Recombinant engineering bacterium for expressing pure iron nitrogenase as well as construction method and application of recombinant engineering bacterium

Abstract

The invention relates to a recombinant engineering bacterium for expressing pure iron nitrogenase as well as a construction method and application of the recombinant engineering bacterium, and belongs to the field of biotechnology and bioengineering. Key gene clusters of rhodopseudomonas and Vilnelande nitrogen-fixing bacteria are amplified and cloned into an expression vector, escherichia coli is converted to obtain recombinant engineering bacteria for expressing pure iron nitrogenase, and the pure iron nitrogenase expressed by the recombinant engineering bacteria can reduce carbon dioxide (CO2) into methane (CH4); the recombinant engineering bacteria are cultured in an LB culture medium added with ferric chloride, ampicillin and spectinomycin, oxygen exposure is reduced as much as possible under the optimized semi-anaerobic condition, the enzyme activity can be improved to the maximum extent, and compared with a traditional system, the methane yield is remarkably increased; by providing a novel methane production scheme, the technical defects of low efficiency and oxygen sensitivity of the traditional nitrogenase process are improved; the process of the present invention contributes to carbon capture and utilization by converting waste carbon dioxide into valuable methane.

Description

Technical Field

[0001] The invention relates to a recombinant engineering bacterium expressing pure iron nitrogenase and a construction method and application thereof, belonging to the fields of biotechnology and bioengineering. Background Art

[0002] Methane is a renewable energy source, and its production by biological means is a mature research field. Biological methane production can utilize nitrogenase, which catalyzes the conversion of atmospheric nitrogen (N2) into ammonia (NH3). Related studies have shown that pure iron nitrogenase without molybdenum (Mo) can catalyze CO2 into CH4. This provides a promising path for reducing carbon dioxide and producing methane through microorganisms, a process that contributes to the generation of renewable energy and greenhouse gas mitigation. However, current methods of producing methane using iron-only nitrogenase face major challenges. One of the main limitations is low efficiency, and the catalytic activity of these nitrogenases under standard conditions cannot reach the production rate for industrial applications; in addition, pure iron nitrogenases are highly sensitive to oxygen, which makes it difficult for them to remain active in the air. These limitations hinder the application of the enzyme in bioenergy production.

[0003] Due to these inherent limitations, there is an urgent need to seek new methods to improve the stability and efficiency of pure iron nitrogenase. Summary of the invention

[0004] In view of some problems existing in the prior art, the present invention provides a recombinant engineering bacterium expressing pure iron nitrogenase and a construction method and application thereof.

[0005] The inventive approach aims to increase the efficiency of methane production while reducing its oxygen sensitivity, making it suitable for industrial bioenergy applications.

[0006] In order to achieve the above technical objectives, the present invention provides the following technical solutions:

[0007] The present invention first provides a recombinant engineering bacterium expressing pure iron nitrogenase, wherein the recombinant engineering bacterium comprises nifU, nifS, nifV, nifB, nifF, nifJ genes and anfH, anfD, anfG, anfK genes; the nifU, nifS, nifV, nifB, nifF, nifJ genes are derived from Rhodopseudomonas, and the anfH, anfD, anfG, anfK genes are derived from Azotobacter vinelandii.

[0008] Furthermore, an RBS sequence is added upstream of the nifU, nifS, nifV, nifB, nifF, nifJ genes and anfH, anfD, anfG, and anfK genes.

[0009] Furthermore, the nucleotide sequences of the nifU, nifS, nifV, nifB, nifF, and nifJ genes after codon optimization are shown in SEQ.ID.No:1-6; the nucleotide sequences of the anfH, anfD, anfG, and anfK genes after codon optimization are shown in SEQ.ID.No:7-10.

[0010] Furthermore, the nifU, nifS, nifV, nifB, nifF, and nifJ genes are responsible for the catalytic activity and assembly of the nitrogenase complex; and the nifU, nifS, nifV, nifB, nifF, and nifJ genes promote the function of pure iron nitrogenase.

[0011] Furthermore, the recombinant engineered bacteria contain plasmids pCDFDuet-1 and pETDuet-1.

[0012] Furthermore, the recombinant engineered bacteria include a host bacterium Escherichia coli, and the preferred host bacterium is the Escherichia coli BL21 strain.

[0013] The present invention also provides a method for constructing the recombinant engineered bacteria expressing pure iron nitrogenase, the method comprising the following steps:

[0014] The nifU, nifS, nifV, nifB, nifF and nifJ genes from Rhodopseudomonas were amplified, and the anfH, anfD, anfG and anfK genes from Azotobacter vinelandii were amplified; the genes from Rhodopseudomonas were connected to plasmid pETDuet-1, and the genes from Azotobacter vinelandii were connected to plasmid pCDFDuet-1 to construct two recombinant plasmids; the constructed recombinant plasmids were transformed into Escherichia coli to obtain recombinant engineered bacteria expressing pure iron nitrogenase.

[0015] The plasmid in the scheme of the present invention is constructed to allow the coordinated expression of two gene clusters when introduced into E. coli; the plasmid is transformed into the E. coli BL21 strain, which is used as a host organism because it is suitable for protein expression and gene manipulation.

[0016] The present invention also provides application of the recombinant engineering bacteria in producing methane.

[0017] The present invention also provides a pure iron nitrogenase system for producing methane using carbon dioxide, and the system comprises the recombinant engineered bacteria.

[0018] The present invention also provides a method for producing methane using carbon dioxide, the method comprising:

[0019] Under certain oxygen content conditions, carbon dioxide is reintroduced into the recombinant engineered bacteria culture system according to any one of claims 1 to 6, and the pure iron nitrogenase expressed by the recombinant engineered bacteria catalyzes the reduction of CO2 to CH4.

[0020] Furthermore, in the above method, the oxygen content is 1-5%, and the stirring speed of the recombinant engineered bacteria culture system is 100-300 rpm.

