. The retention index of the substance is then calculated by the retention time of the target. The GC retention index (NIST 2020) database and the IMS migration time database built into the VOCal software are retrieved and compared for qualitative analysis of the target.

[0078] (2) Results Analysis

[0079] Compared with the GC-MS method, GC-IMS showed different sensitivity in characterizing volatile organic compounds. A total of 167 signal peaks were found by GC-IMS. Due to the limitation of its database, 95 volatile organic compounds were identified, and the remaining 72 peaks could not be identified. From the fingerprints of the detected volatile substances, the flavor of black tea changed significantly during the fermentation process, especially between the samples on the 4th day of fermentation (PDT4) and the 10th day of fermentation (PDT10). Figure 4 A). The volatile compounds identified included 22 alcohols, 21 aldehydes, 18 ketones, 14 esters, 11 heterocyclics, 4 acids, and 2 hydrocarbons ( Figure 4 B). It is worth noting that some volatile compounds may produce multiple signals, which may be due to substances with a strong affinity for protonation or due to different concentrations, allowing ions to form dimers or even oligomers when passing through the drift tube. In this investigation, 25 volatile compounds were found to coexist in the form of dimers and monomers. Fermentation with Penicillium polonicum XL6-1 has a great influence on the aroma of dark tea, resulting in the large formation of volatile organic compounds such as alcohols, aldehydes and heterocyclics. Alcohols (19.93%-25.38%), esters (5.49%-10.73%), heterocyclics (3.70%-6.77%) and hydrocarbons (0.14%-0.32%) continued to increase throughout the early and middle fermentation, but their levels decreased in the late fermentation. At the same time, aldehydes (7.03%-11.03%) increased significantly in the early fermentation and decreased significantly in the middle and late fermentation. No significant trends were observed for ketones (14.28%-17.24%) and ethers (5.49%-10.73%). Figure 4 C). However, in general, the contents of these substances increased after 22 days of fermentation compared with dark tea (PDT0). Alcohols and ketone compounds are the main volatile compounds in dark tea fermented by Penicillium polonicum XL6-1, which is different from the previous study that Fuzhuan tea has ketones and aldehydes as the main volatile substances. And compared with dark tea fermented by Eurotium cristatum, more sulfide and heterocyclic compounds were detected in dark tea fermented by Penicillium polonicum XL6-1 by GC-IMS. After 22 days of solid-state fermentation, the content of acid substances decreased significantly ( Figure 4 D), including some acids with pungent odors, such as butyric acid, propionic acid, acetic acid and 2-methylpropionic acid. Under the action of microorganisms, carboxylic acid derivatives and alcohols can be esterified to form ester compounds, most of which have a fruity aroma.

[0080] Table 2 lists the rOAV results obtained by analyzing volatile compounds using GC-IMS. The table shows that 56 volatile compounds have rOAV>1. It is worth noting that 2-isobutyl-3-methoxypyrazine plays a dominant role in shaping the overall flavor characteristics of dark tea fermented by Penicillium polonicum XL6-1. Its rOAV remains the highest in each fermentation stage. In the early stage, (Z)-4-heptenal significantly affects the flavor of dark tea fermented by Penicillium polonicum XL6-1, and its rOAV is second only to 2-isobutyl-3-methoxypyrazine. By the middle of fermentation, its rOAV decreased by nearly 79%. After that, its effect on the aroma characteristics of dark tea fermented by Penicillium polonicum XL6-1 gradually weakened. (Z)-4-heptenal is a key aroma-active compound in Lu'an Guapian tea, which is characterized by cooked soybean and fishy smells. The rOAV of dimethyl sulfide (like the smell of cooked corn) increased by 2.36 times in the middle stage of fermentation, while dimethyl trisulfide (onion and cabbage-like aroma) increased by 7.40 times in the early stage of fermentation. In addition, ethyl isobutyrate (607.99-2778.60) and methyl 2-methylbutyrate (32.58-1660.48) contributed fruity aroma. In the early stage of fermentation, their rOAV values ​​increased by 3.20 times and 44.93 times, respectively. Their influence on the overall flavor of dark tea fermented by Penicillium polonicum XL6-1 continued to grow during the middle and late fermentation.

