UvsY protein mutant and application thereof

Abstract

The invention provides a UvsY protein mutant, and compared with a wild type UvsY protein, the UvsY protein mutant has mutation at one or more of the 29th amino acid, the 73rd amino acid, the 74th amino acid, the 81th amino acid, the 99th amino acid, the 119th amino acid, the 126 amino acid, the 128 amino acid and the 132 amino acid corresponding to SEQ ID NO: 4. Compared with a wild type UvsY protein, the UvsY protein mutant disclosed by the invention has the advantages that the yield, the solubility, the stability and / or the activity in a recombinase polymerase isothermal amplification technology (RPA) are remarkably improved.

Description

Technical Field

[0001] The present invention belongs to the field of genetic engineering, and specifically relates to UvsY protein mutants and applications thereof. Background Art

[0002] Since its development by the British company TwistDx in 2006, recombinase polymerase isothermal amplification (RPA) has become an important nucleic acid amplification technology. Compared with the traditional polymerase chain reaction (PCR) technology, RPA has significant advantages. First, RPA does not require a high-temperature denaturation step and can react at a constant temperature of 37°C-42°C, which makes its operation easier, avoids the thermal cycling step in PCR, and significantly increases the speed of the reaction. The RPA amplification process is usually completed within 20-30 minutes, and is comparable to PCR in terms of sensitivity and specificity. Therefore, RPA technology has been widely used in nucleic acid detection, on-site diagnosis and other fields.

[0003] The core of RPA technology lies in the synergistic effect of recombinase and DNA polymerase, which can effectively amplify DNA templates at room temperature. Coenzyme UvsY is a key recombinase in the RPA reaction, participating in the formation and stabilization of presynaptic filaments, laying the foundation for the function of UvsX recombinase. However, in practical applications, the use of T4 UvsY protein still faces many challenges, which affects its application effect in RPA.

[0004] First, the expression yield of T4 UvsY protein is generally low. Due to its own properties and the expression conditions in the recombinant system, the expression efficiency of T4 UvsY protein in common host systems such as Escherichia coli is low, and most of them are expressed in inclusion bodies, resulting in protein yields that cannot meet the needs of efficient experiments. Low yields not only limit its wide application, but also increase the cost of protein purification and subsequent use.

[0005] Secondly, the solubility of T4 UvsY protein is poor. Low solubility makes it easy for the protein to form aggregates or precipitate during the purification process, which seriously affects the recovery and functional activity of the protein. Especially in the freeze-dried preparation process, the poor stability and solubility of the protein further aggravate these problems. Therefore, the poor freeze-dried preparation effect caused by low solubility not only increases the difficulty of the preparation process, but also affects the long-term storage and transportation of the protein.

[0006] In addition, the stability of T4 UvsY protein also needs to be improved. During storage and transportation, the protein is prone to degradation or inactivation, reducing its activity in the RPA reaction. Although T4 UvsY protein can effectively participate in RPA amplification under standard conditions, its lack of stability makes it difficult to maintain its long-term functionality in actual operations, especially under high temperature or long-term storage conditions, the activity will drop rapidly.

[0007] Therefore, although RPA technology has shown superior performance in the field of nucleic acid amplification, the shortcomings of T4 UvsY protein in terms of yield, solubility, stability and activity limit its effectiveness and stability in large-scale applications. In view of these problems, it is urgent to optimize T4 UvsY protein through protein engineering to improve its performance in RPA and promote its wider application. Summary of the invention

[0008] The present invention discloses a method for significantly improving the yield, solubility, stability or activity of T4 UvsY protein in recombinase polymerase isothermal amplification (RPA) by performing mutation optimization on the protein, thereby overcoming the deficiencies in the prior art and promoting the widespread use of the protein in practical applications.

[0009] One aspect of the present disclosure provides a UvsY protein mutant, which has a mutation at one or more of the amino acids at positions 29, 73, 74, 81, 99, 119, 126, 128, and 132 corresponding to SEQ ID NO:4 relative to the wild-type UvsY protein.

[0010] In some embodiments, the UvsY protein mutant includes one or more mutations of V29P, F73P, S74F, S81K, S81R, S99K, S119F, S119R, S119W, H126W, Q128I, and A132K.

[0011] In some embodiments, the UvsY protein mutant includes F73P+V29P mutation. In some embodiments, the UvsY protein mutant includes F73P+A132K mutation. In some embodiments, the UvsY protein mutant includes F73P+S119F mutation. In some embodiments, the UvsY protein mutant includes V29P+A132K mutation. In some embodiments, the UvsY protein mutant includes V29P+S119F mutation. In some embodiments, the UvsY protein mutant includes A132K+S119F mutation.