[0021] Furthermore, in the above method, the oxygen content is 1-3%, and the stirring speed of the recombinant engineered bacteria culture system is 100-200 rpm.

[0022] The beneficial effects of the present invention include:

[0023] (1) The present invention improves the enzyme activity expressed by Escherichia coli through codon optimization, and then constructs a pure iron nitrogenase system containing Rhodopseudomonas and Vinelandia gene clusters to achieve efficient gene expression and methane production, ultimately providing a more stable and efficient solution for the microbial method of converting carbon dioxide into methane. Codon optimization and the matching of each gene in the gene cluster ensure the efficient expression and function of the enzyme, thereby obtaining a higher methane yield than traditional biological systems. The invention achieves more efficient methane production under optimized growth conditions, and the methane yield can reach a maximum of 0.8L of methane per day per liter of recombinant engineered bacteria contained in the culture medium.

[0024] (2) The present invention provides a scalable and cost-effective method using E. coli as a chassis organism that can be integrated into industrial bioenergy facilities for large-scale methane production. By continuously optimizing growth conditions, the efficiency of methane production is increased while reducing oxygen sensitivity, overcoming the key obstacles of existing methane production systems.

[0025] The present invention further optimizes the growth conditions of recombinant bacteria and provides engineered bacteria constructed with a completely new gene combination, which can reduce oxygen sensitivity and enhance the stability and function of enzymes; the present invention further overcomes the technical problem that traditional nitrogen enzyme systems are limited by their sensitivity to oxygen and the activity of enzymes is low in oxygen environments; therefore, the methane production method of the present invention can maintain stable methane production in more environments, expanding its potential for industrial application.

[0026] (3) The present invention provides an economical and efficient production process. The present invention provides an economical and effective solution by selecting Escherichia coli as the chassis organism, which has good genetic characteristics, grows rapidly and is easy to culture. The methane production system can be expanded from a laboratory environment to industrial scale production, becoming an economically feasible method for large-scale methane production. The solution of the present invention can be directly integrated into existing bioenergy infrastructure.

[0027] The invention provides the dual benefits of bioenergy production and carbon capture by using carbon dioxide as the primary substrate for methane production. This process helps reduce carbon dioxide emissions and converts waste emissions into valuable energy. The system's ability to convert carbon dioxide into methane is consistent with carbon neutrality strategies and supports the reduction of greenhouse gas emissions.

[0028] (4) The method of the present invention has versatility and broad industrial applicability, and the methane production system of the present invention is suitable for a variety of industrial scenarios, including biogas production plants and biorefineries. The modular nature of the invention supports customization and scalability, supporting methane production under a variety of operating environments. Low oxygen sensitivity and efficient methane output capacity enable the system to operate under a variety of conditions and is suitable for a wide range of bioenergy applications.

[0029] The invention supports the transition of mankind to sustainable and green energy technologies by producing methane, a renewable energy source, through microbial production. This invention complies with the principles of circular economy, converting carbon dioxide emissions into valuable biofuels, reducing dependence on non-renewable resources while contributing to the production of clean energy, and promoting the use of renewable energy and the development of circular economy.

[0030] These beneficial effects indicate that the invention provides an efficient, scalable and sustainable solution for methane production, making it suitable for industrial applications and carbon dioxide emission reduction efforts. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 This is the gas chromatogram of the quantitative analysis of methane in Example 2.

[0032] Figure 2 It is a recombinant plasmid carrying the anf gene cluster constructed in the embodiment of the present invention.

[0033] Figure 3 It is a recombinant plasmid carrying the nif gene cluster constructed in the embodiment of the present invention.

[0034] Figure 4 It is a schematic diagram of the recombinant engineering bacteria converting carbon dioxide into methane in the method of the present invention. DETAILED DESCRIPTION

[0035] In order to make those skilled in the art better understand the technical solution of the present invention, the present invention is further described in detail below in conjunction with specific embodiments and drawings. It should be understood that these embodiments are only for illustrating the present invention, and are not intended to limit the scope of protection of the present invention in any way.

[0036] The experimental methods in the following examples, unless otherwise specified, are conventional methods, and are performed according to the techniques or conditions described in the literature in the art or according to the product instructions. The plasmids / vectors, materials, reagents, instruments, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0037] The present invention relates to an engineered microbial system that converts CO2 into methane using pure iron nitrogenase expressed in Escherichia coli (E. coli). The present invention includes several embodiments that are intended to optimize methane production, enhance enzyme stability, and improve the oxygen tolerance of the system to make it more suitable for industrial applications. The following describes embodiments of the present invention in detail:

[0038] Example 1: Gene identification and cloning

[0039] This example relates to the identification and isolation of essential gene clusters from Rhodopseudomonas and Azotobacter vineilandii. These genes include:

[0040] The nifU, nifS, nifV, nifB, nifF and nifJ genes from Rhodopseudomonas sp. (GenBank Genome Accession No.: CP019967.1) are responsible for the catalytic activity and assembly of the nitrogenase complex.

[0041] anfH, anfD, anfG, and anfK genes from Azotobacter vinelandii (GenBank Genome Accession No.: X13303.1), which are essential for the functional expression of pure iron nitrogenase.

[0042] The above gene is amplified using conventional PCR technology to obtain cloned gene fragments.

[0043] The amplified gene sequences were optimized according to the codon usage preference of Escherichia coli. The nucleotide sequences of the codon-optimized nifU, nifS, nifV, nifB, nifF, and nifJ genes are shown in SEQ.ID.No:1-6; the nucleotide sequences of the codon-optimized anfH, anfD, anfG, and anfK genes are shown in SEQ.ID.No:7-10. Codon optimization ensures the effective translation of the nitrogenase gene carried in the plasmid, improves the protein expression level in the host cell, and ensures the production of pure iron nitrogenase.

