A kind of Lactobacillus plantarum TY-M19 and application thereof

Abstract

The invention belongs to the technical field of microorganisms, and discloses a plant lactobacillus TY-M19 and an application thereof. The preservation number of the plant lactobacillus TY-M19 is CGMCC No. 28303. The plant lactobacillus TY-M19 has the function of significantly improving acute pancreatitis and related lung damage.

Description

Technical Field

[0001] The invention relates to the technical field of microorganisms, and in particular to a Lactobacillus plantarum TY-M19 and an application thereof. Background Art

[0002] Acute pancreatitis is an acute inflammatory disease, and its common causes include biliary system diseases, excessive drinking, hyperlipidemia, overeating, infection and trauma. The clinical manifestations of acute pancreatitis are mainly pancreatic interstitial edema, hemorrhage, vacuolar degeneration and necrosis of acinar cells and infiltration of inflammatory cells. The degree of lesions usually varies, and the outcome is unpredictable. When the clinical manifestations and biochemical changes of acute pancreatitis last for more than 48 hours, it is usually accompanied by persistent functional failure of one or more organs such as respiratory, heart or kidney, and cannot recover on its own, which is severe acute pancreatitis. Clinically, it has been found that in addition to the pancreas, the complications of severe acute pancreatitis also include damage to lung function, and the related lung damage caused by acute pancreatitis has a great impact on the prognosis of patients with severe acute pancreatitis, which is mainly manifested as respiratory distress and progressive dyspnea.

[0003] At present, the pathogenesis of acute pancreatitis-related lung injury is still not fully understood, but it is usually related to the following factors: the influence of pancreatic enzyme activation, the release of inflammatory mediators and toxic substances, excessive production of reactive oxygen and insufficient antioxidants; when acute pancreatitis occurs, it will promote the release of polymorphonuclear cells in the lungs, which can promote the production of arachidonic acid to produce thromboxanes, kinins and platelet-activating factor, damage the permeability of pulmonary capillaries, and cause ventilation / blood flow imbalance. Toxic substances and oxidants increase, such as protease, free radicals, etc. are released to directly damage lung tissue.

[0004] Some probiotics on the market have been proven to have good anti-inflammatory, antioxidant and free radical scavenging functions, and probiotics have no side effects and are highly safe. According to a domestic meta-analysis of some probiotics, probiotic intervention can improve the prognosis of patients with severe acute pancreatitis, reduce inflammation levels, and shorten the length of hospital stay. Although current probiotics can reduce inflammation levels, their effects on improving acute pancreatitis and related lung injury are still not ideal. Therefore, it is of certain clinical significance to explore a probiotic that can improve acute pancreatitis and related lung injury. Summary of the invention

[0005] The present invention is a strain of bacteria separated from women's breast milk, which is identified as Lactobacillus plantarum and can significantly improve acute pancreatitis and / or related lung damage.

[0006] In order to achieve the above object, the present invention can adopt the following technical solutions:

[0007] The present invention provides a Lactobacillus plantarum TY-M19, whose deposit number is CGMCC No.28303.

[0008] Preferably, the 16SrDNA sequence of the above-mentioned Lactobacillus plantarum TY-M19 comprises the sequence shown in SEQ ID NO.1.

[0009] Another aspect of the present invention provides a composition comprising the Lactobacillus plantarum TY-M19 of the present invention.

[0010] Preferably, the composition comprises one or more combinations of lysates, cultures or fermentations made from Lactobacillus plantarum TY-M19.

[0011] Preferably, the above composition further comprises one or more combinations of probiotics, prebiotics, dietary fiber and Chinese patent medicines.

[0012] In another aspect, the present invention provides a preparation comprising the above-mentioned composition of the present invention, and the preparation includes food, medicine or health care product.

[0013] Preferably, the above preparation is in the form of tablets, pills, capsules, powders, gels, granules or liquids.

[0014] In another aspect, the present invention provides a use of Lactobacillus plantarum TY-M19 of the present invention or the composition of the present invention in the preparation of a preparation for improving acute pancreatitis and / or related lung injury.

[0015] Preferably, the above application includes one or more combinations of the following:

[0016] (a) Use of Lactobacillus plantarum TY-M19 or a composition in the preparation of a preparation for inhibiting amylase activity and lipase activity in serum;

[0017] (b) Use of Lactobacillus plantarum TY-M19 or the composition in the preparation of a preparation for improving pathological damage of acute pancreatitis;

[0018] (c) Use of Lactobacillus plantarum TY-M19 or the composition in the preparation of a preparation for inhibiting the expression level of inflammatory factors in pancreatic tissue;

[0019] (d) Use of Lactobacillus plantarum TY-M19 or the composition in the preparation of a preparation for reducing the oxidative stress level of lung tissue.