[0012] In some embodiments, the wild-type UvsY protein has the amino acid sequence shown in SEQ ID NO:4, or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% sequence identity compared to SEQ ID NO:4, or an amino acid sequence in which one or more amino acids are added, deleted, replaced or modified to the amino acid sequence shown in SEQ ID NO:4.

[0013] In some embodiments, the UvsY protein mutant has an amino acid sequence shown in one or more of SEQ ID NOs: 5-9, 11, 26-31 and 46-51.

[0014] In some embodiments, the UvsY protein mutant has improved protein solubility, and / or improved protein yield, and / or improved thermal stability, and / or improved enzyme activity compared to the wild-type UvsY protein.

[0015] In some embodiments, the enzyme activity is RPA enzyme activity.

[0016] The present disclosure obtains 13 mutation sites for UvsY protein: V29P, S99K, Q128I, A132K, F73P, S74F, S81K, S81R, S119F, S119R, S119W, F122R, H126W. After testing, it was found that the key sites of thermal stability of UvsY protein include F73, S81, S119, H126 and Q128; the key sites of solubility include V29, F73, S74, F119, and H126; the key sites of yield include V29, F73, S74, S119, H126 and Q128; the key sites of RPA activity include V29, F73, S81, S99, S119, H126 and A132.

[0017] In particular, mutations at the F73P site can significantly increase the solubility of UvsY (more than 10 times), the protein yield is more than 7 times higher than the wild type, and the thermal stability is 1.29°C higher than the wild type. The present disclosure also found that the combined mutant with the F73P mutation also has greatly improved protein yield and protein solubility. For example, the protein yield of the combined mutation F73P+V29P can reach 129 mg / (L fermentation broth), which is significantly higher than the wild type (9.86 mg / (L fermentation broth)), the protein concentration can reach 50 μg / μL, which is significantly higher than the wild type (3-6 μg / μL), and the RPA activity is 37% higher than the wild type.

[0018] Another aspect of the present disclosure provides a nucleic acid molecule encoding the UvsY protein mutant described in the present disclosure.

[0019] Another aspect of the present disclosure provides a recombinant expression vector containing the nucleic acid molecule of the present disclosure.

[0020] In some embodiments, the recombinant expression vector can be selected from a viral or bacterial vector, such as, but not limited to, an African swine fever virus vector, a lentiviral vector, an avian pox virus vector, a canine measles virus vector, a herpes virus vector, a varicella virus vector, an adenovirus vector, an adeno-associated virus vector, and the like.

[0021] In some embodiments, the recombinant expression vector includes, but is not limited to, pET-28a, pET-22b plasmids, and the like.

[0022] Another aspect of the present disclosure provides a host cell, wherein the host cell contains the UvsY protein mutant, the nucleic acid molecule, or the recombinant expression vector described in the present disclosure.

[0023] In some embodiments, the host cell is a prokaryotic cell or a eukaryotic cell.

[0024] In some embodiments, the prokaryotic cell can be selected from Escherichia coli or Bacillus subtilis, such as Escherichia coli BL21, T7E, C41, Arctic, etc. In some specific embodiments, the host cell is Escherichia coli BL21 (DE3) strain.

[0025] In some embodiments, the eukaryotic cell can be selected from yeast cells, insect cells, plant cells, animal cells, etc., such as yeast cells, CHO cells, 293 cells, Vero cells or NSO cells, etc.

[0026] Another aspect of the present disclosure provides a composition comprising (i) the UvsY protein mutant described in the present disclosure, and (ii) one or more reagents selected from the following: a buffer, a primer, a probe, a dye, a detection agent, a target nucleic acid and a cell lysis agent.

[0027] In some embodiments, the composition is provided in the form of a kit.

[0028] Another aspect of the present disclosure provides a method for preparing the UvsY protein mutant described in the present disclosure, wherein the method comprises the following steps: (1) culturing the host cell described in the present disclosure; and (2) isolating the UvsY protein mutant from the host cell or from the growth medium or supernatant.

[0029] Another aspect of the present disclosure provides the use of the UvsY protein mutant, the nucleic acid molecule, the recombinant expression vector, the host cell or the composition described in the present disclosure in enzyme preparation production, gene repair, target gene detection, DNA recombination or vaccine preparation.

[0030] In some embodiments, the UvsY protein mutant is used in a recombinase polymerase amplification reaction.

[0031] Yet another aspect of the present disclosure provides a method for producing a DNA molecule, comprising the step of using the UvsY protein mutant described in the present disclosure.

[0032] In some embodiments, the UvsY protein mutant is incubated with template DNA and primers.

[0033] In some embodiments, the method is performed by a recombinase polymerase amplification reaction.