[0044] Codon-optimized nifU sequence (SEQ ID No: 1):

[0045] atgggcatgtggaattattcagaaaaggtaaaagatcacttcttcaacccgcgtaatgcgcgtgttgtagacaacgctaacgctgtgggtgatgttggtagccttagctg

[0046] cggtgacgcattgcgcctcatgctgcgcgttgacccgcagagcgagatcatcgaggaggcgggttttcagaccttcggctgcggatctgcgatcgcctcctctagcg

[0047] cgttgacggaactgatcattggccacaccctggcggaggctggccagattaccaaccagcaaatcgcggactacctggatggcctgccaccggaaaagatgcact

[0048] gctcggtgatgggtcaagaagcactgcgtgctgccatcgcgaattttcgtggtgaatccctggaagaggaacacgatgagggcaagctgatttgtaaatgctttggcg

[0049] ttgacgagggtcacatccgccgtgccgtgcaaaacaacggtctgacgaccttggcggaggttattaattacaccaaagcaggtggcggttgtacttcatgccatgaaa

[0050] agatcgagctggcgctcgctgagattttggcgcagcaaccgcaaaccaccccggcagtcgcgagcggcaaagatccgcattggcagagcgtcgtggacaccattg

[0051] ccgagctgcgtccgcatattcaggcagatggtggcgacatggcgttactgagcgtgaccaatcatcaggttaccgttagcttgtccggtagttgcagcggctgcatgat

[0052] gaccgatatgacgctggcgtggctgcagcaaaaactgatggaaagaacaggttgttatatggaagtcgtggctgcataa

[0053] Codon-optimized nifS sequence (SEQ ID No: 2):

[0054] atgaaacaggtttatctcgataacaacgccaccacccgtctggacccgatggtcctggaagcgatgatgccctttttgaccgatttttacggcaacccctcgtcgataca

[0055] cgattttggcattccggcccaggcggctctggaacgcgcgcatcagcaggctgcggcgctgctgggcgcggagtatcccagcgagatcatctttacctcctgcgcc

[0056] accgaagccaccgccaccgccatcgcctcggcgatcgccctgctgcctgagcgtcgcgaaatcatcaccagcgtggtcgaacatccggcgacgctggcggcctg

[0057] cgagcacatggagcgcgagggctaccggattcatcgcatcgcggtagatggcgagggggcgctggacatggcgcagttccgcgcggcgctcagcccgcgcgtc

[0058] gcgttggtcagcgtgatgtgggcgaataacgaaaccggggtgcttttcccgatcggcgaaatggcggagctggcccatgaacaaggggcgctgtttcactgcgatg

[0059] cggtgcaggtggtcgggaaaataccgatcgccgtgggccagacccgcatcgatatgctctcctgctcggcgcataagttccacgggccaaaaggcgtaggctgtct

[0060] ttatctgcggcggggaacgcgctttcgcccgctgctgcgcggcggtcaccaggagtacggtcggcgagccgggacagaaaatatctgcggaatcgtcggcatggg

[0061] cgcggcctgcgagctggcgaatattcatctgccgggaatgacgcatatcggccaattgcgcaacaggctggagcatcgcctgctggccagcgtgccgtcggtcatg

[0062] gtgatgggcggcggccagccggcggtgcccggcacggtgaatctggcctttgagtttattgaaggtgaagccattctgctgctgttaaaccaggccgggatcgccgc

[0063] ctccagcggcagcgcctgcacctcaggctcgctggaaccctcccacgtgatgcgggcgatgaatatcccctacaccgccgcccacggcaccatccgcttttctctct

[0064] cgcgctacacccgggagaaagagatcgattacgtcgtcgccacgctgccgccgattatcgaccggctgcgcgcgctgtcgccctactggcagaacggcaagccg

[0065] cgcccggcggacgccgtattcacgccggtttacggctaa

[0066] Codon-optimized nifV sequence (SEQ ID No: 3):

[0067] atggaacgcgtgctgattaacgataccaccctgcgcgacggcgagcagagccccggcgtcgcctttcgcaccagcgaaaaggtcgccattgccgaggcgctttac

[0068] gccgcaggaataacggcgatggaggtcggcaccccggcgatgggcgacgaggagatcgcgcggatccagctggtgcgtcgccagctgcccgacgcgaccctg

[0069] atgacctggtgtcggatgaacgcgctggagatccgccagagcgccgatctgggcatcgactgggtggatatctcgattccggcttcggataagctgcggcagtacaa

[0070] actgcgcgagccgctggcggtgctgctggagcggctggcgatgtttatccatcttgcgcataccctcggcctgaaggtatgcatcggctgcgaggacgcctcgcgg

[0071] gccagcggccagaccctgcgcgctatcgccgaggtcgcgcagcaatgcgccgccgcccgcctgcgctatgccgatacggtcggcctgctcgacccttttaccacc

[0072] gcggcgcaaatctcggccctgcgcgacgtctggtccggcgaaatcgaaatgcatgcccataacgatctgggtatggcgaccgccaatacgctggcggcggtaagc

[0073] gccggggccaccagcgtgaatacgacggtcctcggtctcggcgagcgggcgggcaacgcggcgctggaaaccgtcgcgctgggccttgaacgctgcctgggc

[0074] gtggagaccggcgtgcatttttcggcgctgcccgcgtcctgtcagagggtcgcggaagccgcgcagcgcgccatcgacccgcagcagccgctggtcggcgagct

[0075] ggtgtttacccatgagtcaggtgtccacgtggcggcgctgctgcggcacagcgagagctaccagtccatcgccccttccctgatgggccgcagctaccggctggtg

[0076] ctgggcaaacactccgggcgtcaggcggtcaacggcgtttttgaccagatgggctatcacctcaacgccgcgcagattaaccagctgctgcccgccatccgccgctt

[0077] cgccgagaactggaagcgcagcccgaaagattacgagctggtggctatctacgacgagctgtgcggtgaatccgctctgcgggcgagggggtaa

[0078] Codon-optimized nifB sequence (SEQ ID No: 4):

[0079] atgacttcctgctcctctttttctggcggcaaagcctgccgcccggcggatgacagcgcattgacgccgcttgtggccgataaagctgccgcgcacccctgctactctc