[0081] The OPLS-DA model was used to perform pairwise comparisons between PDT0 and PDT4, PDT4 and PDT10, and PDT10 and PDT22, aiming to identify differential volatile compounds at different fermentation stages. 2The X and Q2 values ​​were both over 0.9. There were significant differences between samples at different fermentation stages. Cross-validation confirmed the robustness of the model and ruled out the possibility of overfitting. Potential key differential volatile compounds that led to aroma differences in the three fermentation stages were identified by OPLS-DA analysis and rOAV standards (rOAV>1, VIP>1). A total of 64 potential key differential volatile compounds were screened during the fermentation process, among which linalool, methyl salicylate, 1-octen-3-ol and other substances were detected more in Fuzhuan tea and had a significant effect on the flavor of Fuzhuan tea. Methyl hexanoate-D, dimethyl disulfide, and propionic acid-M were key differential flavor compounds unique to the early fermentation stage; 1-pentanol-M, 1-butanol-D, 2-methyl-1-butanol and 3-methyl-2-butenal were key differential flavor compounds unique to the middle fermentation stage; 1-penten-3-ol-M was a key differential flavor compound unique to the late fermentation stage. There were 19 key differential volatile compounds common to the three fermentation stages. In the early stage of fermentation, the contents of 11 volatile organic compounds, including acetoin, methyl salicylate, dimethyl trisulfide and (Z)-3-hexen-1-ol, were high. In the middle stage of fermentation, the concentrations of 1-octen-3-ol, ethyl isobutyrate and ethyl propionate were higher. In the late stage of fermentation, 2,4-hexadienal, dimethyl sulfide, (E)-2-nonenal, 1-penten-3-one and 2-pentanone were produced in large quantities ( Figure 4 E). These key differential flavor compounds can be used to identify the different fermentation stages of dark tea fermented by Penicillium polonicum XL6-1.

[0082]

[0083]

[0084]

[0085] 4. Changes in the color of dark tea fermented with Penicillium polonicum XL6-1

[0086] (1) Detection method

[0087] According to the Chinese Tea Standard Procedure (GB / T 23776-2018), 150 mL of boiling ultrapure water was poured into a beaker containing 3.00 g of Penicillium polonicum XL6-1 fermented black tea sample. After soaking for 5 minutes, the mixture was filtered and cooled to room temperature.

[0088] In order to detect the color change of tea soup, a colorimeter device (CM-5, Konica Minolta (China) Investment Co., Ltd.) was used. The colorimetric system uses four color coordinates: L* (brightness, ranging from -dark to +bright), a* (from -green to +red), b* (from -blue to +yellow) and C* (saturation, where 100 means full saturation and 0 means unsaturation). The determination was carried out in a dark environment.

[0089] (2) Test results

[0090] The tea soup color of Penicillium polonicum XL6-1 fermented black tea at different fermentation stages is significantly different, changing the tea color from yellow to bright red and then to reddish brown ( Figure 5 A). This indicates that Penicillium polonicum XL6-1 helps improve the color quality of dark tea. Figure 5 As shown in B, a* (redness) and C values ​​(color saturation) increase in the early fermentation stage and then decrease in the middle and late stages, indicating a transition from increased redness and saturation to reduced levels. L* (lightness) and b* (yellowness) values ​​show a continuous downward trend throughout the fermentation process, with little difference in the late stage.

[0091] 5. Changes in tea pigment content in dark tea fermented with Penicillium polonicum XL6-1

[0092] (1) Detection method

[0093] Preparation of tea soup: Weigh 3.0g of Penicillium polonicum XL6-1 fermented dark tea sample, add 125mL of boiling distilled water, shake well and immediately extract in boiling water bath for 10min, filter while hot, and extract after cooling to room temperature. Add 30mL of tea soup sample and 30mL of ethyl acetate into a separatory funnel and shake thoroughly for 5min.

[0094] Take 2mL of the lower layer of liquid and put it into a 25mL volumetric flask, add 2mL of saturated oxalic acid solution and 6mL of distilled water, and then make up to volume with 95% ethanol solution. The absorbance of the solution at 380nm is recorded as A a .

[0095] Take 2 mL of the upper layer of liquid and transfer it to a 25 mL volumetric flask, and add 95% ethanol solution to make up the volume. The absorbance of the solution at 380 nm is recorded as A b .