[0034] The present invention significantly improves the yield, solubility, stability and activity of UvsY protein in recombinase polymerase isothermal amplification (RPA) by mutation optimization of UvsY protein, and promotes the widespread use of UvsY protein in practical applications. Specifically, it is embodied in the following aspects:

[0035] (1) The amino acid sequence of UvsY protein was optimized by genetic engineering, which increased its yield in conventional expression systems and improved the efficiency of protein production, thereby meeting the needs of large-scale production.

[0036] (2) Through mutation and structural optimization, the solubility of UvsY protein was enhanced to avoid the formation of aggregates or precipitation during expression and purification, ensure the high stability of the protein in solution, and improve its freeze-drying preparation effect.

[0037] (3) Improve the thermal stability of the protein by modifying the structure of UvsY protein. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 The protein concentration results of the mutants obtained by virtual saturation mutagenesis disclosed in the present invention are shown.

[0039] Figure 2 The yield results of mutants obtained by virtual saturation mutagenesis of the present disclosure are shown.

[0040] Figure 3 The protein concentration results of mutants obtained from the consensus mutations disclosed in the present invention are shown.

[0041] Figure 4 The yield results of mutants obtained from the consensus mutations disclosed in the present invention are shown.

[0042] Figure 5 The thermal stability results of mutants obtained by virtual saturation mutation and consensus mutation of the present disclosure are shown.

[0043] Figure 6 The RPA activity results of mutants obtained by virtual saturation mutation and consensus mutation of the present disclosure are shown.

[0044] Figure 7 The relative RPA activity results of mutants obtained by virtual saturation mutation and consensus mutation are shown.

[0045] Figure 8 The protein concentration results of mutants obtained by combinatorial mutagenesis are shown.

[0046] Fig. 9 The yield results of mutants obtained by combinatorial mutations are shown.

[0047] Fig.10 The RPA activity results of mutants obtained by combinatorial mutations are shown.

[0048] Fig.11 The relative RPA activity results of mutants obtained by combinatorial mutations are shown. DETAILED DESCRIPTION

[0049] In order to make the purpose, technical scheme and advantages of the present disclosure more clear, the present disclosure is further described in detail below in conjunction with the accompanying drawings and embodiments. The specific embodiments described herein are only used to explain the present disclosure and are not intended to constitute any limitation to the present disclosure. In addition, in the following description, the description of well-known structures and technologies is omitted to avoid unnecessary confusion of the concepts of the present disclosure. Such structures and technologies are also described in many publications.

[0050] definition

[0051] Unless otherwise defined, all technical and scientific terms used in this disclosure have the same meaning as commonly used in the field to which this disclosure belongs. For the purpose of interpreting this specification, the following definitions will apply, and where appropriate, terms used in the singular will also include the plural form, and vice versa.

[0052] Unless the context clearly dictates otherwise, the expressions "a", "an" and "an" as used herein include plural references. For example, reference to "a cell" includes a plurality of such cells and equivalents thereof known to those skilled in the art, and so forth.

[0053] As used herein, the term "about" refers to a range of ±20% of the value that follows. In some embodiments, the term "about" refers to a range of ±10% of the value that follows. In some embodiments, the term "about" refers to a range of ±5% of the value that follows.

[0054] The term "T4 UvsY protein" as used herein refers to an important protein in T4 bacteriophage that is involved in DNA repair and recombination processes.

[0055] The term "RPA (Recombinase Polymerase Amplification)" used herein is a molecular biology technique for DNA amplification, which uses specific recombinases, polymerases, and auxiliary proteins to perform efficient DNA amplification at room temperature.

[0056] The term "substitution" as used herein for amino acids refers to the replacement of at least one amino acid residue in an amino acid sequence by another different "replacement" amino acid residue. The term "insertion" as used herein for amino acids refers to the incorporation of at least one additional amino acid into an amino acid sequence. Although inserts typically consist of the insertion of 1 or 2 amino acid residues, larger "peptide inserts" can also be prepared, for example, inserting about 3 to 5 or even up to about 10, 15 or 20 amino acid residues. As disclosed above, the inserted residues can be naturally occurring or non-naturally occurring. The term "deletion" as used herein for amino acids refers to the removal of at least one amino acid residue from an amino acid sequence.

[0057] Mutants disclosed herein or fragments thereof may comprise conservative amino acid substitutions at one or more amino acid residues, such as at essential or non-essential amino acid residues. "Conservative amino acid substitutions" are amino acid residues replaced by amino acid residues with similar side chains. Families of amino acid residues with similar side chains have been defined in the art, including basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), non-polar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), β-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Therefore, in this article, the essential or non-essential amino acid residues in the mutant are preferably replaced with another amino acid residue from the same side chain family.