[0020] Preferably, in the above application,

[0021] Application (b) includes: application of Lactobacillus plantarum TY-M19 or the composition in the preparation of a preparation for relieving pancreatic tissue edema and inflammatory exudation;

[0022] In application (c), the inflammatory factors include one or more combinations of TNF-α, IL-6 or IL-1β;

[0023] Application (d) includes: application of Lactobacillus plantarum TY-M19 or the combination in the preparation of a preparation for restoring the MDA content and SOD activity in lung tissue.

[0024] The preservation information of Lactobacillus plantarum TY-M19 in the present invention is as follows:

[0025] Depository: China General Microbiology Center (CGMCC);

[0026] Address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing;

[0027] Deposit date: August 31, 2023;

[0028] Deposit number: CGMCC No.28303;

[0029] Classification name: Lactobacillus plantarum. The beneficial effects of the present invention include at least:

[0030] (1) The Lactobacillus plantarum TY-M19 provided by the present invention can inhibit the activity of amylase and lipase in serum, and effectively improve the condition of acute pancreatitis.

[0031] (2) The Lactobacillus plantarum TY-M19 provided by the present invention can reduce pathological damage to the pancreas, relieve pancreatic tissue edema and inflammatory exudation, and restore the structure of pancreatic tissue and lung tissue.

[0032] (3) The Lactobacillus plantarum TY-M19 provided by the present invention can reduce the levels of inflammatory factors TNF-α, IL-1β and IL-6 in pancreatic tissue and alleviate the inflammatory response of acute pancreatitis.

[0033] (4) The plant lactobacillus TY-M19 provided by the present invention can increase the activity of SOD with antioxidant function in lung tissue, reduce the content of lipid peroxide MDA, and alleviate the level of oxidative stress associated with lung tissue in acute pancreatitis. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 This is the colony morphology of Lactobacillus plantarum TY-M19.

[0035] Figure 2 This is the Gram staining result of Lactobacillus plantarum TY-M19.

[0036] Figure 3 This is the effect of Lactobacillus plantarum TY-M19 on the body weight of mice.

[0037] Figure 4 This is the effect of Lactobacillus plantarum TY-M19 on the food intake of mice.

[0038] Figure 5 This is the effect of Lactobacillus plantarum TY-M19 on the water intake of mice.

[0039] Figure 6 This is the effect of Lactobacillus plantarum TY-M19 on the activity of serum amylase in mice.

[0040] Figure 7 This is the effect of Lactobacillus plantarum TY-M19 on the activity of serum lipase in mice.

[0041] Figure 8 This is the effect of Lactobacillus plantarum TY-M19 on pancreatic tissue of mice.

[0042] Fig. 9 This is the pathological score of pancreatic tissue in mice infected with Lactobacillus plantarum TY-M19.

[0043] Fig.10 This is the effect of Lactobacillus plantarum TY-M19 on the TNF-α content in pancreatic tissue of mice.

[0044] Fig.11 This is the effect of Lactobacillus plantarum TY-M19 on the IL-6 content in mouse pancreatic tissue.

[0045] Fig.12 This is the effect of Lactobacillus plantarum TY-M19 on the IL-1β content in mouse pancreatic tissue.

[0046] Fig.13 This is the effect of Lactobacillus plantarum TY-M19 on lung tissue edema in mice.

[0047] Fig.14 This is the effect of Lactobacillus plantarum TY-M19 on mouse lung tissue.

[0048] Fig.15 This is the pathological score of the lung tissue of mice infected with Lactobacillus plantarum TY-M19.

[0049] Fig.16 This is the effect of Lactobacillus plantarum TY-M19 on the TNF-α content in mouse lung tissue.

[0050] Fig.17 This is the effect of Lactobacillus plantarum TY-M19 on the IL-6 content in mouse lung tissue.

[0051] Fig.18 This is the effect of Lactobacillus plantarum TY-M19 on the MPO content in mouse lung tissue.

[0052] Fig.19This is the effect of Lactobacillus plantarum TY-M19 on the SOD activity of mouse lung tissue.

[0053] Fig. 20 This is the effect of Lactobacillus plantarum TY-M19 on the MDA content in mouse lung tissue.

[0054] In the above figure, "*" represents the statistical difference between the two groups P<0.05, "**" represents the statistical difference between the two groups P<0.01, "***" represents the statistical difference between the two groups P<0.001, and "****" represents the statistical difference between the two groups P<0.0001. DETAILED DESCRIPTION

[0055] The examples are provided to better illustrate the present invention, but the present invention is not limited to the examples. Therefore, those skilled in the art may make non-essential improvements and adjustments to the implementation scheme according to the above invention content, which still fall within the protection scope of the present invention.

