Astaxanthin-producing Yarrowia lipolytica engineered strain, construction method and application thereof, and astaxanthin preparation method

Abstract

The present invention belongs to the technical field of microbial synthesis of astaxanthin, and discloses an astaxanthin-producing Yarrowia lipolytica engineered strain, a construction method and application thereof, and a method for preparing astaxanthin. The Yarrowia lipolytica engineered strain provided by the present invention overexpresses peroxisomal membrane protein PEX11 and peroxisomal targeting signal type I receptor PEX5, and can simultaneously synthesize and express β-carotene hydroxylase and β-carotene ketolase. The Yarrowia lipolytica engineered strain has excellent astaxanthin synthesis ability and astaxanthin cell volume, can achieve high-yield synthesis of astaxanthin, provides a basis for large-scale industrial production of astaxanthin, and has good application prospects.

Description

Technical Field

[0001] The invention belongs to the technical field of astaxanthin microbial synthesis, and particularly relates to an astaxanthin-producing Yarrowia lipolytica engineering strain, a construction method and application thereof, and a method for preparing astaxanthin. Background Art

[0002] The chemical name of astaxanthin is 3,3'-dihydroxy-4,4'-diketo-β,β'-carotene, which is a keto-carotenoid. Compared with other carotenoids, it has excellent antioxidant effects and is widely used in daily chemical products, pharmaceutical industry, food and health industry, aquatic animal husbandry and other fields.

[0003] At present, the main methods of producing astaxanthin are natural extraction, chemical synthesis and microbial synthesis. The natural extraction method refers to the method of extracting astaxanthin from waste crustaceans such as shrimps and crabs, but there are problems such as extremely low yield, high cost and low purity of the obtained astaxanthin. The process of chemical synthesis is complicated, and the synthesized astaxanthin has problems such as low biological activity, poor stability and low purity. The microbial synthesis method refers to the use of strains such as Haematococcus pluvialis that have the ability to synthesize astaxanthin, or the introduction of exogenous astaxanthinase synthesis metabolic pathways into common engineered bacteria such as Escherichia coli, Saccharomyces cerevisiae and Yarrowia lipolytica through genetic engineering technology to obtain recombinant strains with the ability to synthesize astaxanthin, and synthesize astaxanthin. The astaxanthin obtained by microbial synthesis has a clear configuration, is environmentally friendly, and has few by-products. It is a very potential astaxanthin production method. However, the conflict between the introduced exogenous astaxanthinase synthesis metabolic pathway and the natural metabolism of the engineered bacteria greatly limits the synthesis efficiency of astaxanthin; moreover, intermediate products such as astaxanthin and carotenoids will be stored in membranous organelles and cell membranes, which often imposes a burden on the engineered bacteria, causing growth inhibition, and even cell death in severe cases. There are problems such as low astaxanthin synthesis efficiency and poor tolerance of engineered strains to astaxanthin accumulation, which have certain limitations. Summary of the invention

[0004] The first purpose of the present invention is to solve the problem of low astaxanthin production caused by low astaxanthin synthesis efficiency and poor tolerance of engineered strains to astaxanthin accumulation in existing astaxanthin microbial synthesis methods, and to provide an engineered strain of Yarrowia lipolytica with high astaxanthin production, wherein the engineered strain of Yarrowia lipolytica has excellent astaxanthin production.

[0005] The second object of the present invention is to provide a method for constructing the above-mentioned astaxanthin-producing Yarrowia lipolytica engineered strain.

[0006] The third object of the present invention is to provide the use of the above-mentioned astaxanthin-producing Yarrowia lipolytica engineered strain in the field of astaxanthin preparation.

[0007] The fourth object of the present invention is to provide a method for preparing astaxanthin.

[0008] Specifically, the chassis cells of the astaxanthin-producing Yarrowia lipolytica engineered strain provided by the present invention are terpene-producing Yarrowia lipolytica, the Yarrowia lipolytica engineered strain overexpresses peroxisomal membrane protein PEX11 and peroxisomal targeting signal type I receptor PEX5, and the Yarrowia lipolytica engineered strain can simultaneously synthesize and express β-carotene hydroxylase and β-carotene ketolase.

[0009] Furthermore, the peroxisomal membrane protein PEX11 includes an amino acid fragment whose sequence is shown in SEQ ID NO:24.

[0010] Furthermore, the peroxisome targeting signal type I receptor PEX5 comprises an amino acid fragment having a sequence as shown in SEQ ID NO:25.

[0011] Furthermore, the β-carotene hydroxylase comprises an amino acid fragment whose sequence is shown in SEQ ID NO:49.

[0012] Furthermore, the β-carotene ketolase comprises an amino acid fragment having a sequence as shown in SEQ ID NO:50.

[0013] Furthermore, the Yarrowia lipolytica producing terpene compounds expresses terpene synthase.

[0014] Furthermore, the terpene synthase includes one or more of phytoene dehydrogenase carB, lycopene cyclase and phytoene synthase bifunctional enzyme carPR, α-farnesene synthase αFS, multifunctional carotene synthase carS, and limonene synthase.

[0015] Furthermore, the phytoopene dehydrogenase carB comprises an amino acid fragment having a sequence as shown in SEQ ID NO:1.

[0016] Furthermore, the lycopene cyclase and phytoene synthase bifunctional enzyme carPR comprises an amino acid fragment having a sequence as shown in SEQ ID NO:2.

[0017] Furthermore, the α-farnesene synthase αFS comprises an amino acid fragment having a sequence as shown in SEQ ID NO:3.

[0018] Furthermore, the multifunctional carotene synthase carS comprises an amino acid fragment whose sequence is shown in SEQ ID NO:4.

[0019] The method for constructing an astaxanthin-producing Yarrowia lipolytica engineering strain provided by the present invention comprises: constructing a PEX11-PEX5 expression cassette based on a PEX11 gene and a PEX5 gene, and recombining the PEX11-PEX5 expression cassette with a plasmid vector I to obtain a recombinant plasmid PEX11-PEX5; constructing a CrtZ expression cassette and a CrtW expression cassette based on a CrtZ gene and a CrtW gene, and recombining the CrtZ expression cassette and the CrtW expression cassette with a plasmid vector II to obtain a recombinant plasmid CrtZ-CrtW; and sequentially transforming the recombinant plasmid PEX11-PEX5 and the recombinant plasmid CrtZ-CrtW into a terpene compound-producing Yarrowia lipolytica to obtain the Yarrowia lipolytica engineering strain.

[0020] Furthermore, the PEX11 gene includes a nucleotide sequence as shown in SEQ ID NO:9.

[0021] Furthermore, the PEX5 gene includes a nucleotide sequence as shown in SEQ ID NO:16.

[0022] Furthermore, the PEX11-PEX5 expression cassette includes a TEF promoter, a PEX11 gene, an XPR2 terminator, a TEF promoter, a PEX5 gene and an XPR2 terminator sequentially connected from the 5' to the 3' direction.

[0023] Furthermore, the recombinant plasmid PEX11-PEX5 includes at least two groups of PEX11-PEX5 expression cassettes.

[0024] Furthermore, the CrtZ gene comprises a nucleotide sequence as shown in SEQ ID NO:33.

[0025] Furthermore, the CrtW gene comprises a nucleotide sequence as shown in SEQ ID NO:40.