[0058] "Percent sequence identity" or "percent identity" between two polynucleotide or polypeptide sequences refers to the number of identical matching positions shared by the sequences within the comparison window, taking into account additions or deletions (i.e., gaps) that must be introduced for optimal alignment of the two sequences. A matching position is any position where the same nucleotide or amino acid is present in both the target sequence and the reference sequence. Since a gap is not a nucleotide or amino acid, gaps present in the target sequence are not counted. Likewise, since target sequence nucleotides or amino acids are counted and nucleotides or amino acids from the reference sequence are not counted, gaps present in the reference sequence are not counted.

[0059] The sequence identity percentage can be calculated by the following process: determine the number of positions where the same amino acid residue or nucleic acid base occurs in both sequences to obtain the number of matching positions, divide the number of matching positions by the total number of positions in the comparison window, and multiply the result by 100 to obtain the sequence identity percentage. The determination of the sequence identity percentage between the comparison of the sequence and the two sequences can be completed using software that is easy to use and download online. Suitable software programs can be obtained from various sources for the comparison of protein and nucleotide sequences. A suitable program for determining the sequence identity percentage is bl2seq, which is a part of the BLAST program suite that can be obtained from the BLAST website (blast.ncbi.nlm.nih.gov) of the National Center for Biotechnology Information of the U.S. Government. Bl2seq uses BLASTN or BLASTP algorithms to compare between two sequences. BLASTN is used for comparing nucleic acid sequences, and BLASTP is used for comparing amino acid sequences. Other suitable programs are, for example, Needle, Stretcher, Water or Matcher, part of the EMBOSS suite of bioinformatics programs and also available from the European Bioinformatics Institute (EBI) at www.ebi.ac.uk / Tools / psa.

[0060] Examples are provided below to help understand the present disclosure. However, it should be understood that these examples are only used to illustrate the present disclosure and do not constitute any limitation. The actual protection scope of the present disclosure is set forth in the claims. It should be understood that any modifications and changes can be made without departing from the spirit of the present disclosure.

[0061] Example

[0062] Example 1: Recombinant plasmid construction

[0063] 1. Target gene synthesis

[0064] The gene sequence encoding UvsY (SEQ ID NO: 4) was synthesized by Suzhou Jinweizhi Biotechnology Co., Ltd. and inserted into the NdeⅠ and XhoⅠ sites of the pET-28a(+) plasmid to successfully construct the pET-UvsY recombinant plasmid.

[0065] (1) Extraction of pET-UvsY recombinant plasmid

[0066] A single T1 colony carrying the pET-UvsY plasmid was picked from the plate and transferred to 5 mL LB liquid medium (Table 1) containing 0.1 mM kanamycin, and cultured at 37°C 220 rpm for 12 hours. Afterwards, the cells were collected by centrifugation for plasmid extraction, and the extraction process was performed according to the instructions of the plasmid extraction kit (purchased from Beijing Quanshijin Biotechnology).

[0067] (2) Construction of E. coli BL21

[0068] In the clean bench, take 10 μL of pET-UvsX recombinant plasmid and 50 μL of E. coli BL21 competent cells and mix them evenly. Transform the plasmid into E. coli BL21 competent cells and incubate on ice for 30 minutes. Then perform heat shock treatment: place the reaction tube in a 42°C water bath for 45 seconds, quickly transfer to ice, and cool for 2 minutes. Next, add 500 μL of LB liquid culture medium to the system and culture at 37°C 220rpm for 1 hour.

[0069] 450 μL of supernatant was removed by centrifugation (8000×g, 1 minute), the cells were resuspended and spread on a plate medium containing kanamycin, and cultured at 37° C. for 12 hours. A single clone strain was picked and cultured in liquid LB medium for 12 hours for strain preservation.

[0070] Table 1 Preparation of LB medium

[0071] Components LB liquid medium / g / L LB plate medium / g / L Peptone 10 10 Yeast powder 5 5 Sodium chloride 10 10 Agar powder - 15

[0072] Example 2: Heterologous expression and purification of recombinant proteins

[0073] (1) Transformation and expression of pET-UvsY recombinant plasmid

[0074] The pET-UvsY recombinant plasmid constructed in Example 1 was introduced into E. coli BL21 (DE3) competent cells, and protein expression was performed in the BL21 (DE3) strain.

[0075] Take 10 μL of competent cells and inoculate into 5 mL LB liquid culture medium containing 0.1 mM kanamycin, and culture at 37°C and 220 rpm for 12 hours.

[0076] On the next day, 1 mL of the culture medium was transferred to a new 80 mL LB medium containing 0.1 mM kanamycin and culture was continued. When the bacterial concentration (OD600) reached 0.8, IPTG was added to a final concentration of 0.05 mM, the temperature was adjusted to 16°C, and culture was continued at 160 rpm for 20 hours.