[0096] Take 15mL of the upper layer liquid, 2.5% NaHCO3; 15mL of the solution is added to the separatory funnel and fully shaken for 0.5min. After stratification, take 4mL of the newly obtained upper layer of ethyl acetate to a 25mL volumetric flask and add 95% ethanol solution to make up the volume. The absorbance of the solution at 380nm is recorded as A c .

[0097] Add 15 mL of tea sample and 15 mL of n-butanol into a separatory funnel and shake thoroughly for 3 minutes. Take 2 mL of the lower layer of liquid and transfer it to a 25 mL volumetric flask. Add 2 mL of saturated oxalic acid solution and 6 mL of distilled water, and then make up to volume with 95% ethanol solution. The absorbance of the solution at 380 nm is recorded as A d .

[0098] Use 95% ethanol solution as blank control and substitute the measured absorbance into the formula for calculation:

[0099] Theaflavins (%) = (Ac × 2.25) × 100%

[0100] Thearubigins (%) = [7.06 × (2A b +2A a -A c -2A d )]×100%

[0101] Theabrownin (%) = (2A d ×7.06)×100%

[0102] (2) Results Analysis

[0103] Tea pigments are the key factors affecting the color of tea liquid. The content of theaflavins and thearubigins increases significantly in the early stage, but in the subsequent stage ( Figure 5 CD). Theaflavins are the result of oxidation and polymerization of catechins under the catalysis of polyphenol oxidase and other enzymes. Theaflavins are known to enhance the red color of tea leaves, which increased significantly by 122.45% in the early and middle stages and decreased slightly in the later stages ( Figure 5 E). During tea processing, polyphenols such as catechins and theaflavins are further oxidized to form thearubigins and theabrownins. Theabrownins have the characteristics of phenolic substances, and their structure contains a large number of hydroxyl and carboxyl groups. They have the effects of reducing fat and losing weight, anti-oxidation, anti-tumor and improving immunity. Dark tea has obvious effects of reducing fat and losing weight, which is related to the content of theabrownins.

[0104] 6. Analysis of the flavor changes of dark tea fermented by Penicillium polonicum XL6-1

[0105] (1) Detection method

[0106] According to the Chinese Tea Standard Procedure (GB / T 23776-2018), 150 mL of boiling ultrapure water was poured into a beaker containing 3.00 g of Penicillium polonicum XL6-1 fermented black tea sample. After soaking for 5 minutes, the mixture was filtered and cooled to room temperature.

[0107] The taste sensory evaluation was performed using a taste sensing system (SA-402B, Insend Intelligent Sensing Technology Co., Ltd., Kanagawa, Japan). The taste sensing system consists of a series of sensor probes and a standard probe, which are immersed in tea soup and reference solutions to evaluate the intensity of taste. The sensor probes evaluate various taste attributes, including astringency, astringent aftertaste, bitterness, bitter aftertaste, sourness, umami, sweetness, richness, and saltiness. A standard solution composed of 30 mmol / L potassium chloride and 0.3 mmol / L tartaric acid was used as a cleaning and reference solution. The definition standards for saltiness and sourness were -6 and -13, respectively, while the thresholds for other taste attributes were set to zero.

[0108] (2) Results Analysis

[0109] There are differences in the response intensity of taste sensors of dark tea fermented by Penicillium polonicum XL6-1 at different fermentation times. Principal component analysis (PCA) effectively distinguished the taste of dark tea fermented by Penicillium polonicum XL6-1 at different fermentation stages, and PDT10 and PDT22 had certain similarities ( Figure 6 A). The sour taste of the dark tea soup fermented by Penicillium polonicum XL6-1 was not detected. The saltiness of the dark tea soup fermented by Penicillium polonicum XL6-1 at different fermentation times had no significant difference, but showed considerable differences in other taste indicators ( Figure 6 B). During the fermentation process, the richness of the tea soup decreased significantly. Sweetness increased in the early fermentation stage, but decreased significantly in the later stage. Similarly, umami increased in the early and middle stages, but decreased significantly in the later fermentation stage. Bitterness showed an "N"-shaped trend, with an increase in the bitterness of the fermented tea soup compared to black tea (PDT0). Astringency continued to decrease until it was no longer noticeable. Bitterness and bitter aftertaste, as well as astringency and astringent aftertaste, were positively correlated, respectively. A large number of studies have shown that ester catechins are important contributors to the bitterness and astringency of tea soup, and higher theabrownin content reduces the bitterness of black tea. Microorganisms transform alkaloids and flavonoids, thereby reducing the bitterness and astringency of tea soup.