[0026] Furthermore, the CrtZ expression cassette includes a TEF promoter, a CrtZ gene and an XPR2 terminator sequentially connected from the 5' to the 3' direction.

[0027] Furthermore, the CrtW expression cassette includes a TEF promoter, a CrtW gene and an XPR2 terminator sequentially connected from the 5' to the 3' direction.

[0028] Furthermore, the recombinant plasmid CrtZ-CrtW comprises a leu-promoter-leu2 sequence, a CrtZ expression cassette and a CrtW expression cassette sequentially connected along the 5' to 3' direction.

[0029] Furthermore, the Yarrowia lipolytica engineered strain is also introduced with a helper plasmid, and the helper plasmid includes a gRNA sequence.

[0030] Furthermore, the gRNA sequence includes a nucleotide fragment as shown in SEQ ID NO:46.

[0031] The present invention also provides application of the above-mentioned astaxanthin-producing Yarrowia lipolytica engineered strain in the field of astaxanthin preparation.

[0032] The preparation method of astaxanthin provided by the present invention comprises: taking the above-mentioned astaxanthin-producing Yarrowia lipolytica engineered strain for fermentation culture to obtain the astaxanthin.

[0033] Beneficial effects:

[0034] In the Yarrowia lipolytica engineered strain provided by the present invention, the overexpression of peroxisomal membrane protein PEX11 and peroxisomal targeting signal type I receptor PEX5 is conducive to the improvement of intracellular peroxisome abundance and the transfer of protein into peroxisomes, thereby improving the operational efficiency of peroxisomes, promoting the synthesis of intracellular terpene compounds and the β-oxidation process to provide precursor substances for the synthesis of astaxanthin, and facilitating the realization of large-scale synthesis of astaxanthin; at the same time, the overexpressed peroxisomal membrane protein PEX11 and peroxisomal targeting signal type I receptor PEX5 act synergistically to promote the enhancement of peroxisomes as lipid metabolism cells. The invention discloses a novel method for preparing a yeast strain for fermenting astaxanthin, which can effectively transform lipid intermediates produced in the biosynthesis process of astaxanthin, and is not only beneficial to the synthesis of astaxanthin, but also effectively improve the cell's capacity for astaxanthin, so that the Yarrowia lipolytica engineered strain shows excellent astaxanthin synthesis ability in both small-scale and large-scale fermentation culture. The Yarrowia lipolytica engineered strain can produce 35 mg / L of astaxanthin at the fermentation level of 50 mL shake flask, and can produce 145 mg / L of astaxanthin at the fermentation level of 5 L fermenter. The astaxanthin production has been significantly improved, which provides a basis for the large-scale industrial production of astaxanthin and has good application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 This is a schematic diagram of the structure of the recombinant plasmid pHR_A08_PEX11-PEX5 provided in Example 1 of the present invention;

[0036] Figure 2 This is a schematic diagram of the structure of the recombinant plasmid pCFB-CrtZ-CrtW provided in Example 2 of the present invention;

[0037] Figure 3 This is a schematic diagram of the structure of the recombinant plasmid pCRISPRyl_IntE provided in Example 2 of the present invention. DETAILED DESCRIPTION

[0038] Based on a deep understanding of the intracellular astaxanthin synthesis pathway, the inventors of the present invention have creatively discovered through extensive and in-depth research and a large number of experiments that on the basis of the terpene synthase, peroxisome and its related proteins that can be synthesized and expressed by the original Yarrowia lipolytica producing terpene compounds, the PEX11 gene and the PEX5 gene are additionally introduced, and the copy number of the genes encoding the overexpressed peroxisomal membrane protein PEX11 and the peroxisome targeting signal type I receptor PEX5 in the cell is increased, so that the above two peroxisome-related proteins can be synthesized and accumulated in large quantities without affecting the normal life activities of the cells. The invention relates to a Yarrowia lipolytica engineered strain overexpressing peroxisomal membrane protein PEX11 and peroxisome targeting signal type I receptor PEX5. The overexpression of the above two peroxisome-related proteins can change the abundance of intracellular peroxisomes, improve the peroxisome protein transport process, and promote the functions related to peroxisome lipid metabolism bodies, so as to promote the biosynthesis of astaxanthin with β-carotene hydroxylase and β-carotene ketolase as key enzymes, realize the efficient synthesis and accumulation of astaxanthin, and finally realize the high-yield synthesis of astaxanthin, thereby obtaining the technical scheme of the present invention.

[0039] In the present invention, the chassis cell of the Yarrowia lipolytica engineered strain is a terpene-producing Yarrowia lipolytica, the Yarrowia lipolytica engineered strain overexpresses peroxisomal membrane protein PEX11 and peroxisomal targeting signal type I receptor PEX5, and the Yarrowia lipolytica engineered strain simultaneously synthesizes and expresses β-carotene hydroxylase and β-carotene ketolase.

[0040] In the present invention, the overexpression refers to fusing the genes encoding the peroxisome membrane protein PEX11 and the peroxisome targeting signal type I receptor PEX5 with a highly active constitutive promoter to construct a plasmid vector, and increasing the copy number of the relevant encoding gene in the cell to upregulate the expression of the protein, so that the peroxisome membrane protein PEX11 and the peroxisome targeting signal type I receptor PEX5 are accumulated in large quantities in the cell.

[0041] In the present invention, the peroxisomal membrane protein PEX11 refers to a type of protein that can be inserted into the peroxisomal membrane to increase its bending and plasticity, thereby inducing peroxisome fission. The peroxisomal membrane protein PEX11 is limited to having the above-mentioned biological activity, and the present invention does not impose any particular limitation on its specific amino acid sequence.

[0042] In some specific embodiments, the peroxisomal membrane protein PEX11 preferably includes an amino acid fragment as shown in SEQ ID NO: 24. At this time, the peroxisomal membrane protein PEX11 can better exert biological activity in Yarrowia lipolytica cells, and cooperate with the peroxisome targeting signal type I receptor PEX5 to achieve a better astaxanthin synthesis effect.

[0043] In the present invention, the peroxisome targeting signal type I receptor PEX5 refers to a protein that can recognize a PTS1 signal (peroxisome targeting signal 1) to induce the formation of a transmembrane import pore, thereby achieving the localization of the target protein on the peroxisome membrane. The peroxisome targeting signal type I receptor PEX5 is limited to having the above-mentioned biological activity, and the present invention does not impose any particular limitation on its specific amino acid sequence.

[0044] In some specific embodiments, the peroxisome targeting signal type I receptor PEX5 preferably includes an amino acid fragment as shown in SEQ ID NO: 25. At this time, the peroxisome targeting signal type I receptor PEX5 can better exert biological activity in Yarrowia lipolytica cells, and cooperate with the peroxisome membrane protein PEX11 to achieve a better astaxanthin synthesis effect.

[0045] In the present invention, the β-carotene hydroxylase refers to a class of enzyme molecules that have the activity of catalyzing the conversion of β-carotene into zeaxanthin. The β-carotene hydroxylase is limited to having the above-mentioned biological activity, and the present invention does not impose any particular limitation on its specific amino acid sequence.

