Fvemi r172c gene for regulating anthocyanin accumulation in strawberry fruit and application thereof

By constructing overexpression and silencing vectors for the FvemiR172c gene, the accumulation of anthocyanins in strawberry fruits was regulated, solving the problem of unclear color regulation of strawberry fruits. This enabled the creation of white and pink strawberries and the improvement of the quality of red strawberries, providing a solution for molecular breeding.

CN119776349BActive Publication Date: 2026-04-07ANHUI AGRICULTURAL UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-20
Publication Date
2026-04-07

AI Technical Summary

Technical Problem

The regulatory mechanism of miR172 on anthocyanin accumulation in strawberry fruit is not yet clear in the existing technology, resulting in poor color regulation effect of strawberry fruit. Furthermore, white and pink strawberries are scarce in the market and have high prices, while it is difficult to improve the quality of red strawberries.

Method used

By constructing overexpression and silencing vectors for the FvemiR172c gene, the expression or activity of the FvemiR172c gene in strawberry fruit can be regulated. The FvemiR172c overexpression vector can be used to increase anthocyanin accumulation in strawberries, or the STTM-miR172 silencing vector can be used to inhibit anthocyanin accumulation in strawberries, thereby regulating the color of strawberry fruit.

Benefits of technology

Successfully regulating anthocyanin accumulation in strawberry fruits allows for the mass production of white and pink strawberries to increase their commercial value, or makes red strawberries even redder, thus improving their quality. This provides a molecular breeding method for controlling strawberry fruit color and anthocyanin content.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119776349B_ABST
    Figure CN119776349B_ABST
Patent Text Reader

Abstract

The present application relates to the technical field of plant molecular genetic engineering, and particularly relates to a FvemiR172c gene for regulating anthocyanin accumulation in strawberry fruits and application thereof.The nucleotide sequence of the FvemiR172c gene is shown as SEQ ID NO.1.The present application discloses the nucleotide sequence of the FvemiR172c gene for regulating anthocyanin content in strawberry fruits.Experiments show that the FvemiR172c gene or an expression vector containing the FvemiR172c gene can be applied to regulate anthocyanin content in strawberry fruits, and further regulate the color of strawberry fruits.The present application provides a new gene resource for creating different color strawberries and promoting / inhibiting anthocyanin accumulation.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of plant molecular genetic engineering technology, and in particular to a FvemiR172c gene that regulates anthocyanin accumulation in strawberry fruit and its application. Technical Background

[0002] Strawberries are popular with consumers due to their vibrant color, unique aroma, delicious taste, and high nutritional value. Anthocyanins, water-soluble pigments in the flavonoid family, give strawberry fruits, petals, and other tissues their vibrant colors and also influence fruit quality. They offer some protection against biotic and abiotic stresses in plants. Furthermore, anthocyanins possess antioxidant properties, capable of scavenging free radicals in the human body and thus having anti-aging effects. Therefore, optimizing anthocyanin content is an important breeding goal for horticultural crops, and elucidating the molecular mechanisms of anthocyanin accumulation has profound theoretical and practical application value.

[0003] miRNAs are a class of small, non-coding RNAs typically 20-24 nt in length, playing crucial roles in plant growth and development, and responses to biotic and abiotic stresses. miR172 is an important member of the miRNA family, playing a vital regulatory role in many processes, including growth stage transitions, flowering time, fruit ripening, and organ morphogenesis. Studies have shown that miR172 can regulate the ripening of the climacteric fruit, apple, through the ethylene pathway.

[0004] However, strawberries are typical non-climacteric fruits. Although patent CN107075500A discloses that miR172 can regulate the size of various fruits, including strawberries, this patent does not distinguish between climacteric fruits and does not provide actual data on the regulation of strawberry fruit size, leading to reduced reliability of the results. Therefore, whether and how members of the miR172 family regulate strawberry fruit development, especially their effects on quality indicators such as color and anthocyanins, remains to be elucidated. To date, there are no reports of miR172 affecting anthocyanin accumulation in strawberry fruits. Summary of the Invention

[0005] In order to solve the problems in the prior art, one of the objectives of the present invention is to provide a FvemiR172c gene that regulates the accumulation of anthocyanins in strawberry fruit, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0006] The second objective of this invention is to provide an application of the aforementioned FvemiR172c gene in regulating anthocyanin accumulation in strawberry fruit.