[0056] The terms used herein are only used to describe specific embodiments and are not intended to limit the present disclosure. Unless the context has a significantly different meaning, expressions in the singular include expressions in the plural. As used herein, it should be understood that terms such as "include", "have", "include" are intended to indicate the presence of features, numbers, operations, components, parts, elements, materials or combinations. The terms of the present invention are disclosed in the specification, and are not intended to exclude the possibility that one or more other features, numbers, operations, components, parts, elements, materials or combinations thereof may exist or may be added. As used herein, " / " may be interpreted as "and" or "or", depending on the circumstances.

[0057] The Latin name of "Lactobacillus plantarum" in the present invention is the old Latin name of Lactobacillus plantarum, and its new Latin name is "Lactiplantibacillus plantarum". The "Lactobacillus plantarum" in the present invention is also called "Lactobacillus plantarum TY-M19" or "TY-M19".

[0058] The embodiment of the present invention provides a Lactobacillus plantarum TY-M19, which is deposited in the General Microbiological Center of China National Microbiological Culture Collection Administration with a deposit number of CGMCC No.28303.

[0059] It should be noted that the above-mentioned Lactobacillus plantarum TY-M19 is derived from the breast milk of healthy women in Yubei, Chongqing, has no side effects, and is rod-shaped as determined by Gram staining results, and is a Gram-positive bacterium (G+ ); and amplifying the 16SrDNA sequence by PCR, and measuring that the 16SrDNA sequence contains the sequence shown in SEQ ID NO.1, and performing homology analysis, the strain is Lactobacillus plantarum.

[0060] In addition, the plant lactobacillus TY-M19 of the present invention has strong gastric juice tolerance and bile salt tolerance, with a survival rate in gastric juice of 108.35% and a growth efficiency in bile salt of 31.86%, which indicates that it has good digestive tract resistance in the body.

[0061] The embodiment of the present invention also provides a composition comprising the Lactobacillus plantarum TY-M19 of the present invention.

[0062] It should be noted that, in order to improve the application effect of Lactobacillus plantarum TY-M19, Lactobacillus plantarum TY-M19 can be applied in the form of a composition.

[0063] In some embodiments, the composition comprises one or more combinations of lysates, cultures or fermentations made from Lactobacillus plantarum TY-M19.

[0064] It should be noted that in the above-mentioned composition, plant lactobacillus TY-M19 has good digestive tract resistance in the body, and can be prepared into a composition that can be used for food, medicine or health products. The form of the above-mentioned composition can be a lysate, culture or fermentation product comprising plant lactobacillus TY-M19, wherein the lysate refers to the destruction of bacterial cell walls by physical or chemical methods to release intracellular substances; the culture refers to the microbial colony (including products such as proteins, peptides, secretions or metabolites obtained by culture) obtained by culture and breeding under artificially specified conditions; the fermentation product refers to the various substances produced by the fermentation process using plant lactobacillus TY-M19 under suitable culture conditions. In the specific use process, the different forms of the bacteria can be selected according to specific needs to be prepared into a composition to play a role.

[0065] In some embodiments, the above composition further comprises one or more combinations of probiotics, prebiotics, dietary fiber and Chinese patent medicine.

[0066] It should be noted that the above-mentioned Lactobacillus plantarum TY-M19 and its different forms can also be used in combination with one or more of probiotics, dietary fiber and pharmaceutically active compounds; for example, Lactobacillus plantarum TY-M19 can be used in combination with Bacillus subtilis, Bifidobacterium or lactic acid bacteria so that the composition has the efficacy of Lactobacillus plantarum TY-M19 and other probiotics; for another example, Lactobacillus plantarum TY-M19 can be used in combination with prebiotics, which can provide an energy source for Lactobacillus plantarum TY-M19 and improve the effect of Lactobacillus plantarum TY-M19; for another example, Lactobacillus plantarum TY-M19 can be used in combination with dietary fiber, which can assist Lactobacillus plantarum TY-M19 in colonization, thereby improving the effect of Lactobacillus plantarum TY-M19; for another example, Lactobacillus plantarum TY-M19 can also be used in combination with Chinese patent medicines to form a composition, while exerting the effects of Lactobacillus plantarum TY-M19 and Chinese patent medicines.

[0067] An embodiment of the present invention further provides a preparation comprising the composition of the present invention, and the preparation is a food, a medicine or a health product.

[0068] It should be noted that food, medicine or health products are products known in the art, and may need to be selected according to dosage form, such as being prepared into probiotic beverages, dairy beverages (such as yogurt), or may be prepared into foods such as probiotic biscuits and probiotic powders; Of course, it is also possible to prepare medicines with therapeutic effects with pharmaceutical excipients; Similarly, it is possible to prepare health products with certain health functions, and specifically it is possible to prepare according to the effect achieved as needed. During actual preparation, the above-mentioned composition comprising plant lactobacillus TY-M19 and its different forms may be added to food, medicine or health products.