[0080] gccatgggcatcaccgtttcgcgcggatgcatctgcccgtcgcgcccgcctgcaatttgcagtgcaactactgtaatcgcaaattcgattgcagcaacgagtcccgcc

[0081] ccggggtatcgtcaacgctgctgacgcctgaacaggcggtcgtgaaagtgcgtcaggtcgcgcaggcgatcccgcagctttcggtggtgggcatcgccgggcccg

[0082] gcgatccgctcgccaatatcgcccgcacctttcgcaccctggagctgatccgcgaacagctgccggacctgaaattatgcctgtcgaccaacggactggtgctgcct

[0083] gacgcggtggaccgcctgctggatgtcggcgttgaccacgtcacggtcaccattaacaccctcgacgcggagattgccgcgcaaatctacgcctggctatggctgg

[0084] acggcgaacgctacagcgggcgcgaagcgggagagatcctgattgcccgtcagcttgagggcgtacgcaggctgaccgccaaaggcgtgctggtgaaaataaat

[0085] tcggtgctgatccccggtatcaacgatagcggcatggccggcgtgagccgcgcgctgcgggccagcggcgcgtttatccataatattatgccgctgatcgccaggc

[0086] cggagcacggcacggtgtttggcctcaacggccagccggagccggacgccgagacgctcgccgccacccgcagccggtgcggcgaagtgatgccgcagatga

[0087] cccactgccaccagtgtcgcgccgacgccattgggatgctcggcgaagaccgcagccagcagtttacccagcttccggcgccagagagtctcccggcctggctgc

[0088] cgatcctccaccagcgcgcgcagctgcacgccagcattgcgacccgcggcgaatctgaagccgatgacgcctgcctggtcgccgtggcgtcaagccgcgggga

[0089] cgtcattgattgtcactttggtcacgccgaccggttctacatttacagcctctcggccgccggtatggtgctggtcaacgagcgctttacgcccaaatattgtcaggggc

[0090] gcgatgactgcgagccgcaggataacgcagcccggtttgcggcgatcctcgaactgctggcggacgttaaagccgtattctgcgtgcgtatcggccatacgccgtg

[0091] gcaacagctggaacaggaaggcattgaaccctgcgttgacggcgcgtggcggccggtctccgaagtgctgcccgcgtggtggcaacagcgtcgggggagctgg

[0092] cctgccgcgttgccgcataagggggtcgcctga

[0093] Codon-optimized nifF sequence (SEQ ID No: 5):

[0094] atggcgaacattggtattttctttggcaccgataccggtaaaacccgcaaaatcgcgaaaatgatccataagcaactgggcgagctggcggatgccccggtcaacatt

[0095] aaccgcacgacgctggacgactttatggcctatccggtgctgctgctgggcacgccgacgctcggcgacggccagctgccggggctggaggccggatgcgaaag

[0096] cgagtcatggagcgaatttatcagcggcctcgacgacgccagcctgaaagggaaaaccgtggcgctgttcggcctcggcgatcagagaggctatccggacaactt

[0097] cgtcagcgggatgcgcccgctgttcgacgccctgagcgcgcgcggcgcgcagatgattggcagctggccaaatgagggttatgaattcagcgcgtcctcggcgct

[0098] ggaaggcgaccgctttgttgggctggtgctggatcaggataaccagttcgaccagaccgaagcgcgtctggcgagctggcttgaggagattaaacgcaccgtgctg

[0099] tag

[0100] Codon-optimized nifJ sequence (SEQ ID No: 6):

[0101] atgtccggaaaaatgaaaacaatggatggcaacgccgcggcggcctggatctcttatgcctttaccgaggtcgcggcgatttaccccataaccccctccacgccgat

[0102] ggcggaaaacgtcgacgagtgggcggcgcaggggaaaaagaacctttttggccagccggtgcgcttaatggagatgcagtcggaggccggcgcggcaggcgc

[0103] ggtccacggcgcgctgcaggccggggcgctcaccaccacctatacggcctcccaggggctgctgctgatgatccccaacatgtacaaaatcgccggtgaactgct

[0104] gccgggcgtctttcacgtcagcgcccgggcgctggcgaccaattcgctgaatatttttggcgatcaccaggatgtgatggcggtccgccagaccggctgcgcgatgc

[0105] tggcggagaacaacgtgcagcaggtgatggatttgtcggcggtggcgcatctggcggcgattaagggacgcatcccgtttgttaacttcttcgacggttttcgcacctc

[0106] gcacgaaattcaaaaaatcgaggtgttggaatatgagcagctggcgacgctgctggaccggcccgcgctcgacagcttccgccgtaacgcgctgcatccggatcat

[0107] ccggtcatccgcggaacggcgcagaacccggatatctacttccaggagcgggaggcgggcaaccgtttttatcaggcgctgcccgacattgtcgaaagctatatga

[0108] cgcaaatcagcgcgctcaccggccgggagtatcatctgtttaactataccggcgcggcggatgccgaacgggtgattatcgcaatgggatcggtctgcgataccgtt

[0109] caggaagtggtggatacgctgaacgcggcgggagagaaggtcgggctgctcagcgtgcatctgtttcgccctttttcgctggcccacttcttcgcccagctgccgaa

[0110] aaccgtgcagcggattgccgtccttgaccgtaccaaagagcccggcgctcaggctgaaccgctgtgcctggatgtgaaaaacgccttctaccaccacgacgatgcg

[0111] ccgctaatcgtcggcggccgctatgcgcttggcgggaaggatgttctgcccaacgatatcgcggccgtctttgataacctcaataaaccgctgccgatggacgggttt

[0112] accctcgggattgtcgatgatgtaacctttacttcgttaccgccggcccagcagacgctggcggtctcgcatgacggcatcaccgcctgtaaattttggggcatgggct

[0113] cggacggcaccgtcggggccaataaaagcgcgatcaaaattatcggcgataaaacgccgctctacgcgcaggcctacttttcttatgactcgaaaaaatccggcggc