[0110] In summary, the application of Penicillium polonicum XL6-1 obtained by the present invention in the production of dark tea has a great influence on the formation of the flavor of dark tea. As the fermentation proceeds, the volatile organic compounds with floral and fruity aromas in the dark tea, such as (E)-β-ionone and (E)-β-damascus ketone, are significantly reduced. In the middle and late stages of fermentation, the volatile organic compounds with pea and sweet pepper aromas increase significantly, such as compounds such as 2-isopropyl-3-methoxypyrazine, 2-methoxy-3-sec-butylpyrazine and 2-methoxy-3-isobutylpyrazine, which significantly change the flavor of the dark tea during the fermentation process. At the same time, the taste quality and color characteristics of the dark tea also undergo significant changes. The color of the dark tea fermented by Penicillium polonicum XL6-1 changes from yellow to bright red and then to reddish brown. Compared with unfermented black tea, the astringency of fermented black tea soup is significantly reduced, while bitterness, umami and sweetness are increased. In addition, the analysis of the extracellular enzyme activity secreted by Penicillium polonicum XL6-1 shows that β-glucosidase, polyphenol oxidase, tannase and peroxidase have certain activities during the fermentation process, and the activities of polyphenol oxidase and peroxidase are significantly higher than those of other hydrolases. These hydrolases can work together to improve the quality characteristics of black tea. Therefore, Penicillium polonicum XL6-1 is a strain with excellent performance and suitable for black tea fermentation production. The use of the strain of the present invention for fermentation production is conducive to the development and application of the modern industry of fermented food.

Claims

1. A strain of Penicillium polonicum XL6-1, characterized in that: The deposit number of the Penicillium polonicum XL6-1 is CCTCC NO: 2023483.

2. A microbial preparation, characterized in that: The microbial preparation comprises the Penicillium polonicum XL6-1 according to claim 1.

3. The microbial preparation according to claim 2, characterized in that The preparation method of the microbial preparation comprises the following steps: The Penicillium polonicum XL6-1 described in claim 1 is inoculated into a modified Czapek medium under sterile conditions for activation; the activated Penicillium polonicum XL6-1 is transferred to the modified Czapek medium under sterile conditions, and cultured at 28° C. for 5 to 7 days, and then the activated Penicillium polonicum XL6-1 is inoculated into the modified Czapek medium again under sterile conditions, subcultured at 28° C., and finally the subcultured Penicillium polonicum XL6-1 is mixed with sterile water to obtain the microbial preparation.

4. The microbial preparation according to claim 3, characterized in that The concentration of Penicillium polonicum XL6-1 in the microbial preparation is 10 7 CFU / mL.

5. The microbial preparation according to claim 3, characterized in that The subculture period is 7 days.

6. Use of the Penicillium polonicum XL6-1 according to claim 1 or the microbial preparation according to any one of claims 2 to 5 in the preparation of fermented products.

7. The use according to claim 6, characterized in that: The fermented product includes but is not limited to black tea.

8. The use according to claim 7, characterized in that: The method for preparing dark tea comprises the following steps: The dark tea leaves are uniformly sprayed with distilled water and then sterilized at high temperature. After cooling to room temperature, they are inoculated with the Penicillium polonicum XL6-1 described in claim 1 or the microbial preparation described in any one of claims 2 to 5, and fermented at 28° C. to obtain the dark tea.

9. The use according to claim 8, characterized in that: The mass volume ratio of the dark tea leaves to the distilled water is 20:9; and the fermentation time at 28° C. is 2-22 days.

10. A solid fermented dark tea made from Penicillium polonicum XL6-1, characterized in that: The solid fermented dark tea is prepared by fermenting dark tea with Penicillium polonicum XL6-1 described in claim 1 or the microbial preparation described in any one of claims 2-5.

Images