[0046] In some specific embodiments, the β-carotene hydroxylase preferably includes an amino acid fragment having a sequence as shown in SEQ ID NO: 49. In this case, the β-carotene hydroxylase still has excellent enzyme activity in Yarrowia lipolytica cells and can achieve efficient synthesis of astaxanthin.

[0047] In the present invention, the β-carotene ketolase refers to a class of enzyme molecules that have the activity of catalyzing the conversion of zeaxanthin into astaxanthin. The β-carotene ketolase is limited to having the above-mentioned biological activity, and the present invention does not impose any particular limitation on its specific amino acid sequence.

[0048] In some specific embodiments, the β-carotene ketolase preferably includes an amino acid fragment having a sequence as shown in SEQ ID NO: 50. In this case, the β-carotene ketolase still has excellent enzyme activity in Yarrowia lipolytica cells and can achieve efficient synthesis of astaxanthin.

[0049] In the present invention, the Yarrowia lipolytica producing terpene compounds refers to a type of Yarrowia lipolytica having the ability to synthesize terpene compounds, which can express terpene synthase in its cells and realize the synthesis of terpene compounds, so as to provide corresponding precursor substances for the synthesis of astaxanthin. Specific examples of the terpene synthase include but are not limited to: one or more of phytoene dehydrogenase carB, lycopene cyclase and phytoene synthase bifunctional enzyme carPR, α-farnesene synthase αFS, limonene synthase, and multifunctional carotene synthase carS.

[0050] In some specific embodiments, the terpene-producing Yarrowia lipolytica preferably includes a phytoene dehydrogenase carB and a lycopene cyclase and phytoene synthase bifunctional enzyme carPR; the phytoene dehydrogenase carB includes an amino acid fragment as shown in SEQ ID NO: 1; the lycopene cyclase and phytoene synthase bifunctional enzyme carPR includes an amino acid fragment as shown in SEQ ID NO: 2. At this time, the introduced PEX11-PEX5-CrtZ-CrtW gene axis can better play a synergistic role with the relevant expression system for synthesizing terpene compounds in the terpene-producing Yarrowia lipolytica, and the obtained Yarrowia lipolytica engineered strain has a better astaxanthin synthesis ability.

[0051] In some specific embodiments, the terpene-producing Yarrowia lipolytica preferably has an α-farnesene synthase αFS; the α-farnesene synthase αFS includes an amino acid fragment as shown in SEQ ID NO: 3. At this time, the introduced PEX11-PEX5-CrtZ-CrtW gene axis can better cooperate with the relevant expression system for synthesizing terpene compounds in the terpene-producing Yarrowia lipolytica, and the obtained Yarrowia lipolytica engineered strain has a better astaxanthin synthesis ability.

[0052] In some specific embodiments, the terpene-producing Yarrowia lipolytica preferably has a multifunctional carotene synthase carS; the multifunctional carotene synthase carS includes an amino acid fragment as shown in SEQ ID NO: 4. At this time, the introduced PEX11-PEX5-CrtZ-CrtW gene axis can better cooperate with the relevant expression system for synthesizing terpene compounds in the terpene-producing Yarrowia lipolytica, and the obtained Yarrowia lipolytica engineered strain has a better astaxanthin synthesis ability.

[0053] Based on the purpose of constructing the above-mentioned Yarrowia lipolytica engineering strain, the present invention also provides a method for constructing an astaxanthin-producing Yarrowia lipolytica engineering strain. The construction method specifically includes: constructing a PEX11-PEX5 expression cassette based on the PEX11 gene and the PEX5 gene, taking the PEX11-PEX5 expression cassette and recombining it with the plasmid vector I to obtain a recombinant plasmid PEX11-PEX5; constructing a CrtZ expression cassette and a CrtW expression cassette based on the CrtZ gene and the CrtW gene, taking the CrtZ expression cassette and the CrtW expression cassette and recombining it with the plasmid vector II to obtain a recombinant plasmid CrtZ-CrtW; taking the recombinant plasmid PEX11-PEX5 to transform the original Yarrowia lipolytica to obtain a Yarrowia lipolytica engineering strain that overexpresses the peroxisomal membrane protein PEX11 and the peroxisomal targeting signal type I receptor PEX5, and on this basis, transforming into the recombinant plasmid CrtZ-CrtW to obtain the Yarrowia lipolytica engineering strain.

[0054] In the present invention, the PEX11 gene refers to a gene fragment encoding the peroxisomal membrane protein PEX11. A person skilled in the art can learn its specific nucleotide sequence based on the structure of the peroxisomal membrane protein PEX11, as long as it can achieve the encoding of the peroxisomal membrane protein PEX11. The present invention does not impose any particular limitation on its specific nucleotide sequence.

[0055] In some specific embodiments, the PEX11 gene preferably includes a nucleotide sequence as shown in SEQ ID NO: 9. In this case, the PEX11 gene can be efficiently expressed in Yarrowia lipolytica cells to better achieve the effect of overexpression of the peroxisomal membrane protein PEX11.

[0056] In the present invention, the PEX5 gene refers to a gene fragment encoding the peroxisome targeting signal type I receptor PEX5. Those skilled in the art can know its specific nucleotide sequence based on the structure of the peroxisome targeting signal type I receptor PEX5, and is limited to being able to achieve the encoding of the peroxisome targeting signal type I receptor PEX5. The present invention does not impose any particular limitation on its specific nucleotide sequence.

[0057] In some specific embodiments, the PEX5 gene preferably includes a nucleotide sequence as shown in SEQ ID NO: 16. At this time, the PEX5 gene can be efficiently expressed in Yarrowia lipolytica cells to better achieve the effect of overexpression of peroxisome targeting signal type I receptor PEX5.

[0058] In the present invention, the PEX11-PEX5 expression cassette refers to a DNA fragment including a promoter, a PEX11 gene, a PEX5 gene and a terminator, which can utilize the protein expression system in Yarrowia lipolytica cells to achieve the expression of peroxisomal membrane protein PEX11 and peroxisome targeting signal type I receptor PEX5.

[0059] In some specific embodiments, the PEX11-PEX5 expression cassette preferably includes a TEF promoter, a PEX11 gene, an XPR2 terminator, a TEF promoter, a PEX5 gene, and an XPR2 terminator sequentially connected along the 5' to 3' direction. The nucleotide sequence of the TEF promoter is the nucleotide sequence shown in SEQ ID NO:51; the nucleotide sequence of the XPR2 terminator is the nucleotide sequence shown in SEQ ID NO:52.

[0060] In the present invention, the plasmid vector I refers to a type of circular DNA molecule that can carry exogenous gene fragments and can be replicated and expressed in host cells. It is a technical means commonly used in the field of genetic engineering and is not particularly limited in the present invention.

[0061] In some specific embodiments, the recombinant plasmid PEX11-PEX5 preferably includes at least two groups of PEX11-PEX5 expression cassettes. In this case, the recombinant plasmid PEX11-PEX5 can better overexpress the peroxisomal membrane protein PEX11 and the peroxisomal targeting signal type I receptor PEX5 in Yarrowia lipolytica cells.

[0062] In the present invention, the CrtZ gene refers to a gene fragment encoding β-carotene hydroxylase. Those skilled in the art can learn its specific nucleotide sequence based on the structure of β-carotene hydroxylase, as long as it can achieve the encoding of β-carotene hydroxylase. The present invention does not impose any particular limitation on its specific nucleotide sequence.