[0114] attaccgtttcacatttacgcttcggcgaccggccgatcaattcgccctacctgatccatcgggccgattttatctcctgttcgcagcagtcctacgttgagcgctacgatc

[0115] tgctggacggattaaagccgggcgggacctttttactcaactgcagctggtccgatgcggagctggagcagcatctgccggtcggctttaaacgctatctggcgcgg

[0116] gaaaatatccatttttataccctgaacgccgtggatatcgcccgcgagctcgggctgggcgggcgctttaatatgctgatgcaggcggcgttctttaagctggcggcga

[0117] ttatcgacccgcagaccgcggcggattacctcaagcaggcggttgaaaaaagctacggcagcaaaggggcggcggtgattgagatgaaccagcgggcgatcga

[0118] gctgggcatggcctcgctgcatcaggtgacgattccggcgcactgggcgacgctggatgaacccgcggcgcaagcatcagccatgatgccggatttcatccgcgat

[0119] attctgcagccgatgaaccgccagtgcggcgaccagctgccggtgagcgcgttcgtcggtatggaggacgggacctttccttcgggcaccgccgcgtgggagaaa

[0120] cgcgggatcgcgctggaagtgccggtctggcagccggagggctgcacgcagtgtaaccagtgcgcctttatctgcccgcatgcggcgatccgcccggcgctgctc

[0121] aacggcgaagagcatgacgccgcgccggttgggctgctgagcaaacccgcgcagggagcgaaggagtatcactaccatctggctatctcgccgctggattgttcc

[0122] ggctgcggcaactgcgtggatatctgtcccgcgcgcggcaaggcgttaaaaatgcagtctctcgatagccagcgtcagatggcgccggtctgggactatgcgctgg

[0123] cgctgacgccgaagagcaatccgtttcgtaagacgacggtcaaaggcagccagtttgaaaccccgctgctggagttttccggcgcctgcgcgggatgcggtgaaac

[0124] gccttatgcccgcctgataacccagctgtttggcgaccggatgctgatcgctaacgccaccggctgctcttctatctggggagccagcgcgccgtcgattccctatacc

[0125] accaaccaccgcggccatggcccggcatgggcgaactcgctgtttgaggataatgcggagtttggcctcggcatgatgctcggcggccaggcggtgcgtcaacaa

[0126] atcgccgatgatatgaccgccgcgctggcgctaccggtcagcgacgaacttagcgacgcaatgcgccagtggctggcgaagcaggatgaaggcgagggcaccc

[0127] gcgagcgcgcggaccggctcagcgaacggctggcggcggaaaaagagggcgtgccgctgttggagcagctgtggcagaaccgcgactattttgttcgtcgttcg

[0128] cagtggattttcggcggcgacggctgggcctacgatatcggcttcggcggtctcgatcacgtgctggcgagcggggaagacgtcaatattctggtgtttgacaccga

[0129] ggtttactccaataccggcggccagtcgtctaaatcgaccccggtggcggccatcgcgaagtttgccgcgcagggcaaacgcacgcggaaaaaagatctcggcat

[0130] gatggcgatgagctacggcaatgtgtacgtggcccaggtcgcgatgggcgctgataaagatcagaccctacgggcgatcgccgaggccgaagcctggccgggac

[0131] cgtcgctggtgattgcctacgccgcctgcattaaccacgggctgaaagccggtatgcgctgcagccagcgcgaggcgaaacgggcggttgaggcgggatactgg

[0132] cacctgtggcgctatcatccgcagcgggaagcggaaggtaagacgccgtttatgctcgattccgaagagccggaggagagcttccgcgactttttgcttggcgaagt

[0133] gcgctacgcctcgctgcacaaaacgacgccgcatctggcggatgcgctctttagccgaaccgaggaggacgcgcgggcccgctttgcccagtatcggcggctgg

[0134] ccggcgaggagtag

[0135] Codon-optimized anfH sequence (SEQ ID No: 7):

[0136] atgggcatgacaaggaaggtagctatatatggaaaaggcggcatcggtaaatccaccactacgcagaataccgcggctgccctggcctacttccacgataagaagg

[0137] tgttcatccacggttgtgatccgaaggcggacagcacgcgtttgattctgggcggcaagccgcaagaaaccctgatggatatgctgcgcgacaaaggtgctgagaa

[0138] aattactaatgacgacgtaatcaaaaaggggtttctcgacatccaatgtgtggaatctggcggtccggagccgggtgttggttgcgcgggtcgtggtgttatcacggct

[0139] attgaccttatggaagaaaatggtgcgtataccgatgacttagattttgttttttttgatgtgctgggagatgtcgtgtgcggtggcttcgccatgccgattcgcgacggca

[0140] aggcccaagaggtttatattgtcgcgagcggcgagatgatggcaatttatgcagcgaacaacatttgcaaaggcctggttaaatacgcgaagcagagcggtgttcgtt

[0141] tgggtggtattatctgcaattcgcgtaaggtggatggtgagcgcgaattcttggaagagttcaccgctgcgatcggcaccaaaatgattcactttgttccgcgtgacaac

[0142] attgtgcagaaagcggagttcaacaaaaaaaccgttaccgaatttgcaccagaggagaaccaggcaaaagaatacggcgagctggcgcgtaagatcatcgaaaac

[0143] gacgaattcgtcatcccgaagccgctgacgatggaccagctggaagatatggtggtgaagtacggcatcgcggactaa

[0144] The codon-optimized anfD sequence (SEQ ID No: 8):

[0145] atgccgcatcacgagttcgagtgcagcaaggttattcccgagcggaagaagcatgccgttatcaaaggtaaaggcgaaacgctggccgacgccctgcctcaagggt

[0146] atctgaataccatccctggttccatctccgagcgtggttgtgcctactgtggtgccaagcacgttatcgggactcccatgaaggatgtgattcacatcagtcatggcccg

[0147] gtcggctgcacttacgatacctggcagaccaagcgttatatcagcgacaacgacaacttccagctcaaatacacctatgccaccgatgtgaaggaaaagcatatcgtg