[0069] In some specific embodiments, the dosage form of the preparation is tablets, pills, capsules, powders, gels, granules or liquids. It should be noted that the solid dosage forms such as tablets, pills, granules or capsules can be in the form of products such as probiotic tablets, probiotic sugar pills, probiotic powders or probiotic capsules; the liquid can be in the form of products such as probiotic beverages; the gel can be in the form of products such as probiotic jelly, probiotic milk caps or solidified yogurt. The specific form of the preparation is a form known in the art, and there are differences in the excipients added to different dosage forms. For example, the preparation of tablets mainly uses diluents (such as starch, dextrin, sucrose or mannose, etc.), absorbents (calcium sulfate, calcium hydrogen phosphate or light magnesium oxide, etc.), binders (polyvidone, syrup or hydroxypropyl methylcellulose, etc.), wetting agents (water, etc.) or disintegrants (dry starch, sodium hydroxymethyl starch or cross-linked polyvidone, etc.); for example, the preparation of liquids mainly uses solubilizers, suspending agents, emulsifiers or colorants, etc. Different types of agents can be added as known in the art.

[0070] In some specific examples, the above-mentioned preparation can be an inactivated bacterial agent or a microecological bacterial agent.

[0071] It should be noted that the above-mentioned preparations can be preparations prepared from inactivated bacteria agents, or can be microecological preparations prepared from live bacteria. The specific dosage form can be selected according to specific needs, and the preparation method can be selected by those known in the art.

[0072] The embodiments of the present invention also provide a use of Lactobacillus plantarum TY-M19 of the present invention or the composition of the present invention in the preparation of a preparation for improving acute pancreatitis and / or related lung injury.

[0073] It should be noted that the plant lactobacillus TY-M19 in the present invention or the composition in the present invention can be used in the preparation of a preparation, and the preparation can be a food, a medicine or a health product; it should be understood that the plant lactobacillus TY-M19 in the present invention, as a probiotic, has the properties of a functional food, a therapeutic drug and a health product. When it plays the functional role of a food, the above-mentioned preparation is a food, when it plays a therapeutic role, the above-mentioned preparation is a medicine, and when it plays a health care role, the above-mentioned preparation is a health product.

[0074] It should also be noted that, as mentioned above, the above-mentioned preparations can be powders, tablets, liquid dosage forms, granules or capsule dosage forms, etc., and the excipients added to different dosage forms are different and can be added according to what is known in the art.

[0075] In some specific examples, the above application includes one or more combinations of the following applications:

[0076] (a) Use of Lactobacillus plantarum TY-M19 or a composition in the preparation of a preparation for inhibiting amylase activity and lipase activity in serum;

[0077] (b) Use of Lactobacillus plantarum TY-M19 or the composition in the preparation of a preparation for improving pathological damage of acute pancreatitis;

[0078] (c) Use of Lactobacillus plantarum TY-M19 or the composition in the preparation of a preparation for inhibiting the expression level of inflammatory factors in pancreatic tissue;

[0079] (d) Use of Lactobacillus plantarum TY-M19 or the composition in the preparation of a preparation for reducing the oxidative stress level of lung tissue.

[0080] It should be noted that TY-M19 in the present invention can significantly improve pancreatic damage and lung damage in mice with acute pancreatitis, restore the pancreatic tissue and lung tissue structure of mice, reduce the levels of inflammatory factors TNF-α, IL-1β and IL-6 in pancreatic tissue, reduce lung tissue edema, reduce the levels of TNF-α, IL-6 and MPO in lung tissue, significantly increase the activity of SOD with antioxidant function in lung tissue, and reduce the content of lipid peroxide MDA. Therefore, Lactobacillus plantarum TY-M19 can enhance the antioxidant capacity of mice, relieve the oxidative stress of the body and reduce the inflammatory response of the body to achieve the purpose of improving pancreatic damage and lung damage in mice with acute pancreatitis, and provide potential intervention measures for the prevention and treatment of acute pancreatitis and related lung damage.

[0081] In some specific examples, in the above applications,

[0082] Application (b) includes: application of Lactobacillus plantarum TY-M19 or the composition in the preparation of a preparation for relieving pancreatic tissue edema and inflammatory exudate; specifically, the above-mentioned improvement of acute pancreatitis pathological damage mainly includes the preparation of a preparation for relieving pancreatic tissue edema and inflammatory exudate;

[0083] In application (c), the inflammatory factors include one or more combinations of TNF-α, IL-6 or IL-1β;

[0084] Application (d) includes: application of Lactobacillus plantarum TY-M19 or a composition in the preparation of a preparation for restoring the MDA content and SOD activity in lung tissue; specifically, the above-mentioned reduction of the oxidative stress level of lung tissue mainly includes the preparation of a preparation for restoring the MDA content and SOD activity in lung tissue.

[0085] In order to better understand the present invention, the content of the present invention is further explained below in conjunction with specific examples, but the content of the present invention is not limited to the following examples.