[0063] In some specific embodiments, the CrtZ gene preferably includes a nucleotide sequence as shown in SEQ ID NO: 33. In this case, the CrtZ gene can be efficiently expressed in Yarrowia lipolytica cells to better achieve the expression of β-carotene hydroxylase.

[0064] In the present invention, the CrtZ expression cassette refers to a DNA fragment including a promoter, a CrtZ gene and a terminator, which can utilize the protein expression system in Yarrowia lipolytica cells to achieve the expression of β-carotene hydroxylase. In some specific embodiments, the CrtZ expression cassette specifically includes a TEF promoter, a CrtZ gene and an XPR2 terminator sequentially connected along the 5' to 3' direction.

[0065] In the present invention, the CrtW gene refers to a gene fragment encoding β-carotene ketolase. Those skilled in the art can learn its specific nucleotide sequence based on the structure of β-carotene ketolase, as long as it can encode β-carotene ketolase. The present invention does not impose any particular limitation on its specific nucleotide sequence.

[0066] In some specific embodiments, the CrtW gene preferably includes a nucleotide sequence as shown in SEQ ID NO: 40. In this case, the CrtW gene can be efficiently expressed in Yarrowia lipolytica cells to better achieve the expression of β-carotene ketolase.

[0067] In the present invention, the CrtW expression cassette refers to a DNA fragment including a promoter, a CrtW gene and a terminator, which can utilize the protein expression system in Yarrowia lipolytica cells to achieve the expression of β-carotene ketolase. In some specific embodiments, the CrtW expression cassette specifically includes a TEF promoter, a CrtW gene and an XPR2 terminator sequentially connected along the 5' to 3' direction.

[0068] In the present invention, the plasmid vector II refers to a type of circular DNA molecule that can carry exogenous gene fragments and can be replicated and expressed in host cells. It is a technical means commonly used in the field of genetic engineering and is not particularly limited in the present invention.

[0069] It should be noted that the "I" and "II" in the above-mentioned plasmid vector I and plasmid vector II are only for convenience of description and do not have any other special limiting effect.

[0070] In some specific embodiments, the recombinant plasmid CrtZ-CrtW preferably comprises a leu-promoter-leu2 sequence, a CrtZ expression cassette and a CrtW expression cassette connected in sequence from 5' to 3'. In this case, the recombinant plasmid CrtZ-CrtW can efficiently synthesize β-carotene hydroxylase and β-carotene ketolase in Yarrowia lipolytica cells.

[0071] In the present invention, the construction methods of the PEX11-PEX5 expression cassette, CrtZ expression cassette, CrtW expression cassette and related recombinant plasmids are conventional techniques used in genetic engineering, and the present invention does not impose any particular limitation thereto.

[0072] In the present invention, the Yarrowia lipolytica engineered strain is preferably further introduced with an auxiliary plasmid, wherein the auxiliary plasmid includes a gRNA sequence, wherein the gRNA sequence specifically includes a nucleotide fragment as shown in SEQ ID NO:46.

[0073] In the present invention, the method of transforming the original Yarrowia lipolytica with the recombinant plasmids PEX11-PEX5, recombinant plasmids CrtZ-CrtW and optional auxiliary plasmids is a conventional technical means used in genetic engineering, and the present invention does not impose any particular limitation thereto.

[0074] Based on the excellent astaxanthin-producing ability of the Yarrowia lipolytica engineered strain, the present invention also provides the use of the astaxanthin-producing Yarrowia lipolytica engineered strain in the field of astaxanthin preparation.

[0075] Based on the application of the Yarrowia lipolytica engineered strain in the field of astaxanthin preparation, the present invention provides a method for preparing astaxanthin. The preparation method specifically comprises: taking the Yarrowia lipolytica engineered strain producing astaxanthin and fermenting and culturing it to obtain the astaxanthin.

[0076] Embodiments of the present invention are described in detail below, and the examples of the embodiments are intended to be used to explain the present invention, but should not be construed as limiting the present invention. In the embodiments, if specific techniques or conditions are not specified, the techniques or conditions described in the literature in this area or the product specifications are used. If the manufacturer is not specified for reagents or instruments used, they are all conventional products that can be obtained commercially.

[0077] Preparation Example 1

[0078] This preparation example is used to illustrate the preparation of Yarrowia lipolytica YLA-1 competent cells, which specifically includes:

[0079] (1) Yarrowia lipolytica YLA-1 was inoculated into 5 mL of YPD medium and cultured overnight in a shaking incubator at 28°C and 225 rpm to obtain a bacterial liquid.

[0080] The YPD medium includes: 10 g / L yeast extract, 20 g / L peptone and 20 g / L glucose.

[0081] (2) Take 50 mL of bacterial solution, centrifuge at 4000 rpm for 2 min, remove the supernatant, wash the precipitate with 30 mL of sterile water, centrifuge at 4000 rpm for 2 min, remove the supernatant, precipitate with 1.5 mL of 1.1×TE / LiAc, centrifuge at 4000 rpm for 2 min, remove the supernatant, and collect the bacteria.

[0082] Among them, 1.1×TE / LiAc was prepared by mixing 1.1 mL of 10×TE buffer and 1.1 mL of 1M LiAc solution (pH=7.5) and diluting to 10 mL with sterile water; 10×TE buffer was prepared by dissolving 15.759 g of Tris-Cl and 2.92 g of EDTA in 100 mL of sterile water and adjusting the pH to 8.

[0083] (3) Resuspend the cells in 600 μL of 1.1×TE / LiAc solution and aliquot into 50 μL / tube to obtain competent cell treatment solution, which was stored at -80°C for later use.

[0084] Among them, the cells of Yarrowia lipolytica YLA-1 include terpene synthase-phytoene dehydrogenase carB (SEQ ID NO: 1) and lycopene cyclase and phytoene synthase bifunctional enzyme carPR (SEQ ID NO: 2), which have the ability to synthesize terpene compounds. [1] The provided method is constructed.

[0085] [1] Zhu Hangzhi, Jiang Shan, Chen Dan, et al. Introducing a novel isoprenol utilization pathway to promote the synthesis of β-carotene in Yarrowia lipolytica[J]. China Biotechnology, 2021, 41(04): 37-46. DOI: 10.13523 / j.cb.2012054.

[0086] Preparation Example 2

[0087] This preparation example adopts the method provided in Preparation Example 1 to prepare Yarrowia lipolytica YLA-1' competent cells, except that in step (1), Yarrowia lipolytica YLA-1' is used instead of Yarrowia lipolytica YLA-1, and other conditions are the same to construct Yarrowia lipolytica YLA-1' competent cells.

[0088] Among them, Yarrowia lipolytica YLA-1' includes a terpene synthase, α-farnesene synthase αFS (SEQ ID NO: 3), which also has the ability to synthesize terpene compounds. [2] The provided method is constructed.

[0089] [2]LIU YINGHANG,JIANG XIN,CUI ZHIYONG,et al.Engineering theoleaginous yeast Yarrowia lipolytica for production ofɑ-farnesene[J].Biotechnology for Biofuels,2019,12(1).DOI:10.1186 / s13068-019-1636-z.