[0077] (2) Cell harvesting and lysis

[0078] After the culture was completed, the culture was centrifuged at 8000×g and 4°C for 5 minutes, the supernatant was discarded, and the bacterial pellet was retained.

[0079] Suspend the cells with 10 mL of lysis solution (Table 3) and store on ice. Then, use an ultra-high pressure cell disruptor to disrupt the cells three times. Transfer the disrupted solution to centrifuge at 10,000 × g and 4°C for 60 minutes, discard the precipitate, and collect the supernatant.

[0080] (3) Protein purification

[0081] The supernatant was filtered through a 0.45 μm microporous membrane and then the protein was purified using a Ni-NTA metal affinity chromatography column.

[0082] First, use one column volume of Buffer I (Table 2) to equilibrate the Ni-NTA column for 2 minutes. Then, add the supernatant to the Ni-NTA column, add 10 mL along the wall, let the nickel medium and supernatant bind for 2 minutes, repeat three times, and the nickel column will turn white-gray after binding with protein.

[0083] Subsequently, five times the column volume of washing solution (Table 4) buffer was added along the wall to wash away the impurities; the elution buffer (Table 5) was added to compete with the nickel column using high concentration imidazole to collect the washed target protein. After the protein was eluted, the nickel medium turned back to blue. The protein washing and elution were checked with Coomassie Brilliant Blue solution.

[0084] Finally, the Ni-NTA column was washed with one column volume of the final elution buffer (Table 6), and then washed with water and stored.

[0085] (3) Protein concentration and storage

[0086] All purification operations were performed at 4° C. The eluted protein was dialyzed with storage buffer (Table 7) and concentrated to less than 1 mL, and the harvested protein volume was recorded.

[0087] (4) Protein quality detection and concentration determination

[0088] The purified protein was analyzed by 15% SDS-PAGE to confirm its purity and molecular weight. The protein concentration was quantified using the Solarbio BCA protein assay kit.

[0089] In the above steps, the formulas of the buffer solutions used are shown in Tables 2 to 7.

[0090] Table 2 Preparation of Buffer-I

[0091] Components concentration Phosphate buffer pH 7.2 50mM Sodium chloride 500mM

[0092] Table 3 Preparation of Bacterial Disruption Solution

[0093] Components concentration Buffer-I – PMSF 100mM

[0094] Table 4 Preparation of washing buffer

[0095] Components concentration Phosphate buffer pH 7.2 50mM Sodium chloride 500mM Imidazole 60mM

[0096] Table 5 Preparation of elution buffer

[0097] Components concentration Phosphate buffer pH 7.2 50mM Sodium chloride 500mM Imidazole 500mM

[0098] Table 6 Preparation of final elution buffer

[0099] Components concentration Phosphate buffer pH 7.2 50mM Sodium chloride 500mM Imidazole 1000mM

[0100] Table 7 Preparation of enzyme storage solution

[0101] Components concentration Sodium chloride 300mM Tris-HCl (pH 8) 20mM DTT 1mM EDTA 0.1mM

[0102] Example 3: RPA reaction conditions

[0103] (1) Plasmid construction

[0104] The plasmid required for the RPA detection system for detecting HPV-16 was synthesized by Quanshijin Company and cloned into the pET-22b vector. The relevant primer sequences and amplified nucleotide sequences are shown in Table 8.

[0105] (2) RPA reaction system and conditions

[0106] The reaction volume was 50 μL, the buffer components used were listed in Table 9, and the reaction conditions were shown in Table 10. The reaction was carried out at 41° C. for 30 minutes. The mixed reaction solution was placed in a 1.5 mL EP tube in a water bath.

[0107] (3) Nucleic acid extraction and electrophoresis analysis

[0108] After the reaction, an equal volume of DNA extraction phenol was added for nucleic acid extraction. After centrifugation at 12000×g for 7 minutes, the supernatant was collected. The extracted products were separated on a 2.0% (w / v) agarose gel and stained with 1×Safe Green dye. Each group of experiments was repeated three times in parallel.

[0109] Table 8 Amplification sequences and primers used in the experiment

[0110]

[0111] Table 9 Preparation of 2×RPA buffer

[0112] Components concentration Tris-HCl (pH 8) 60mM <![CDATA[CH3COOK]]> 80mM DTT 4mM Creatine Phosphate 40mM PEG35K 15％ ATP 5mM dNTPs 0.9mM