[0007] The third objective of this invention is to provide an application of the above-mentioned FvemiR172c gene in regulating strawberry fruit color.

[0008] Preferably, by inhibiting the expression or activity of the FvemiR172c gene, the accumulation of anthocyanins in strawberry fruit is increased and the reddening of strawberry fruit is promoted; or by increasing the expression or activity of the FvemiR172c gene, the accumulation of anthocyanins in strawberry fruit is reduced and the reddening of strawberry fruit is delayed.

[0009] Preferably, the expression of the FvemiR172c gene is suppressed by the silencing vector STTM-miR172, the sequence of which is shown in SEQ ID NO.2.

[0010] Preferably, the expression of the FveMIR172c gene is enhanced by an FveMIR172c overexpression vector, wherein the FveMIR172c overexpression vector is pK7WG2D-FvemiR172c, and the PCR product of the FveMIR172c gene is obtained by using “Ruegen” strawberry fruit cDNA as a template and then ligating it into the pK7WG2D vector.

[0011] The fourth objective of this invention is to provide a construct for increasing the expression level of the FvemiR172c gene in strawberries, wherein the construct contains the FvemiR172c gene as described above.

[0012] The fifth objective of this invention is to provide a construct for reducing or eliminating the expression of the FvemiR172c gene in strawberry, the construct containing a simulated target with an antisense complementary sequence to the mature form of the strawberry FvemiR172c gene.

[0013] The present invention also provides a host cell containing the construct described above.

[0014] Finally, this invention provides the application of the construct described above in regulating anthocyanin accumulation or color regulation in strawberry fruits.

[0015] The beneficial effects of this invention are as follows:

[0016] 1) This invention demonstrates through experiments of transient transformation in strawberry and stable transformation in Arabidopsis that miR172c can negatively regulate fruit coloring in strawberry and reduce anthocyanin accumulation in mature fruit. This application provides a candidate gene for molecular breeding work to regulate strawberry fruit color and anthocyanin content in fruit.

[0017] 2) Most commercially available strawberries are red. In recent years, white and pink strawberries have appeared on the market, and due to their scarcity, they are priced much higher than ordinary red strawberries. According to the method provided in this application, by increasing the expression or activity of the FvemiR172c gene in strawberries, the accumulation of anthocyanins in strawberries can be inhibited, making the color of ripe strawberries lighter. This allows for the mass production of white and pink strawberries, increasing their commercial value and showing great commercial potential.

[0018] 3) According to the method provided in this application, by inhibiting the expression or activity of the FvemiR172c gene in strawberries, the accumulation of anthocyanins in strawberries can be increased, making the strawberries turn red at maturity and improving the market quality of red strawberry varieties. Attached Figure Description

[0019] Figure 1 This study analyzes the phenotype of FveMIR172 transgenic Arabidopsis thaliana and the relative expression level of FveMIR172 in transgenic Arabidopsis thaliana in Example 1 of this application.

[0020] Figure 2 The phenotypic changes in Arabidopsis thaliana overexpressed with WT and MIR172c in Example 1 of this application are shown.

[0021] Figure 3 This is a schematic diagram of the STTM-miR172 and miRNA binding model in Example 2 of this application.

[0022] Figure 4 The figures show the experimental results of FveMIR172c inhibiting the accumulation of anthocyanins in strawberries in Example 3 of this application. Figure A shows the comparison of the peel color between the experimental group and the control group, Figure B shows the expression level of FveMIR172c in the fruit, and Figure C shows the anthocyanin content in the fruit.

[0023] Figure 5 The figures show the experimental results of FveMIR172c-STTM promoting anthocyanin accumulation in strawberries in Example 3 of this application. Figure A shows the comparison of peel color between the experimental group and the control group, Figure B shows the expression level of FveMIR172c in the fruit, Figure C shows the anthocyanin content in the fruit, and Figure D shows the anthocyanin extraction results in the fruit. Detailed Implementation

[0024] To facilitate understanding, the technical solution of the present invention will be described in more detail below with reference to embodiments:

[0025] Example 1

[0026] FveMIR172c binary expression vector and Arabidopsis genetic transformation