[0090] Preparation Example 3

[0091] This preparation example adopts the method provided in Preparation Example 1 to prepare Yarrowia lipolytica YLA-1" competent cells, except that in step (1), Yarrowia lipolytica YLA-1" is used instead of Yarrowia lipolytica YLA-1, and other conditions are the same to construct Yarrowia lipolytica YLA-1" competent cells.

[0092] Among them, Yarrowia lipolytica YLA-1" includes a terpene synthase, a multifunctional carotene synthase carS (SEQ ID NO: 4), which also has the ability to synthesize terpene compounds. [3] The provided method is constructed.

[0093] [3]Shuliang G, Yangyang T, Li Z, et al. Production of β-carotene byexpressing a heterologous multifunctional carotene synthase in Yarrowialipolytica.[J]. Biotechnology letters, 2017, 39(6):921-927.

[0094] Example 1

[0095] This example is used to illustrate the construction of an engineered strain of Yarrowia lipolytica YLA-2 that overexpresses peroxisomes, specifically comprising:

[0096] 1. Construction of recombinant plasmid pHR_A08_PEX11-PEX5

[0097] (1) Obtaining the linearized pHR_A08 plasmid vector: Using the plasmid pHR_A08_hrGFP (Addgene, catalog number 84615) as a template, PCR amplification was performed using the primers PHR-A08-F / R shown in Table 1 to remove the GFP sequence to obtain the linearized pHR_A08 plasmid vector.

[0098] (2) Construction of TEF-PEX11-XPR2 expression cassette:

[0099] a. Using the genomic DNA of Yarrowia lipolytica Po1f as a template, PCR amplification was performed using the primers PEX11-F / R described in Table 1 to obtain the PEX11 gene (sequence as shown in SEQ ID NO: 9);

[0100] b. Using genomic DNA of Yarrowia lipolytica Po1f as a template, PCR amplification was performed using primers TEF-F1 and PEX11-KOZAK-TEF-R shown in Table 1 to obtain TEF promoter-1;

[0101] c. Using the genomic DNA of Yarrowia lipolytica Po1f as a template, PCR amplification was performed using primers PEX11-XPR2-F and XPR2-R1 shown in Table 1 to obtain XPR2 terminator-1;

[0102] d. Using the PEX11 gene, TEF promoter-1 and XPR2 terminator-1 as templates, overlapping PCR amplification was performed using primers TEF-F and PEX11-R shown in Table 1 to obtain the TEF-PEX11-XPR2 expression cassette.

[0103] (3) Construction of TEF-PEX5-XPR2 expression cassette:

[0104] a. Using genomic DNA of Yarrowia lipolytica Po1f as a template, PCR amplification was performed using primers PEX5-F / R shown in Table 1 to obtain the PEX5 gene (sequence as shown in SEQ ID NO: 16);

[0105] b. Using the genomic DNA of Yarrowia lipolytica Po1f as a template, PCR amplification was performed using primers TEF-F2 and PEX5-KOZAK-TEF-R shown in Table 1 to obtain TEF promoter-2;

[0106] c. Using the genomic DNA of Yarrowia lipolytica Po1f as a template, PCR amplification was performed using primers PEX5-XPR2-F and XPR2-R2 to obtain XPR2 terminator-2;

[0107] d. Using the PEX5 gene, TEF promoter-2 and XPR2 terminator-2 as templates, overlapping PCR amplification was performed using primers TEF-F2 and XPR2-R2 shown in Table 1 to obtain the TEF-PEX5-XPR2 expression cassette.

[0108] (4) Construction of PEX11-PEX5 expression cassette-1: Using the TEF-PEX11-XPR2 expression cassette and the TEF-PEX5-XPR2 expression cassette as templates, overlapping PCP amplification was performed using the primers TEF-F1 and XPR2-R2 shown in Table 1 to obtain the PEX11-PEX5 expression cassette-1.

[0109] (5) Construction of PEX11-PEX5 expression cassette-2: Using PEX11-PEX5 expression cassette-1 as a template, PCR amplification was performed using primers TEF-F2 and A08 HR-XPR2-R shown in Table 1 to obtain PEX11-PEX5 expression cassette-2.

[0110] (6) Assembly of recombinant plasmid pHR_A08_PEX11-PEX5: The linearized pHR_A08 plasmid vector and PEX11-PEX5 expression cassette-2 were assembled using the Vazyme assembly kit according to the instructions to obtain the following: Figure 1 The recombinant plasmid pHR_A08_PEX11-PEX5 is shown.

[0111] Table 1.

[0112]

[0113]

[0114]

[0115] 2. Construction of Yarrowia lipolytica engineered strain YLA-2

[0116] (1) Add 50 μL of the competent cell treatment solution provided in the preparation example, 0.5 μg of the recombinant plasmid pHR_A08_PEX11-PEX5, 0.5 μg of the plasmid pCRISPRyl_A08 (Addgene, catalog number 84610), 10 μL of 10 mg / mL ssDNA (Solaibo, catalog number D8050) and 500 μL of PEG / LiAc mixed solution into a centrifuge tube and mix gently; incubate in a 30°C water bath for 30 min, and rinse every 1 minute during the incubation process. 0min and gently mix; then add 20μL of DMSO, heat shock in a 42℃ water bath for 15min, and gently mix every 5min during the heat shock process; centrifuge at 12000rpm for 15s, remove the supernatant, resuspend the precipitate with 5mL of YPD medium, and culture at 30℃, 220rpm for 2h; at the end of the culture, aspirate 50μL of the bacteria and spread it on a SD-URA-LEU solid culture medium plate (Solebo, product number S0190), and culture at 30℃ for 2d to obtain recombinant cells.

[0117] (2) The randomly selected recombinant cells were used as templates to perform PCR verification using primers JD-F1 / JD-R1 shown in Table 2. A sequence of 11434 bp in length appeared, indicating that the recombinant cells were successfully constructed.

[0118] Table 2.

[0119] name SEQ ID NO: sequence Primer JD-F1 22 CGCGAAGCTATGTGGACCAAC Primer JD-R1 23 GATATTTCCCTCAACCGCAAGACC

[0120] (3) The bacteria with the correct band verified by PCR were inoculated into 5 mL of YPD-5FOA medium and cultured at 30° C. and 220 rpm for 1 day to obtain the Yarrowia lipolytica engineered strain YLA-2.

[0121] The YPD-5FOA culture medium includes: 10 g / L yeast extract, 20 g / L peptone, 2.5 g 5-FOA and 20 g / L glucose.

[0122] In this example, the PEX11 gene and the PEX5 gene were introduced into the Yarrowia lipolytica YLA-1, and the copy number of the above two genes in the cell was increased to adjust the expression level of the peroxisomal membrane protein PEX11 with a sequence as shown in SEQ ID NO:24 and the peroxisomal membrane protein PEX5 with a sequence as shown in SEQ ID NO:25, so that the Yarrowia lipolytica engineered strain YLA-2 finally obtained can overexpress the above two peroxisomal membrane proteins.

[0123] Example 2

[0124] This example is used to illustrate the construction of an astaxanthin-producing Yarrowia lipolytica engineered strain YLA-3, which specifically includes:

[0125] 1. Construction of recombinant plasmid pCFB-CrtZ-CrtW

[0126] (1) Obtaining the linearized pCFB6677 plasmid vector: Using plasmid pCFB6677 (Addgene, catalog number 106155) as a template, PCR amplification was performed using primers pCFB6677-F / R shown in Table 3 to obtain the linearized pCFB6677 plasmid vector.