[0148] ttcggcgccgagaagttgctgaagcagaacatcatcgaagccttcaaggcgttcccgcagatcaagcggatgaccatctaccagacctgcgccacggcgctgatcg

[0149] gagacgacatcaacgccatcgccgaagaggtgatggaagagatgccggaggtggatatcttcgtctgcaactcgcccggtttcgccggtccgagccagtccggtg

[0150] gtcaccacaagatcaacatcgcctggatcaaccagaaggtgggtaccgtcgagccggagatcaccggcgaccatgtgatcaactatgtgggcgagtacaacattca

[0151] gggcgaccaggaagtgatggtggattacttcaagcgcatgggtatccaggtgctatccactttcaccggcaacggttcctacgacggcctgcgtgccatgcacagag

[0152] cccatctgaacgtactggaatgtgcccgctccgccgagtacatctgcaacgaactgcgtgtccgttacggcattccgcgtctggatatcgacggtttcggtttcaagcc

[0153] actggcggattcgctgcgtaagatcggtatgttcttcggcatcgaagaccgtgccaaggccatcatcgacgaggaagtcgcccgctggaagccggagttggactggt

[0154] acaaggagcggctgatgggcaagaaggtctgcctgtggccgggcggttccaaactctggcactgggcccatgtgatcgaggaagaaatgggcctcaaggtggtgt

[0155] cggtctataccaagttcggccatcagggcgacatggagaaaggcatcgcccgttgcggcgaaggcactttggccatcgacgacccgaacgaattggaaggtctgg

[0156] aagccctggagatgctcaagcccgacatcatcctgaccggcaagcgtccgggtgaagtggccaagaaagtccgggttccctacctgaacgcccacgcctaccaca

[0157] acggcccgtacaaaggcttcgaaggttgggtgcgtttcgcccgcgatatttacaacgccatctactcgccgatccatcagctctccggtatcgacatcactaaagacaa

[0158] tgcaccggagtggggtaatggtttccgtactcgccaaatgctgtccgatggcaacttgagcgatgcagtacgtaactcggaaaccttgcgccagtacaccggcggct

[0159] acgacagcgtgagcaagctgcgcgaacgggaatatcccgccttcgagcgcaaggtcggctga

[0160] The codon-optimized anfG sequence (SEQ ID No: 9):

[0161] atgagtaccgcttccgccgctgctgtggtcaaacagaaggtcgaagctcccgtgcatccgatggatgcacggatcgacgagctgaccgactacatcatgaaaaactg

[0162] cctctggcagttccattcccgctcctgggaccgggaacgccagaacgccgaaatcctgaagaaaaccaaggaactgctgtgcggtgagccagtggatctgagcac

[0163] atcccatgatcgttgctactgggtcgatgcggtttgtctggccgacgactatcgggagcactatccctggatcaatagcatgtccaaggaagaaatcggctccttgatgc

[0164] aaggactgaaagaccgcatggattatctgaccatcaccggctcgctcaacgaagagttgagcgacaaacactattaa

[0165] The codon-optimized anfK sequence (SEQ ID No: 10):

[0166] atgacttgcgaagtcaaggaaaaagggcgggttggcactatcaaccccatctttacctgtcaaccggccggtgcccagttcgtcagtatcggtatcaaggattgcatcg

[0167] gtatcgtgcatggcggccaaggctgcgtgatgttcgtccgcctgatcttttcccagcactacaaggaaagtttcgagctggcctcttcctccctgcacgaggacggcgc

[0168] cgtgttcggtgcctgcggccgggtcgaggaagcggtcgatgtgctgctcagccgctatcccgacgtgaaggtggtgcccatcatcaccacctgctccaccgagatc

[0169] atcggcgacgacgtggacggggtgatcaagaagctcaacgaagggctgctgaaagagaagttcccggaccgggaagtccatctgatcgccatgcacacgccgag

[0170] cttcgtgggcagcatgatcagcggctacgacgtggccgttcgggatgtggtcaggcatttcgccaagcgcgaagcgcccaacgacaagatcaatctgctcaccggc

[0171] tgggtcaatccgggggatgtcaaggagctgaagcacctgctcggggaaatggacatcgaagccaacgtgttgttcgagatcgaaagtttcgactcgccgatcctgcc

[0172] ggatggcagtgccgtttcccacggcaataccaccatcgaggatctgatcgacaccggcaatgcccgggcgaccttcgccctgaaccgctacgaaggcaccaaggc

[0173] cgccgagtatctgcagaagaaattcgagatcccggcgatcatcggcccgaccccgatcggcatccgcaataccgacatcttcctgcagaacctgaagaaggcgac

[0174] gggcaagccgattccccagtcgctggcccatgagcgcggggtggccatcgatgccctggccgacctgacccacatgtttctggccgaaaagcgtgtggccatctat

[0175] ggggcgccggatctggtgatcggcctggccgaattctgcctggatctggagatgaagcccgtcttgctgctgctgggcgacgacaactccaagtacgtggacgatc

[0176] cgcgcatcaaggcgcttcaggaaaacgtcgattacggcatggaaatcgtcaccaatgcggatttctgggaactggaaaaccgcatcaagaacgagggtctggaact

[0177] ggatctgatcctcggtcactccaagggccgtttcatctccatcgactacaacatcccgatgctgcgcgtgggtttcccgacctacgaccgcgccggcctgttccgctat

[0178] cccacggtgggctatggcggtgccatctggctggccgagcagatggccaacaccctgttcgccgatatggaacacaagaagaacaaggaatgggtcctcaacgtct

[0179] ggt

[0180] Insert these codon-optimized genes into two plasmids as follows:

[0181] GenScript Biotech Co., Ltd. was commissioned to synthesize codon-optimized anfH and anfD, and the RBS sequence AAGGAG (SEQ.ID.No:11) was added upstream of the codon-optimized anfH and anfD. The genes were cloned into the first multiple cloning site (MCS1) of the pCDFDuet-1 plasmid using a seamless cloning kit (Nanjing Novogene Biotech Co., Ltd.). The pCDFDuet-1 plasmid has a dual promoter and two multiple cloning sites MCS1 and MCS2. In this embodiment, the gene was cloned into NcoI and HindIII of the multiple cloning site MCS1 of the plasmid pCDFDuet-1.