[0027] Construction of the FveMIR172c binary expression vector: The binary expression vector pH7LIC1.0 was linearized by digesting the restriction endonuclease (Stu1) and used directly for subsequent applications. Then, using high-fidelity Phanta as a template, the FveMIR172c fragment was amplified using primers FveMIR172c-F: AC TAGTTCCAGGGCGCCCGGGCTAATCCGTTCTGAATGAATCTATG and FveMIR 172c-R: ATCATCGACCCGACGCCCGGGCAAAGCGACCAGCAAGAATCACG. The FveMIR172c target gene fragment was then ligated into pH7LIC1.0 using homologous recombinase to obtain the pH7LIC1.0-FveMIR172c vector.

[0028] The ligation product was introduced into *E. coli* using a heat shock method and plated with LB + 50 mg / L solution. -1 Spectinomycin. Positive clones were identified by PCR and sequenced to obtain single clones with perfectly matched nucleotide sequences. Plasmid DNA was extracted from these single clones and introduced into Agrobacterium GV3101 to obtain Agrobacterium containing the recombinant vector pH7LIC1.0-FveMIR172c, which was then used to infect Arabidopsis thaliana. After Arabidopsis seed harvest, positive seedlings were screened using tissue culture and antibiotics, and molecular biological analysis was performed on the transgenic Arabidopsis.

[0029] Experimental results:

[0030] See Figures 1-2 . Figure 1 This study analyzed the phenotype of FveMIR172 transgenic Arabidopsis thaliana and the relative expression level of FveMIR172 in transgenic Arabidopsis thaliana. The results showed that, among the positive Arabidopsis thaliana plants, at the same planting time, the flowering time of Arabidopsis thaliana overexpressing MIR172c was significantly earlier than that of wild-type Arabidopsis thaliana. The bolting time was also correspondingly earlier, and the number of rosette leaves in the overexpressing Arabidopsis thaliana plants was significantly reduced, until later, only 1-2 rosette leaves fell off. This is consistent with previous research results, verifying that MIR172c overexpression can regulate the growth period transition of Arabidopsis thaliana and affect leaf development. Next, three phenotypically distinct transgenic Arabidopsis thaliana plants were selected for qRT-PCR analysis to determine the expression level of MIR172c. In the Arabidopsis thaliana plants overexpressing MIR172c, the expression level of MIR172c was significantly increased, approximately 2-3 times higher than that of wild-type Arabidopsis thaliana.

[0031] Figure 2Phenotypic changes in Arabidopsis thaliana overexpressed with WT and MIR172c were observed. It was found that after high-concentration sucrose treatment, anthocyanin accumulation was significant in both wild-type Arabidopsis seedlings and plants, especially on the undersides of leaves and stems, where a distinct red color appeared. In contrast, MIR172c-overexpressed Arabidopsis plants showed only minimal anthocyanin accumulation in a small area of ​​the leaves, with no significant anthocyanin accumulation observed in other tissues. This indicates that MIR172c effectively inhibits anthocyanin accumulation in Arabidopsis thaliana, but it cannot completely suppress anthocyanin accumulation.

[0032] Experiments show that the FveMIR172c target gene fragment extracted in this application is an effective fragment, and FveMIR 172c can regulate anthocyanin accumulation.

[0033] Example 2

[0034] Construction of FveMIR172c overexpression vector and STTM silencing vector

[0035] Construction of FveMIR172c overexpression vector: A two-step method was used. First, homologous recombination was performed using the pENT1A vector, and then the vector was constructed using the Gateway system. The procedure is as follows:

[0036] Using cDNA from the fruit of "Ruegen" (a diploid red forest strawberry) as a template, the full-length FveMIR172c gene was amplified and ligated into the intermediate vector pENT1A via homologous recombination. The sequence of FveMIR172c (including the precursor sequence) is shown in SEQ ID NO.1. After positive clone selection and routine sequencing, the constructed vector was subjected to an LR reaction with the overexpression vector pK7WG2D. The reaction product was transferred to competent E. coli cells and cultured overnight at 37°C. After PCR verification, the plasmid was transferred to Agrobacterium and cultured at 28°C for 3 days. Single colonies grew and were then verified by PCR.