[0127] (2) Using plasmid LYS-Leu2 (Addgene, catalog number 218114) as a template, PCR amplification was performed using primers LEU-F / R shown in Table 3 to obtain a leu-promoter-leu2 sequence (the sequence is shown in SEQ ID NO: 30).

[0128] (3) Construction of TEF-CrtZ-XPR2 expression cassette:

[0129] a. Using genomic DNA of Haematococcus pluvialis as a template, PCR amplification was performed using primers TEF-CrtZ-F and TEF-XPR2-R shown in Table 3 to obtain a fragment including the CrtZ gene (sequence as shown in SEQ ID NO: 33);

[0130] b. Using genomic DNA of Yarrowia lipolytica Po1f as a template, PCR amplification was performed using primers LEU-TEF-F and TEF-R shown in Table 3 to obtain TEF promoter-3;

[0131] c. Using the genomic DNA of Yarrowia lipolytica Po1f as a template, PCR amplification was performed using primers XPR2-F and XPR2-R3 shown in Table 3 to obtain XPR2 terminator-3;

[0132] d. Using the fragment including the CrtZ gene, TEF promoter-3 and XPR2 terminator-3 as templates, overlapping PCR amplification was performed using primers LEU-TEF-F and XPR2-R3 shown in Table 3 to obtain the TEF-CrtZ-XPR2 expression cassette.

[0133] (4) Construction of TEF-CrtW-XPR2 expression cassette:

[0134] a. Using the genomic DNA of Brevundimonas vesicularis as a template, PCR amplification was performed using primers TEF-CrtW-F and CrtW-XPR2-R shown in Table 3 to obtain a fragment including the CrtW gene (sequence as shown in SEQ ID NO: 40);

[0135] b. Using genomic DNA of Yarrowia lipolytica Po1f as a template, PCR amplification was performed using primers TEF-F3 and TEF-R shown in Table 3 to obtain TEF promoter-4;

[0136] c. Using the genomic DNA of Yarrowia lipolytica Po1f as a template, PCR amplification was performed using primers XPR2-F and IntE-XPR2-R shown in Table 3 to obtain XPR2 terminator-4;

[0137] d. Using the fragment of the CrtW gene, TEF promoter-4 and XPR2 terminator-4 as templates, overlapping PCR amplification was performed using primers TEF-F3 and IntE-XPR2-R shown in Table 3 to obtain the TEF-CrtW-XPR2 expression cassette.

[0138] (5) Assembly of recombinant plasmid pCFB-CrtZ-CrtW: The linearized pCFB6677 plasmid vector, leu-promoter-leu2 sequence, TEF-CrtZ-XPR2 expression cassette and TEF-CrtW-XPR2 expression cassette were assembled using the Vazyme assembly kit according to the instructions to obtain Figure 2 The recombinant plasmid pCFB-CrtZ-CrtW is shown.

[0139] Table 3.

[0140]

[0141]

[0142]

[0143] 2. Construction of recombinant plasmid pCRISPRyl_IntE

[0144] (1) Obtaining linearized pCRISPRyl IntE: Using pCRISPRyl D17 plasmid (Addgene, catalog number 84611) as a template, PCR amplification was performed using primers CRISPRyl_IntE-F / R shown in Table 4 to add the gRNA sequence at the selected position of IntE to obtain a linearized pCRISPRyl_IntE plasmid vector.

[0145] (2) The linearized pCRISPRyl_IntE plasmid vector was self-ligated to obtain the recombinant plasmid pCRISPRyl_IntE.

[0146] Table 4.

[0147]

[0148] 3. Construction of Yarrowia lipolytica engineered strain YLA-3

[0149] (1) Using the Yarrowia lipolytica engineered strain YLA-2 provided in Example 1 as a host cell, competent cells of the Yarrowia lipolytica engineered strain YLA-2 were prepared according to the method provided in the Preparation Example.

[0150] (2) Add 50 μL of Yarrowia lipolytica engineered strain YLA-2 competent cells, 0.5 μg of recombinant plasmid pCFB-CrtZ-CrtW, 0.5 μg of recombinant plasmid pCRISPRyl_IntE, 10 μL of ssDNA with a concentration of 10 mg / mL, and 500 μL of PEG / LiAc mixed solution into a centrifuge tube and mix gently; incubate in a 30°C water bath for 30 min, and mix gently every 10 min during the incubation process; then Add 20 μL of DMSO, heat shock in a 42°C water bath for 15 min, and gently mix every 5 min during the heat shock process; centrifuge at 12000 rpm for 15 s, remove the supernatant, resuspend the precipitate in 5 mL of YPD medium, and culture at 30°C and 220 rpm for 2 h; at the end of the culture, aspirate 50 μL of the bacteria and spread it on a SD-URA-LEU solid culture medium plate (Solebo, product number S0190), and culture at 30°C for 2 days to obtain recombinant cells.

[0151] (3) The randomly selected recombinant cells were used as templates to perform PCR verification using primers JD-F2 / JD-R2 shown in Table 5. A sequence of 6620 bp in length appeared, indicating that the recombinant cells were successfully constructed.

[0152] Table 5.

[0153] name SEQ ID NO: sequence Primer JD-F2 47 CCGGCGTTGTGTCCTTCTTTGC Primer JD-R2 48 CATGATTGGAGAGCGATGAAGTC

[0154] (4) The bacteria with the correct band verified by PCR were inoculated into 5 mL of YPD-5FOA medium and cultured at 30° C. and 220 rpm for 1 day to obtain the Yarrowia lipolytica engineered strain YLA-3.

[0155] In this example, by introducing the CrtZ gene and the CrtW gene into the Yarrowia lipolytica YLA-2, the obtained Yarrowia lipolytica engineered strain YLA-3 is able to express the β-carotene hydroxylase with a sequence as shown in SEQ ID NO:49 and the β-carotene ketolase with a sequence as shown in SEQ ID NO:50, thereby giving the Yarrowia lipolytica engineered strain YLA-3 the ability to synthesize astaxanthin.

[0156] Example 4

[0157] This example adopts the method provided in Example 1 to prepare the astaxanthin-producing Yarrowia lipolytica engineered strain YLA-2', except that, in step "3, construction of Yarrowia lipolytica engineered strain YLA-2", the competent cells of the Yarrowia lipolytica engineered strain YLA-1' provided in Preparation Example 2 are used instead of the competent cells of the Yarrowia lipolytica engineered strain YLA-1, and other conditions are the same to construct the Yarrowia lipolytica engineered strain YLA-2'.

[0158] Example 5

[0159] This example adopts the method provided in Example 2 to prepare the astaxanthin-producing Yarrowia lipolytica engineered strain YLA-3', except that, in step "3, construction of Yarrowia lipolytica engineered strain YLA-3", the competent cells of Yarrowia lipolytica engineered strain YLA-2' provided in Example 4 are used instead of the competent cells of Yarrowia lipolytica engineered strain YLA-2, and other conditions are the same to construct the Yarrowia lipolytica engineered strain YLA-3'.