[0086] 1. Isolation, purification and identification of Lactobacillus plantarum TY-M19

[0087] 1. Experimental Materials

[0088] Lactobacillus plantarum TY-M19 is derived from the breast milk of healthy women in Yubei District, Chongqing, and is deposited in the General Microbiology Center of China Culture Collection Administration, with the deposit number being CGMCC No.28303.

[0089] Collection method: Collect breast milk in a sterile screw-cap centrifuge tube, tighten the cap, and then refrigerate and transport it back to the laboratory.

[0090] (II) Isolation and purification of Lactobacillus plantarum TY-M19

[0091] The retrieved samples were diluted 10-fold to obtain concentrations of 10-1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 , 10 -6 and 10 -7 diluent; add 200 μL of appropriate dilution (10 -3 , 10 -4 , 10 -5 and 10 -6 ) was spread on MRS solid medium and inverted at 37°C for 48h. After the incubation, the colony morphology on the MRS plate was observed, and single colonies with different morphologies were selected to separate the strains by plate streaking method. The above steps were repeated until the purified strains were obtained. The colony morphology was observed and morphological observation was performed by Gram staining.

[0092] The colony morphology of the purified strains was as follows Figure 1 As shown, through Figure 1 It can be seen that the colonies have consistent morphology, smooth and moist surface, medium size, flat edges, hemispherical shape, and milky white color.

[0093] The cell morphology of the purified strain after Gram staining is as follows Figure 2 As shown ( Figure 2 The purple cells were observed under a microscope and were rod-shaped, which was consistent with the characteristics of lactobacilli and was determined to be Gram-positive bacteria (G + ).

[0094] (III) PCR amplification of 16S rDNA sequence

[0095] A 25 μL reaction system was used for PCR amplification: 1 μL template, 1 μL upstream primer (10 μM), 1 μL downstream primer (10 μM), 12.5 μL 2×Taq PCR Master Mix, and the mixture was made up to 25 μL with sterile ultrapure water.

[0096] The primer sequences are: upstream primer AGAGTTTGATCCTGGCTCAG (SEQ ID NO. 2), downstream primer TACGACTTAACCCCAATCGC (SEQ ID NO. 3).

[0097] PCR amplification conditions: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 1 min, for a total of 35 cycles; terminal extension at 72°C for 10 min.

[0098] After sequence amplification, the qualified PCR amplification products were sequenced by Sangon Biotech (Shanghai) Co., Ltd., and the sequence was shown in SEQ ID No. 1. BLAST (http: / / www.ncbi.nlm.nih.gov / BLAST) was used to search and compare similarities in GeneBank, and the results showed that the strain of the present invention was Lactobacillus plantarum.

[0099] 2. Determination of gastrointestinal fluid tolerance of Lactobacillus plantarum TY-M19

[0100] 1. Experimental Materials

[0101] Lactobacillus plantarum TY-M19 is derived from the breast milk of healthy women in Yubei District, Chongqing, and is deposited in the General Microbiology Center of China Culture Collection Administration, with the deposit number being CGMCC No.28303.

[0102] (II) Determination of tolerance of Lactobacillus plantarum TY-M19 to pH 3.0 artificial gastric juice

[0103] Take 10 ml of the activated strain culture medium, centrifuge at 4000 r / min for 10 min to collect the bacterial precipitate, and resuspend it in an equal volume of sterile saline to make a bacterial suspension; take 1 ml of the bacterial suspension and mix it with 9 ml of artificial gastric juice (0.2% NaCl, 0.35% pepsin 1:10000, adjust pH = 3 with 1 mol / L HCl, filter and sterilize for later use), shake well, place in a constant temperature oscillator at 37°C, 100 r / min and culture for 3 h, and take samples at 0 h and 3 h, respectively, and determine the number of viable bacteria by the pour plate method.

[0104]

[0105] Before probiotics enter the human intestine to exert their functions, they must first pass through the stomach (generally, the pH value of gastric juice is around 3.0) and stay there for about 3 hours. The highly acidic stomach environment is not conducive to the survival of probiotics. Therefore, the viability of probiotics in simulated gastric juice is crucial. The above experimental results show that the survival rate of Lactobacillus plantarum TY-M19 is 108.35% under acidic conditions of pH=3.0 for 3 hours, which has very strong viability.

[0106] (III) Determination of tolerance of Lactobacillus plantarum TY-M19 to 0.3% bile salts

[0107] Take the activated strain culture fluid and inoculate it into MRS-THIO medium (MRS liquid medium with 0.2% sodium thioglycolate) containing 0.0% and 0.3% pig bile salts at a 2% inoculation rate. After mixing, place it in a constant temperature oscillator at 37°C and 100r / min for 24h, and calculate its growth efficiency.