[0113] Table 10 Preparation of reagents for RPA amplification reaction

[0114] Components Volume / μL 2×RPA buffer 25 Bsu DNA polymerase (1.5 μg / μL, SEQ ID NO: 52) 1 T4 UvsX recombinase (3 μg / μL, SEQ ID NO: 53) 2 T4 UvsY wild type or mutant (1 μg / μL) 1 T4 gene 32 single-chain binding protein (4 μg / μL, SEQ ID NO: 54) 2.5 Creatine kinase (CK) (2 μg / μL, purchased from Yisheng Biotechnology) 2.5 Forward primer HPV-F (10 μM) 1.5 Reverse primer HPV-R (10 μM) 1.5 Amplification template (HPV-16, SEQ ID NO: 1) 1 <![CDATA[Mg 2+ (280mM)]]> 2.5 Distilled water Add to 50 μL

[0115] In Table 10, the amino acid sequence of Bsu is:

[0116]

[0117] The amino acid sequence of the T4 UvsX recombinase is:

[0118]

[0119]

[0120] The amino acid sequence of the T4 gene 32 single-chain binding protein is:

[0121]

[0122] Example 4: Virtual saturation mutation

[0123] (1) Structure prediction and mutation design

[0124] AlphaFold 3 was used to predict the binding structure of protein and DNA. Based on the predicted structure, FoldX software was used to identify the protein near the DNA binding pocket ( The amino acids within the range of 100 μg / mL were subjected to virtual saturation mutation. The mutation energy of each mutant was then calculated. According to the calculation results, potential mutation sites were screened out: S81K, S81R, S119F, S119R, S119W, F122R, H126W. The amino acid sequences of each mutant are shown in Table 11 below.

[0125] Table 11

[0126]

[0127] (2) Construction of recombinant plasmids for expressing mutants using PCR technology

[0128] The pET-UvsY recombinant plasmid was amplified to obtain a recombinant plasmid for expressing the UvsY mutant protein. The PCR system is shown in Table 12, and the primer sequences used are shown in Table 13.

[0129] Table 12 PCR system

[0130]

[0131]

[0132] PCR amplification program: pre-denaturation: 98°C for 3 minutes; denaturation: 98°C for 15 seconds; annealing: 62°C for 15 seconds; extension: 72°C for 3 minutes; cycle 30 times; final extension: 72°C for 5 minutes.

[0133] Table 13 Primers used in the experiment

[0134] name Sequence information (5'-3') SEQ ID NO: S81K_F TTACGAGAAAAAAGAAATGAAGACAGTTCTATC 12 S81K_R CTTCATTTCTTTTTTCTCGTAACGATCCAT 13 S81R_F TTACGAGAAACGTGAAATGAAGACAGTTCTATC 14 S81R_R CTTCATTTCACGTTTCTCGTAACGATCCAT 15 S119F_F TGCTATTAAATTTCGTGGATTTGCTATTAAG 16 S119F_R AAATCCACGAAATTTAATAGCATCAAGAGCTC 17 S119R_F TGCTATTAAACGTCGTGGATTTGCTATTAAG 18 S119R_R AAATCCACGACGTTTAATAGCATCAAGAGCTC 19 S119W_F TGCTATTAAATGGCGTGGATTTGCTATTAAG 20 S119W_R AAATCCACGCCATTTAATAGCATCAAGAGCTC 21 F122R_F ATCACGTGGACGTGCTATTAAGCATATTCAAGAC 22 F122R_R CTTAATAGCACGTCCACGTGATTTAATAGC 23 H126W_F TGCTATTAAGTGGATTCAAGACATGCGAGC 24 H126W_R GTCTTGAATCCACTTAATAGCAAATCCACG 25

[0135] (3) Mutant performance

[0136] Purified UvsY protein mutants were obtained according to the method of Example 2, and the protein concentration was quantitatively detected by Solarbio BCA protein assay kit; the protein yield was calculated by the following formula:

[0137] Protein yield mg / (L fermentation broth) = (harvest volume * protein concentration) / fermentation broth volume

[0138] Protein thermal stability was determined by differential scanning calorimetry. The protein melting temperature (Tm) value was reflected by: 4 μg protein, 1×SYPRO orange protein dye were included in the detection system, and the final volume was adjusted to 25 μL with storage buffer (Table 7). Differential scanning calorimetry was performed using the ABI QuantStudioTM 5 quantitative real-time PCR system. The melting curve filter of the instrument was configured with an excitation wavelength of 470 nm and an emission wavelength of 586 nm. The sample was subjected to a temperature gradient from 25°C to 99°C at a controlled rate of 0.05°C / s. The Tm value was determined by the melting curve peak.

[0139] The mutant protein concentration results are shown in Figure 1 As shown, the results indicated that the S119F, S119R and H126W mutants had better protein solubility than their wild-type UvsY proteins.

[0140] The results of mutant yields were as follows Figure 2 As shown, the results showed that the production of S81K, S119F, S119R, S119W and H126W mutants was significantly increased compared with the wild-type UvsY protein.