[0160] Example 6

[0161] In this example, the method provided in Example 1 was used to prepare the astaxanthin-producing Yarrowia lipolytica engineering strain YLA-2", except that, in step "3, construction of Yarrowia lipolytica engineering strain YLA-2", the competent cells of the Yarrowia lipolytica engineering strain YLA-1 provided in Preparation Example 3 were used instead of the competent cells of the Yarrowia lipolytica engineering strain YLA-1, and other conditions were the same to construct the Yarrowia lipolytica engineering strain YLA-2.

[0162] Example 7

[0163] In this example, the method provided in Example 2 was used to prepare the astaxanthin-producing Yarrowia lipolytica engineering strain YLA-3", except that, in step "3, construction of Yarrowia lipolytica engineering strain YLA-3", the competent cells of Yarrowia lipolytica engineering strain YLA-2 provided in Example 6 were used instead of the competent cells of Yarrowia lipolytica engineering strain YLA-2, and other conditions were the same to construct the Yarrowia lipolytica engineering strain YLA-3.

[0164] Comparative Example 1

[0165] This comparative example uses the method provided in Example 2 to prepare astaxanthin-producing Yarrowia lipolytica engineered strain YLA-4, except that, in step "3, construction of Yarrowia lipolytica engineering strain YLA-3", Yarrowia lipolytica Po1f (Fenghui Bio, catalog number SC06660221) competent cells are used instead of Yarrowia lipolytica engineering strain YLA-2 competent cells, and other conditions are the same, to construct the Yarrowia lipolytica engineering strain YLA-4.

[0166] Comparative Example 2

[0167] This comparative example uses the method provided in Example 2 to prepare astaxanthin-producing Yarrowia lipolytica engineered strain YLA-5, except that, in step "3, construction of Yarrowia lipolytica engineered strain YLA-3", the competent cells of Yarrowia lipolytica engineered strain YLA-1 provided in Preparation Example 1 are used instead of the competent cells of Yarrowia lipolytica engineered strain YLA-2, and other conditions are the same to construct the Yarrowia lipolytica engineered strain YLA-5.

[0168] Test Case

[0169] This test example is used to illustrate the astaxanthin production capacity of the Yarrowia lipolytica engineered strains provided in the above embodiments and comparative examples. The test specifically includes:

[0170] 1. Astaxanthin production capacity test in 50mL shake flask

[0171] (1) Each frozen Yarrowia lipolytica engineered strain was inoculated into 10 mL of YPD medium and cultured at 30°C and 220 rpm. 600 =4, and the culture was terminated. The engineered strains of Yarrowia lipolytica obtained by culture were inoculated into 50 mL of YPD medium at an inoculum volume of 1% (v / v), and cultured and activated at 30°C and 220 rpm for 15 h to obtain seed solution.

[0172] (2) According to the inoculation amount of 1% (v / v), the seed liquid obtained after activation of each Yarrowia lipolytica engineered strain was inoculated into 50 mL of YPD medium, and cultured at 30°C and 220 rpm for 15 h. Then, 1 mL of the bacterial liquid was transferred to 50 mL of YPD medium, and fermented at 30°C and 220 rpm for 120 h to obtain a fermentation culture medium.

[0173] The YPD medium in steps (1) and (2) includes 20 g / L of peptone, 10 g / L of yeast powder and 20 g / L of glucose.

[0174] (3) Take 1 mL of each fermentation culture medium, centrifuge at 12000 rpm for 2 min, collect the bacteria, resuspend them in 1 mL of sterile water, and measure the OD of the solution. 600 value.

[0175] (4) Take 1 mL of each fermentation culture medium, centrifuge at 12000 rpm for 5 min, remove the supernatant, and collect the cells; wash the cells three times with ultrapure water; resuspend the cells with 500 μL of DMSO, oscillate in a constant temperature oscillator at 55°C for 30 min, then add 500 μL of acetone to mix, and oscillate in a constant temperature oscillator at 55°C for 15 min; centrifuge at 12000 rpm for 5 min, collect the supernatant, and obtain astaxanthin extract; repeat the above steps for multiple extractions until the cells turn from red to white, combine the astaxanthin extracts and use a 0.22 μm organic phase filter to filter and remove impurities, and use high performance liquid chromatography to determine the astaxanthin concentration in the filtrate to obtain the astaxanthin yield. The test results are shown in Table 8.

[0176] Among them, the conditions of the high performance liquid chromatography method include: the chromatographic column adopts a Zorbax SB-Aq type C18 reverse phase chromatographic column (250mm×4.6mm, 5μm; Agilent Technologies Inc, Santa Clara, CA); the elution method is isocratic elution, the volume ratio of acetonitrile:methanol:isopropanol:water is 9:6:4:1, the flow rate is 1mL / min, the detection wavelength is 450mm, the column temperature is 40°C, and the injection volume is 10μL; the absorbance of astaxanthin is detected at 450nm.

[0177] Table 8.

[0178]

[0179]

[0180] From the test results shown in Table 8, it can be seen that the Yarrowia lipolytica engineered strains YLA-1, YLA-1', YLA-1", YLA-2, YLA-2', YLA-2" and YLA-4 do not have the ability to synthesize astaxanthin; while the simultaneous introduction of the PEX11 gene, PEX5 gene, CrtZ gene and CrtW gene into the Yarrowia lipolytica engineered strains YLA-3, YLA-3' and YLA-3" enables the strains to utilize the intracellular overexpressed peroxisomal membrane proteins to synergistically enhance the biosynthesis process of astaxanthin, while increasing the cell's capacity for astaxanthin, effectively solving the adverse effects of large-scale synthesis and accumulation of astaxanthin on the growth and reproduction of strain cells, thereby giving the modified Yarrowia lipolytica engineered strains YLA-3, YLA-3' and YLA-3" excellent astaxanthin synthesis capabilities.

[0181] Moreover, compared with the Yarrowia lipolytica engineered strains YLA-3' and YLA-3", the PEX11-PEX5-CrtZ-CrtW gene axis introduced into the Yarrowia lipolytica engineered strain YLA-3 can better cooperate with the relevant expression system for synthesizing terpene compounds in the chassis cell YLA-1, so that the strain can utilize the peroxisomal membrane proteins overexpressed in the cell to synergistically enhance the biosynthesis process of astaxanthin, while increasing the cell's capacity for astaxanthin, effectively solving the adverse effects of large-scale synthesis and accumulation of astaxanthin on the growth and reproduction of strain cells, thereby giving the Yarrowia lipolytica engineered strain YLA-3 excellent astaxanthin synthesis ability, and the astaxanthin production is increased by 75% compared with the Yarrowia lipolytica engineered strain YLA-5 obtained by introducing the CrtZ gene and the CrtW gene separately.

[0182] 2. Astaxanthin production capacity test of 5L fermentation tank

[0183] (1) Inoculate each frozen Yarrowia lipolytica engineered strain into 10 mL of YPD medium and culture at 30°C and 220 rpm. 600 =4, and the culture was terminated. According to the inoculation amount of 1% (v / v), each Yarrowia lipolytica engineered strain was inoculated into 50 mL of YPD medium, and cultured and activated at 30°C and 220 rpm for 20 h to obtain the primary seed solution.

[0184] (2) According to the inoculation amount of 10% (v / v), each primary seed solution was inoculated into a 2 L baffled shake flask containing 400 mL of YPD medium, and cultured and activated at 30°C and 220 rpm for 20 h to obtain a secondary seed solution.