[0108]

[0109] Probiotics that survive the stomach will come into contact with bile salts in the small intestine. The mass concentration of bile salts in the human body fluctuates between 0.03% and 0.3%. The above experimental results show that the growth efficiency of Lactobacillus plantarum TY-M19 in bile salts with a concentration of 0.3% is 31.86%, which shows good bile salt tolerance.

[0110] III. Improvement of acute pancreatitis and related lung injury by Lactobacillus plantarum TY-M19

[0111] 1. Experimental Materials

[0112] Lactobacillus plantarum TY-M19: isolated from the breast milk of healthy women in Yubei District, Chongqing, and deposited in the General Microbiology Center of China Culture Collection Administration, with the deposit number CGMCC No.28303.

[0113] Mouse model: 30 C57BL / 6 male mice (20g-25g) aged 6-8 weeks were selected and all mice were housed in standardized cages, with 5 mice in each cage. The temperature was constant (23±3℃), the humidity was constant (35±5﹪), and the lighting cycle was 12 hours (lights on at 8:00 in the morning and off at 20:00 in the evening). The experiment began after one week of adaptive feeding, with free access to food and water, and under the care of a dedicated person.

[0114] Grouping: After the adaptation period, the three groups of mice were named: Control group (blank control group), Caerulein group (caerulein group) and Lactobacillus plantarum TY-M19 group (probiotic group).

[0115] Experiment: Lactobacillus plantarum TY-M19 group was intragastrically administered with 1.0×10 9 CFU / kg of plant lactobacillus TY-M19 bacterial suspension, and the control group and Caerulein group were gavaged with an equal amount of normal saline. On the 29th day, the three groups of mice were fasted for 16 hours before modeling, and the plant lactobacillus TY-M19 group and Caerulein group were gavaged with TY-M20 bacterial suspension and normal saline, respectively. One hour later, a caerulein solution (purchased from Tocris Bioscience) was intraperitoneally injected, 50ug / kg body weight per injection, once an hour, for a total of 8 times; the control group was given an equal amount of normal saline. The mice were sacrificed 1 hour after the last injection according to the above method.

[0116] Mouse sample collection and processing: After sacrificing mice, the eyeballs were removed to collect blood, which was kept at 4°C for 1 hour and centrifuged at 3000r / min for 15 minutes to collect the upper serum; at the same time, the mouse pancreas and lung tissues were collected.

[0117] (II) Monitoring of mouse growth performance

[0118] The weight, food intake and water intake of mice can reflect their growth and health status to a certain extent. Initially, the weight of mice in each group was basically the same, with no significant difference (P>0.05). The weight, food intake and water intake of mice were recorded every other day during the experiment. The results recorded after the experiment are as follows: Figure 3 , Figure 4 and Figure 5 shown.

[0119] According to Figure 3 It can be seen that after 28 consecutive days of intervention with Lactobacillus plantarum TY-M19, the weight of mice in each group increased to a certain extent, but there was no significant difference in weight gain (P>0.05).

[0120] according to Figure 4 and Figure 5 It can be seen that there was no significant difference in the changes in food intake and water intake of mice in each group (P>0.05). The results showed that the intervention of Lactobacillus plantarum TY-M19 did not interfere with the daily life and growth and development of mice, indicating that it had no side effects.

[0121] (III) Determination of the activity of mouse serum amylase and lipase

[0122] When diagnosing acute pancreatitis, clinicians mainly rely on the activity of amylase and lipase in serum. This method has been used in clinical practice for many years. In order to determine the activity of amylase and lipase in mouse serum, the amylase and lipase kits (purchased from Nanjing Jiancheng Bioengineering Institute) were used. The test results were as follows: Figure 6 and Figure 7 shown.

[0123] according to Figure 6 and Figure 7 It can be seen that the increase of serum amylase activity (P<0.0001) and lipase activity (P<0.0001) in mice pretreated with Lactobacillus plantarum TY-M19 was significantly inhibited. This result shows that Lactobacillus plantarum TY-M19 can effectively improve the condition of acute pancreatitis.

[0124] (IV) Pathological histological observation of mouse pancreatic tissue

[0125] After the paraffin sections of pancreatic tissue were stained with hematoxylin-eosin, the morphological changes of pancreatic tissue were observed and pathological scores were performed. The specific criteria were to perform pathological scores on pancreatic tissue according to the severity of four items: hemorrhage, edema, necrosis, and inflammation (each item was scored 0 to 4 points according to the severity). The specific results are as follows: Figure 8 and Fig. 9 shown.