[0141] The results of thermal stability of the mutants were shown in Figure 5 As shown, the results showed that the mutants H126W, S119W, S119R, S119F, and S81K had better thermal stability than the wild type.

[0142] Example 5: Consensus mutation

[0143] (1) Mutation design

[0144] The consensus mutation strategy was used to mutate non-conservative amino acids into conservative amino acids. The frequency of occurrence of amino acids in homologous protein sequences determines their degree of conservation. Amino acids with a frequency of occurrence greater than 50% were selected as conservative sites after mutation, thereby determining six mutation sites: V29P, S99K, Q128I, A132K, F73P, and S74F. The amino acid sequences of each mutant are shown in Table 14 below.

[0145] Table 14

[0146]

[0147]

[0148] (2) Construction of recombinant plasmids for expressing mutants

[0149] The PCR amplification system and conditions were the same as in Example 4, and the primer sequences used are shown in Table 15.

[0150] Table 15 Primers used in the experiment

[0151] Name Sequence Information (5’-3’) SEQ ID NO: V29P-YF CAGCTAATAATccgATGTTATATAGTAAATGGCTTAATAAGCATTC 32 V29P-YR CATcggATTATTAGCTGCTTCATACTGTAATTTAGTCG 33 F73P-YF GAAcctAGTATGGATCGTTACGAGAAATCAGA 34 F73P-YR CGATCCATACTaggTTCATCACCATCTCCTCGTCCC 35 S74F-YF TtttATGGATCGTTACGAGAAATCAGAAATGA 36 S74F-YR CGTAACGATCCATaaaAAATTCATCACCATCTCCTCGTCC 37 S99K-YF GGTTGATACCaagTTGCAGTATTGGGGGATTTTATT 38 S99K-YR GCAActtGGTATCAACCTTTAAAACATCCTTATCC 39 Q128I-YF ATTatcGACATGCGAGCATTTGAGGCTGGAAA 40 Q128I-YR GCTCGCATGTCgatAATATGCTTAATAGCAAATCCACGTG 41 A132K-YF GCGAaaaTTTGAGGCTGGAAAATGAGATCCGG 42 A132K-YR CAGCCTCAAAtttTCGCATGTCTTGAATATGCTTAATAG 43

[0152] (3) Mutant performance

[0153] Purified UvsY protein mutants were obtained according to the method of Example 2, and protein concentration, protein yield and protein thermal stability were detected according to the method of Example 4.

[0154] The mutant protein concentration results are shown in Figure 3 As shown, the results showed that the mutants V29P, F73P and S74F had significantly improved protein solubility compared with the wild type, and the mutants Q128I and A132K had protein solubility basically equivalent to that of the wild type.

[0155] The results of mutant yields were as follows Figure 4 As shown, the results showed that compared with the wild-type UvsY protein, the yield of the F73P mutant was greatly improved, and the yields of the V29P, S74F, Q128I and A132K mutants were all significantly increased.

[0156] The results of thermal stability of the mutants were shown in Figure 5 As shown, the results showed that mutants Q128I and F73P had better thermal stability than the wild type, and mutants S74F, V29P, and A132K had thermal stability comparable to that of the wild type.

[0157] Among them, the protein solubility of the mutant F73P was increased by more than 10 times compared with the wild-type UvsY, the protein yield was increased by 7.77 times compared with the wild-type UvsY, the protein thermal stability was increased by 1.29°C compared with the wild-type UvsY, and the protein RPA relative activity was increased by 90% compared with the wild-type UvsY.

[0158] Example 6: RPA reaction

[0159] According to the RPA reaction conditions of Example 3, the mutants obtained in Example 4 and Example 5 were used for RPA reaction. After the reaction, the RPA reaction amplification bands in which each mutant participated were separated and detected by agarose gel method. The gray value of each band was analyzed by image J software, and the gray value of the band in which the wild-type UvsY participated in the reaction was used as a reference to define its relative RPA activity with the mutant protein.

[0160] The results of RPA amplification of wild-type UvsY and mutants are shown in Figure 6 As shown, the results show that the relative activity of RPA is as follows Figure 7 As shown, the results indicated that the mutants V29P, F73P, S99K, A132K, S81R and S119F had significantly improved relative RPA activities compared with the wild type.

[0161] Example 7: Combination Mutation

[0162] (1) Mutation design

[0163] Based on the performance of the mutants obtained by virtual saturation mutation and consensus mutation, the mutation sites F73P, V29P, A132K, and S119F were further selected for experiments. Double-point mutation sites were designed: F73P+V29P, F73P+A132K, F73P+S119F, V29P+A132K, V29P+S119F, and A132K+S119F. The amino acid sequences of each mutant are shown in Table 16 below.