[0185] (3) According to the inoculation amount of 10% (v / v), each secondary seed liquid was inoculated into a 5 L fermentation tank containing 2.5 L of YPD medium for fermentation culture.

[0186] The fermentation conditions include: stirring speed of 800 rpm, temperature of 30°C, dissolved oxygen of 20% to 30%, fermentation time of 120 hours, and pH of 5.5 adjusted by 3M sodium hydroxide or 3M hydrochloric acid. After 6 hours of fermentation, 500 g / L glucose solution was added to the fermenter at a rate of 12 mL / h.

[0187] (4) The OD of each fermentation culture medium was measured using the method provided in "1. Astaxanthin production capacity test in 50 mL shake flask" 600 The test results are shown in Table 9.

[0188] Table 9.

[0189]

[0190]

[0191] From the test results shown in Table 9, it can be seen that the Yarrowia lipolytica engineered strains YLA-3, YLA-3' and YLA-3" have excellent astaxanthin synthesis capabilities, and the astaxanthin production is as high as 145 mg / L.

[0192] In addition, from the comparison of the test results shown in Tables 8 and 9, it can be seen that the Yarrowia lipolytica engineered strain YLA-3 showed a more obvious astaxanthin synthesis advantage in large-scale fermentation tank culture, and its astaxanthin production was increased by 107.14% compared with the Yarrowia lipolytica engineered strain YLA-5.

[0193] Although the embodiments of the present invention have been shown and described above, it is to be understood that the above embodiments are exemplary and are not to be construed as limitations on the present invention. A person skilled in the art may change, modify, replace and modify the above embodiments within the scope of the present invention without departing from the principles and intent of the present invention.

[0194] The sequences involved in the present invention are specifically shown in Table 10.

[0195] Table 10.

[0196]

[0197]

[0198]

[0199]

[0200]

[0201]

[0202]

[0203]

Claims

1. An engineered strain of Yarrowia lipolytica producing astaxanthin, characterized in that: The chassis cells of the Yarrowia lipolytica engineered strain are Yarrowia lipolytica producing terpene compounds, the Yarrowia lipolytica engineered strain overexpresses peroxisomal membrane protein PEX11 and peroxisomal targeting signal type I receptor PEX5, and the Yarrowia lipolytica engineered strain can simultaneously synthesize and express beta-carotene hydroxylase and beta-carotene ketolase.

2. The astaxanthin-producing Yarrowia lipolytica engineered strain according to claim 1, characterized in that: The peroxisomal membrane protein PEX11 includes an amino acid fragment as shown in SEQ ID NO: 24; Optionally, the peroxisome targeting signal type I receptor PEX5 comprises an amino acid fragment whose sequence is shown in SEQ ID NO:

25.

3. The astaxanthin-producing Yarrowia lipolytica engineered strain according to claim 1, characterized in that: The β-carotene hydroxylase comprises an amino acid fragment as shown in SEQ ID NO:49; Optionally, the β-carotene ketolase comprises an amino acid fragment having a sequence as shown in SEQ ID NO:

50.

4. The astaxanthin-producing Yarrowia lipolytica engineered strain according to claim 1, characterized in that: The terpene compound-producing Yarrowia lipolytica expresses terpene synthase; Optionally, the terpene synthase comprises one or more of phytoene dehydrogenase carB, lycopene cyclase and phytoene synthase bifunctional enzyme carPR, ɑ-farnesene synthase ɑFS, multifunctional carotene synthase carS, and limonene synthase; Optionally, the phytoopene dehydrogenase carB comprises an amino acid fragment as shown in SEQ ID NO: 1; Optionally, the lycopene cyclase and phytoene synthase bifunctional enzyme carPR comprises an amino acid fragment as shown in SEQ ID NO: 2; Optionally, the α-farnesene synthase αFS comprises an amino acid fragment as shown in SEQ ID NO: 3; Optionally, the multifunctional carotene synthase carS comprises an amino acid fragment whose sequence is shown in SEQ ID NO:

4.

5. The method for constructing an engineered strain of Yarrowia lipolytica producing astaxanthin according to any one of claims 1 to 4, characterized in that: The construction method comprises: Based on the PEX11 gene and the PEX5 gene, a PEX11-PEX5 expression cassette was constructed, and the PEX11-PEX5 gene expression cassette was recombined with plasmid vector I to obtain a recombinant plasmid PEX11-PEX5; Based on the CrtZ gene and the CrtW gene, the CrtZ expression cassette and the CrtW expression cassette were constructed, and the CrtZ expression cassette and the CrtW expression cassette were recombined with the plasmid vector II to obtain the recombinant plasmid CrtZ-CrtW; The recombinant plasmids PEX11-PEX5 and the recombinant plasmids CrtZ-CrtW are sequentially used to transform the Yarrowia lipolytica producing terpene compounds to obtain the Yarrowia lipolytica engineered strain.

6. The method for constructing an astaxanthin-producing Yarrowia lipolytica engineered strain according to claim 5, characterized in that: The PEX11 gene includes a nucleotide sequence as shown in SEQ ID NO:9; Optionally, the PEX5 gene comprises a nucleotide sequence as shown in SEQ ID NO: 16; Optionally, the PEX11-PEX5 expression cassette includes a TEF promoter, a PEX11 gene, an XPR2 terminator, a TEF promoter, a PEX5 gene and an XPR2 terminator sequentially connected along the 5' to 3' direction.

7. The method for constructing an engineered strain of Yarrowia lipolytica producing astaxanthin according to claim 5, characterized in that: The recombinant plasmid PEX11-PEX5 includes at least two groups of PEX11-PEX5 expression cassettes.

8. The method for constructing an engineered strain of Yarrowia lipolytica producing astaxanthin according to claim 5, characterized in that: The CrtZ gene includes a nucleotide sequence as shown in SEQ ID NO:33; Optionally, the CrtW gene comprises a nucleotide sequence as shown in SEQ ID NO:40; Optionally, the CrtZ expression cassette comprises a TEF promoter, a CrtZ gene and an XPR2 terminator sequentially connected along the 5' to 3' direction; Optionally, the CrtW expression cassette comprises a TEF promoter, a CrtW gene and an XPR2 terminator sequentially connected along the 5' to 3' direction; Optionally, the recombinant plasmid CrtZ-CrtW comprises a leu-promoter-leu2 sequence, a CrtZ expression cassette and a CrtW expression cassette sequentially connected along the 5' to 3' direction.

9. The method for constructing an astaxanthin-producing Yarrowia lipolytica engineered strain according to claim 4, characterized in that: The Yarrowia lipolytica engineered strain is also introduced with a helper plasmid, wherein the helper plasmid includes a gRNA sequence; Optionally, the gRNA sequence includes a nucleotide fragment as shown in SEQ ID NO:

46.

10. Use of the astaxanthin-producing Yarrowia lipolytica engineered strain according to any one of claims 1 to 4 in the field of astaxanthin preparation.

11. A method for preparing astaxanthin, characterized in that: The preparation method comprises: taking the astaxanthin-producing Yarrowia lipolytica engineered strain according to any one of claims 1 to 4 for fermentation culture to obtain the astaxanthin.

Images