[0126] according to Figure 8 and Fig. 9 It can be seen that the interstitial space of pancreatic tissue lobes of mice in the Control group was evenly distributed and tight, without edema and inflammatory exudation. In the Caerulein group, the interstitial space of pancreatic acinar cells of mice was dilated, leukocyte infiltration was found in the lobules or around blood vessels, and the edema and inflammation levels were more severe than those in the Control group. Pretreatment with Lactobacillus plantarum TY-M19 can alleviate the pathological damage of the pancreas in mice to varying degrees, and the edema and inflammatory exudation of pancreatic tissue were significantly alleviated. The quantitative scoring results showed that the histological score of pancreatic sections of mice in the Lactobacillus plantarum TY-M19 group was significantly higher than that in the Caerulein group (P < 0.001). This result shows that Lactobacillus plantarum TY-M19 can alleviate the pathological damage of acute pancreatitis.

[0127] (V) Determination of inflammatory factor levels in mouse pancreatic tissue

[0128] The expression levels of inflammatory factors tumor necrosis factor-α (TNF-α), interleukin-6 (IL-6), and interleukin-1β (IL-1β) in mouse pancreatic tissue were detected by enzyme-linked immunosorbent assay according to the relevant operating instructions of the corresponding ELISA kit (purchased from Shanghai ELISA Biotechnology Co., Ltd.). The test results are as follows: Fig.10 , Fig.11 and Fig.12 shown.

[0129] according to Fig.10 , Fig.11 and Fig.12 It can be seen that compared with the Control group, the levels of TNF-α (P<0.0001), IL-6 (P<0.0001) and IL-1β (P<0.0001) in the pancreatic tissue of mice treated with Caerulein were significantly increased, indicating that the inflammatory response was severe; the levels of TNF-α (P<0.0001), IL-6 (P<0.0001) and IL-1β (P<0.0001) in the pancreatic tissue of mice pretreated with TY-M20 were significantly reduced. This result shows that Lactobacillus plantarum TY-M19 can alleviate the inflammatory response of acute pancreatitis.

[0130] (VI) Determination of the degree of edema in mouse lung tissue

[0131] The degree of pulmonary edema can directly reflect the degree of increased pulmonary vascular permeability, and further reflect the degree of damage to the pulmonary gas-blood barrier. Take a fixed part of the left upper lobe of the mouse lung, wash it with saline, use filter paper to absorb the surface moisture of the lung tissue, weigh the wet weight of the lung, record the data, and bake it in a 60°C oven for 24 hours until its weight no longer changes, and then weigh the dry weight of the lung. The wet / dry weight ratio of lung tissue is a clear indicator for measuring lung tissue edema. Therefore, the wet / dry weight ratio of lung tissue of each group of mice can indirectly reflect the damage of lung tissue. The calculation method is as follows:

[0132]

[0133] The results are as follows Fig.13 As shown, according to Fig.13 It can be seen that compared with the Control group, the wet / dry weight ratio of lung tissue in the Caerulein group was significantly increased. Compared with the Caerulein group, the wet / dry weight ratio of lung tissue in the Lactobacillus plantarum TY-M19 group was significantly reduced. This result shows that the intervention of Lactobacillus plantarum TY-M19 can greatly alleviate the edema of lung tissue caused by acute pancreatitis.

[0134] 7. Pathological histological observation of mouse lung tissue

[0135] In order to evaluate the severity of pathological changes in the mouse lung tissue, HE staining was used to reflect the damage of the lung tissue and pathological scoring was performed. The specific criteria were based on the severity of edema, hemorrhage and leukocyte infiltration (each item was scored 0 to 3 points according to the severity). The results are shown in Figure 2. Fig.14 and Fig.15 shown.

[0136] according to Fig.14 and Fig.15 It can be seen that HE staining of the lung tissue of mice in the Caerulein group showed severe damage to the alveolar structure, a large number of neutrophil infiltration, and congestion of alveolar septal capillaries, indicating that there was lung tissue damage in the acute pancreatitis model induced by Caerulein, while the lung damage in the Lactobacillus plantarum TY-M19 group was significantly improved. The quantitative scoring results showed that the histological score of the lung sections of mice in the Lactobacillus plantarum TY-M19 group was significantly higher than that in the Caerulein group (P < 0.01). This result shows that pretreatment with Lactobacillus plantarum TY-M19 can reduce lung tissue damage in mice with acute pancreatitis.

[0137] (VIII) Determination of inflammatory factor levels in mouse lung tissue

[0138] Serum myeloperoxidase (MPO) activity is a marker of neutrophil infiltration, and an increase in the level of MPO in tissues indicates an inflammatory response in the tissues. In addition, TNF-α and IL-6 also represent the inflammatory response of the tissues. The present embodiment uses enzyme-linked immunosorbent assay to detect the levels of inflammatory factors TNF-α, IL-6 and MPO in mouse lung tissues according to the relevant operating instructions of the corresponding ELISA kit (purchased from Shanghai ELISA Biotechnology Co., Ltd.). The specific results are as follows: Fig.16 , Fig.17 and Fig.18 shown.