[0164] Table 16

[0165]

[0166] (2) Construction of recombinant plasmids for expressing mutants

[0167] The PCR amplification system and conditions were the same as in Example 4, and the primer sequences used are shown in Tables 13 and 15.

[0168] (3) Performance of mutants

[0169] Purified UvsY protein mutants were obtained according to the method of Example 2, and the protein concentration, protein yield and protein thermal stability were detected. The RPA activity and RPA relative activity of each mutant were detected according to the method of Example 6.

[0170] Figure 8 The results showed that the mutants F73P+V29P, F73P+A132K, F73P+S119F and A132K+S119F had significantly improved protein solubility compared with the wild type, and the mutants V29P+A132K and V29P+S119F had protein solubility basically equivalent to that of the wild type.

[0171] Figure 9 The results showed that the mutants F73P+V29P, F73P+A132K and F73P+S119F had significantly higher protein production than the wild type, and the mutants V29P+A132K, V29P+S119F and A132K+S119F also had higher protein production than the wild type.

[0172] Figure 10 and Figure 11 The results showed that the mutant F73P+V29P had a significantly higher relative RPA activity than the wild type, and the mutants F73P+A132K, F73P+S119F, V29P+A132K and V29P+S119F had relative RPA activities that were basically equivalent to those of the wild type.

[0173] Among them, the protein yield of the combined mutation F73P+V29P can reach 129 mg / (L fermentation liquid), which is significantly higher than the wild type (9.86 mg / (L fermentation liquid)); the protein concentration can reach 50 μg / μL, which is significantly higher than the wild type (3-6 μg / μL); the RPA activity is 37% higher than the wild type.

[0174] The technical solution of the present disclosure is not limited to the above-mentioned specific embodiments, and all technical variations made according to the technical solution of the present disclosure fall within the protection scope of the present disclosure.

Claims

1. A UvsY protein mutant, characterized in that: Relative to the wild-type UvsY protein, the UvsY protein mutant has a mutation at one or more of the amino acids at positions 29, 73, 74, 81, 99, 119, 126, 128, and 132 corresponding to SEQ ID NO:

4.

2. The UvsY protein mutant according to claim 1, characterized in that The UvsY protein mutants include one or more mutations of V29P, F73P, S74F, S81K, S81R, S99K, S119F, S119R, S119W, H126W, Q128I, and A132K. Preferably, the UvsY protein mutants include F73P+V29P mutation, F73P+A132K mutation, F73P+S119F mutation, V29P+A132K mutation, V29P+S119F mutation, or A132K+S119F mutation; Preferably, the wild-type UvsY protein has the amino acid sequence shown in SEQ ID NO:4, or an amino acid sequence having at least 80% sequence identity compared to SEQ ID NO:4, or an amino acid sequence shown in SEQ ID NO:4 with one or more amino acids added, deleted, substituted or modified; Preferably, the UvsY protein mutant has an amino acid sequence shown in one or more of SEQ ID NOs: 5-9, 11, 26-31 and 46-51.

3. The UvsY protein mutant according to claim 1 or 2, characterized in that Compared to the wild-type UvsY protein, the UvsY protein mutant has improved protein solubility, and / or improved protein yield, and / or improved thermal stability, and / or improved enzyme activity; Preferably, the enzyme activity is RPA enzyme activity.

4. A nucleic acid molecule encoding the UvsY protein mutant according to any one of claims 1 to 3.

5. A recombinant expression vector containing the nucleic acid molecule of claim 4.

6. A host cell, characterized in that The host cell contains the UvsY protein mutant according to any one of claims 1 to 3, the nucleic acid molecule according to claim 4, or the recombinant expression vector according to claim 5.

7. A composition comprising (i) the UvsY protein mutant of any one of claims 1 to 3, and (ii) one or more reagents selected from the group consisting of a buffer, a primer, a probe, a dye, a detection agent, a target nucleic acid, and a cell lysing agent; Preferably, the composition is in the form of a kit.

8. A method for preparing the UvsY protein mutant according to any one of claims 1 to 3, wherein The method comprises the following steps: (1) culturing the host cell according to claim 6; and (2) isolating the UvsY protein mutant from the host cell or from the growth medium or supernatant.

9. Use of the UvsY protein mutant according to any one of claims 1 to 3, the nucleic acid molecule according to claim 4, the recombinant expression vector according to claim 5, the host cell according to claim 6 or the composition according to claim 7 in enzyme preparation production, gene repair, DNA recombination, target gene detection or vaccine preparation; Preferably, the UvsY protein mutant is used for recombinase polymerase amplification reaction.

10. A method for producing a DNA molecule, comprising the step of using the UvsY protein mutant according to any one of claims 1 to 3; Preferably, the UvsY protein mutant is incubated with template DNA and primers; Preferably, the method is performed by a recombinase polymerase amplification reaction.

Images