[0182] GenScript Biotech Co., Ltd. was commissioned to synthesize the codon-optimized anfG and anfK, and the RBS sequence AAGGAG was added upstream of the codon-optimized anfG and anfK, which were then cloned into the second multiple cloning site (MCS2) of the pCDFDuet-1 plasmid (on NotI and XhoI) using a seamless cloning kit (Nanjing Novogene Biotech Co., Ltd.).

[0183] GenScript Biotech Co., Ltd. was commissioned to synthesize codon-optimized nifU, nifS, and nifV, and the RBS sequence AAGGAG was added upstream of the codon-optimized nifU, nifS, and nifV, which were then cloned into the first multiple cloning site (MCS1) (XbaI, MunI, and BamHI) of the pETDuet-1 plasmid using a seamless cloning kit (Nanjing Novogene Biotech Co., Ltd.).

[0184] GenScript Biotech Co., Ltd. was commissioned to synthesize codon-optimized nifB, nifF, and nifJ. The RBS sequence AAGGAC was added upstream of the codon-optimized nifB and nifF, and cloned into the first multiple cloning site (MCS1) of the pETDuet-1 plasmid (HindIII, NcoI, and XhoI) using a seamless cloning kit (Nanjing Novogene Biotech Co., Ltd.).

[0185] The plasmid pCDFDuet-1 carries the anf gene cluster and is expressed in Escherichia coli; the plasmid pETDuet-1 carries the nif gene cluster, which together with the anf gene can form a complete nitrogenase system.

[0186] The two recombinant plasmids obtained were simultaneously transformed into Escherichia coli BL21 strain to obtain the recombinant engineered bacteria Escherichiacoli BL21 (IO-Fe-nitrogenase).

[0187] The optimized gene sequence was transformed into Escherichia coli BL21 strain using constructed plasmids (pCDFDuet and pETDuet) to obtain recombinant engineered bacteria. Escherichia coli BL21 was selected because it is suitable for efficient protein expression and can ensure the successful expression of pure iron nitrogenase required for methanogenesis. The transformed Escherichia coli is the host organism of the methane production system.

[0188] Through PCR identification, sequencing and electrophoresis analysis, the correct recombinant vector and the successfully constructed recombinant engineering bacteria were obtained. The constructed recombinant engineering bacteria were stored in glycerol tubes at -80°C for long-term storage.

[0189] This example establishes the genetic basis for methanogenesis and provides a modular platform for the construction and expression of pure iron nitrogenase in Escherichia coli.

[0190] Example 2: Cultivation and Optimization of Growth Conditions

[0191] This example describes in detail the culture and condition optimization of the E. coli strain transformed in Example 1, i.e., the recombinant engineered bacteria:

[0192] Medium composition: The recombinant engineered bacteria EscherichiacoliBL21 (IO-Fe-nitrogenase) constructed in Example 1 was cultured in LB medium, to which FeCl3 (0.213 g / L) was added to ensure the activity of the coenzyme (i.e., ferritin in pure iron nitrogenase, a coenzyme synthesized by the nif series genes), and antibiotics such as ampicillin (50 μg / mL) and spectinomycin (30 μg / mL) were added to maintain plasmid stability and promote the selective growth of the engineered strain.

[0193] Environmental conditions: In order to reduce the sensitivity of pure iron nitrogenase to oxygen, the growth environment of the recombinant engineered bacteria was adjusted to minimize oxygen exposure. The recombinant engineered bacteria culture was grown in a semi-anaerobic environment, and the stirring speed was controlled at 200-260rpm to enhance gas exchange and carbon dioxide dissolution, while maintaining a low oxygen concentration (i.e., oxygen content of 1-3%) to ensure optimal enzyme activity and thus obtain higher methane production.

[0194] Methane production was monitored using gas chromatography, and the culture medium composition and environmental parameters of the recombinant engineered bacteria were adjusted to maximize methane production.

[0195] Example 3: Production and Quantification of Methane

[0196] In this example, CO2 is introduced into the culture system, in which the recombinant Escherichia coli BL21 (IO-Fe-nitrogenase) expresses nitrogenase containing only iron. Carbon dioxide is used as a substrate for the enzymatic reaction and is converted into CH4 in the enzymatic reaction. The process of methane production includes:

[0197] The substrate CO2 gas is continuously supplied to the culture medium containing the recombinant engineered bacteria. The system maintains a stable flow rate of the CO2 gas to ensure that there is enough substrate for the pure iron nitrogenase expressed by the recombinant engineered bacteria, thereby forming a methane production system.

[0198] Methane production is measured using gas chromatography to determine the efficiency of the system. Gas chromatography analysis provides precise quantification of methane production, enabling evaluation of system performance under a variety of quantitative conditions.

[0199] In this embodiment, three groups of comparative experiments are set up mainly based on the oxygen concentration and stirring speed that need to be adjusted:

[0200] Methane production is expressed as L CH4 / L·day, which is the amount of methane produced per day by the recombinant engineered bacteria contained in each liter of culture medium.

[0201] (1) Low oxygen concentration (1-3% O2) and low stirring speed (100-200 rpm) group: methane production was 0.8 L CH4 / L·day.

[0202] (2) Moderate oxygen concentration (3-5% O2) and medium stirring speed (200-300 rpm) group: methane production 0.5 L CH4 / L·day.

[0203] (3) Group with higher oxygen concentration (>5% O2) and higher stirring speed (>300 rpm): methane production was 0.2 L CH4 / L·day.