[0139] according to Fig.16 , Fig.17 and Fig.18 It can be seen that compared with the Caerulein group, the levels of TNF-α (P<0.0001), IL-6 (P<0.01) and MPO (P<0.001) in the lung tissue of mice in the Lactobacillus plantarum TY-M19 group were significantly reduced. This result shows that Lactobacillus plantarum TY-M19 can reduce the inflammatory response of lung tissue in mice with acute pancreatitis.

[0140] 9. Determination of oxidative indexes in mouse lung tissue

[0141] Superoxide dismutase (SOD) is an endogenous free radical scavenger, and malondialdehyde (MDA) is a product of peroxidation. Both reflect the level of oxidative stress in the body. The MDA content and SOD activity in the lung tissue of mice were measured using kits (both purchased from Nanjing Jiancheng Bioengineering Institute). The experimental results are as follows: Fig.19 and Fig. 20 shown.

[0142] according to Fig.19 and Fig. 20 It can be seen that compared with the Control group, the SOD activity (P<0.0001) of the mice in the Caerulein group was significantly reduced, and the MDA content was significantly increased (P<0.0001); after the intervention of Lactobacillus plantarum TY-M19, the SOD activity (P<0.0001) and MDA content (P<0.0001) of the mice were able to return to normal levels. This result shows that Lactobacillus plantarum TY-M19 has the effect of reducing the level of oxidative stress associated with lung tissue in acute pancreatitis.

[0143] In summary, plant lactobacillus TY-M19 in the present invention has good gastrointestinal fluid tolerance. Plant lactobacillus TY-M19 can significantly improve acute pancreatitis mouse pancreatic injury and lung injury, restore mouse pancreatic tissue and lung tissue structure, reduce the level of inflammatory factors TNF-α, IL-1β and IL-6 in pancreatic tissue, reduce lung tissue edema, alleviate the level of lung tissue TNF-α, IL-6 and MPO, significantly increase the SOD activity with antioxidant function in lung tissue, reduce lipid peroxide MDA content, and restore both to normal levels. Therefore, fermentation lactobacillus plant lactobacillus TY-M19 can enhance mouse antioxidant capacity, alleviate body oxidative stress and reduce body's inflammatory response to work in coordination, reach the purpose of improving acute pancreatitis mouse pancreatic injury and lung injury, for acute pancreatitis and related lung injury prevention and treatment provide potential intervention measures.

[0144] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solution of the present invention can be modified or replaced by equivalents without departing from the purpose and scope of the technical solution of the present invention, which should be covered by the scope of the claims of the present invention.

Claims

1. A Lactobacillus plantarum TY-M19, whose deposit number is CGMCC No.28303.

2. The Lactobacillus plantarum TY-M19 according to claim 1, characterized in that The 16SrDNA sequence of Lactobacillus plantarum TY-M19 includes the sequence shown in SEQ ID NO.

1.

3. A composition comprising the Lactobacillus plantarum TY-M19 according to claim 1 or 2.

4. The composition according to claim 3, characterized in that The composition comprises one or more combinations of lysate, culture or fermentation product prepared from Lactobacillus plantarum TY-M19.

5. The composition according to claim 4, characterized in that The composition also includes one or more combinations of probiotics, prebiotics, dietary fiber and Chinese patent medicines.

6. A preparation comprising the composition according to any one of claims 3 to 5, wherein the preparation is a food, a medicine or a health product.

7. The preparation according to claim 6, characterized in that The dosage form of the preparation is tablet, pill, capsule, powder, gel, granule or liquid.

8. Use of Lactobacillus plantarum TY-M19 according to claim 1 or 2 or the composition according to any one of claims 3 to 5 in the preparation of a preparation for improving acute pancreatitis and / or related lung injury.

9. The use according to claim 8, characterized in that: Applications include one or a combination of the following: (a) Use of Lactobacillus plantarum TY-M19 or a composition in the preparation of a preparation for inhibiting amylase activity and lipase activity in serum; (b) Use of Lactobacillus plantarum TY-M19 or the composition in the preparation of a preparation for improving pathological damage of acute pancreatitis; (c) Use of Lactobacillus plantarum TY-M19 or the composition in the preparation of a preparation for inhibiting the expression level of inflammatory factors in pancreatic tissue; (d) Use of Lactobacillus plantarum TY-M19 or the composition in the preparation of a preparation for reducing the oxidative stress level of lung tissue.

10. The use according to claim 9, characterized in that: in, Application (b) includes: application of Lactobacillus plantarum TY-M19 or the composition in the preparation of a preparation for relieving pancreatic tissue edema and inflammatory exudation; In application (c), the inflammatory factors include one or more combinations of TNF-α, IL-6 or IL-1β; Application (d) includes: application of Lactobacillus plantarum TY-M19 or the combination in the preparation of a preparation for restoring the MDA content and SOD activity in lung tissue.

Images