[0204] Among them, the group with low oxygen concentration (1-3% O2) and moderate stirring speed (100-200rpm) had the highest methane production, which could reach 0.8L CH4 / L·day. That is, low oxygen concentration (1-3% O2) and moderate stirring speed (100-200rpm) are the optimal methane production conditions for this system.

[0205] At the same time, this embodiment also sets up a control group (using an Escherichia coli strain with an untransformed recombinant plasmid to replace the recombinant engineered bacteria constructed by the present invention) for comparative study. Experimental verification shows that the Escherichia coli strain with an untransformed recombinant plasmid can not produce methane after the introduction of CO2, that is, the methane production is 0, indicating that the methane production system provided by the present invention is effective and efficient in producing methane.

[0206] This example focuses on reducing the oxygen sensitivity of the pure iron nitrogenase system to expand its industrial applicability. In Example 1 of the present invention, a recombinant engineered bacterium Escherichia coli BL21 (IO-Fe-nitrogenase) was constructed, and a specific gene combination was used to increase the expression level of nitrogenase under hypoxic conditions, thereby improving the performance and flexibility of the enzyme.

[0207] In the present invention, the culture conditions are further optimized by fine-tuning the oxygen level to support cell growth while preventing nitrogenase inhibition; the system uses controllable aeration and stirring technology to create a semi-anaerobic environment that is conducive to methane production. Methane production usually relies on anaerobic or hypoxic conditions, so it is crucial to control the oxygen concentration to an appropriate range. Too high oxygen concentrations will inhibit methane production, while too low oxygen concentrations may affect cell growth. The optimized oxygen concentration range in the present invention is 1-5% O2, which can support the normal growth of cells without causing serious inhibition of nitrogenase (especially iron-containing nitrogenase). Further, the present invention has experimentally verified that the methane production is higher at low oxygen concentrations (1-2% O2), the methane production is slightly reduced at moderate oxygen concentrations (3-5% O2), and the methane production is greatly reduced at high oxygen concentrations (>5% O2). These optimizations significantly improve the stability and efficiency of the engineering system, making it more suitable for practical bioenergy applications.

[0208] The optimized method of producing methane of the present invention can be used for industrial bioenergy production:

[0209] Pilot-scale implementation: The optimized methane production system is scaled up in a pilot bioreactor setup. E. coli cultures are grown in a larger space under controlled conditions replicating the laboratory optimized parameters.

[0210] Integration into industrial facilities: The methane production method of the present invention is suitable for integration into industrial bioenergy facilities, making more efficient use of existing bioreactor infrastructure. The methane produced by this process can be used as a renewable energy source.

[0211] Reducing and Utilizing CO2: The process can also serve as a carbon capture and utilization strategy, converting waste CO2 gas into methane, providing a sustainable approach to bioenergy production.

[0212] The scalability and integration strategy highlight the commercial application potential of this invention, providing a feasible solution for large-scale methane production using microorganisms.

[0213] In addition, the methane production method of the present invention can be adapted to work with other E. coli strains or alternative host organisms to further optimize the system for use in a variety of industrial applications. Customization and enhancement of the nitrogenase pathway can be achieved through a modular plasmid system that allows easy exchange of genetic components to explore other biofuel production possibilities besides methane.

[0214] The flexibility of the preparation method of the present invention makes it suitable for use in a variety of environments, including biogas plants, biorefineries, and carbon capture facilities, enhancing its applicability in renewable energy and industrial biotechnology.

Claims

1. A recombinant engineered bacterium expressing pure iron nitrogenase, characterized in that: The recombinant engineered bacteria comprises nifU, nifS, nifV, nifB, nifF, nifJ, anfH, anfD, anfG and anfK genes; the nifU, nifS, nifV, nifB, nifF, nifJ genes are derived from Rhodopseudomonas, and the anfH, anfD, anfG, anfK genes are derived from Azotobacter vinelandii.

2. The recombinant engineered bacterium according to claim 1, characterized in that The nucleotide sequences of the nifU, nifS, nifV, nifB, nifF, and nifJ genes after codon optimization are shown in SEQ.ID.No:1-6; the nucleotide sequences of the anfH, anfD, anfG, and anfK genes after codon optimization are shown in SEQ.ID.No:7-10.

3. The recombinant engineered bacterium according to claim 1, characterized in that The recombinant engineering bacteria contain plasmids pCDFDuet-1 and pETDuet-1.

4. The recombinant engineered bacterium according to claim 1, characterized in that The recombinant engineering bacteria include the host bacteria Escherichia coli.

5. The method for constructing the recombinant engineered bacteria expressing pure iron nitrogenase according to claim 1, the method comprising the following steps: The nifU, nifS, nifV, nifB, nifF and nifJ genes from Rhodopseudomonas were amplified, and the anfH, anfD, anfG and anfK genes from Azotobacter vinelandii were amplified; the genes from Rhodopseudomonas were connected to plasmid pETDuet-1, and the genes from Azotobacter vinelandii were connected to plasmid pCDFDuet-1 to construct two recombinant plasmids; the constructed recombinant plasmids were transformed into Escherichia coli to obtain recombinant engineered bacteria expressing pure iron nitrogenase.

6. Use of the recombinant engineered bacteria expressing pure iron nitrogenase according to claim 1 in producing methane.

7. A pure iron nitrogenase system for producing methane using carbon dioxide, characterized in that: The system comprises the recombinant engineered bacteria according to any one of claims 1 to 6.

8. A method for producing methane using carbon dioxide, the method comprising: Under certain oxygen content conditions, carbon dioxide is reintroduced into the recombinant engineered bacteria culture system according to any one of claims 1 to 6, and the pure iron nitrogenase expressed by the recombinant engineered bacteria catalyzes the reduction of CO2 to CH4.

9. The method according to claim 8, characterized in that The oxygen content is 1-5%, and the stirring speed of the recombinant engineering bacteria culture system is 100-300 rpm.

10. The method according to claim 9, characterized in that The oxygen content is 1-3%, and the stirring speed of the recombinant engineering bacteria culture system is 100-200 rpm.

Images