[0037] Construction of the STTM silencing vector for FveMIR172c: The STTM-miR172 sequence was designed using the structure of the existing STTM interference system. The middle of the sequence is a spacer sequence with a hairpin structure and containing 48 nucleotides (Spacr sequence: GTTGTTGTTGTTATGGTCTAATTTAAATATGGTCTA AAGAAGAAGAAT). On both sides of the spacer are target mimics with antisense complementary sequences of the mature diploid strawberry miR172.

[0038] A mismatched loop of three CTA bases is added between nucleotides 11 and 12 of the Target Mimics sequence to prevent cleavage by the AGO protein in the strawberry RISC complex, thus allowing the STTM system to function properly as an interference device. The spacer and the Target Mimics sequences on both sides together form the STTM-miR172 sequence.

[0039] The full-length sequence of STTM-miR172 is 5'-CTGCAGCATCACTATCAAGATTCCGTTG TTGTTGTTATGGTCTAGTTGTTGTTGTTATGGTCTAATTTAAATATGGTCTAA AGAAGAAGAATATGGTCTAAAGAAGAAGAATCTGCAGCATCACTATCAAG ATTCC-3' (SEQ ID NO.2).

[0040] The STTM-miR172 sequence was ligated into the intermediate vector pENT1A using homologous recombination. After positive single-clone selection and routine sequencing, the plasmid was extracted and ligated into the final vector pK7WG2D via LR reaction. The plasmid was then transformed into competent E. coli and competent Agrobacterium cells, and positive colonies were verified by PCR.

[0041] Figure 3 This is a schematic diagram of the model of STTM-miR172 and miRNA binding.

[0042] Example 3

[0043] Strawberry instant transformation

[0044] Strawberries were transiently injected with the overexpression vector and STTM vector obtained in Example 2. Strawberry fruits with transient expression were collected for qRT-PCR experiments and anthocyanin content determination.

[0045] The specific steps are as follows:

[0046] 1) Pick a single colony into 6 ml of resistant liquid LB (LB + Gent 50 μg / ml + Rif 50 μg / ml + Kam 50 μg / ml or Spe 50 μg / ml), and incubate overnight at 28°C with shaking until the bacterial OD reaches 0.8-1.0;

[0047] 2) Take 2 ml of bacterial culture into a centrifuge tube and centrifuge at 5000 rpm for 5 min;

[0048] 3) Resuspend the bacterial culture in liquid MS containing 2% sucrose to achieve an OD value of 0.8;

[0049] 4) Select fruits that are white-ripe. Use a 1ml syringe to draw up the bacterial solution and insert the needle tip into the core of the fruit to inject it into the fruit until the injection solution seeps out of the fruit surface. 1ml of bacterial solution can be injected into 5-8 fruits. Mark them and observe the results about a week after injection.

[0050] 5) Inject each gene into at least 10 fruits. The injection of blank buffer is named WT. Each experimental group has three biological replicates, named #1, #2, and #3 respectively.

[0051] Anthocyanin content determination

[0052] Weigh 0.5g of transiently transformed strawberry fruit, add liquid nitrogen and grind into powder. Add 5ml of methanol:water:formic acid:trifluoroacetic acid (70:27:2:1) extraction solution and place in a 4℃ refrigerator in the dark for 12 hours. Filter the supernatant coarsely with filter paper and set aside. Measure the absorbance of the extraction solution at 530nm and 657nm using a UV spectrophotometer (Hoefer Vision, SP-2001).

[0053] Total anthocyanin content = (A530 – 0.25 * A657) / M, where A530 and A657 refer to the absorbance values ​​at 530 nm and 657 nm, respectively, and M refers to the fresh weight of the fruit. Significant differences were analyzed using IBM SPSS Statistis 22 software; * represents P < 0.05, and ** represents P < 0.01.

[0054] Experimental results:

[0055] See Figures 4-5 . Figure 4 Results of FveMIR172c inhibiting anthocyanin accumulation in strawberries. See also Figure 4 In the intermediate A group, the strawberry fruit after transient transformation showed a significantly lighter peel color compared to the blank control, and the expression level of FveMIR172c in the fruit was significantly increased. Figure 4 The expression level of anthocyanin B in the injected strawberry fruit was about three times higher than that in the control group. The anthocyanin content in the fruit was then measured, and the results showed a significant decreasing trend in anthocyanin content. Figure 4 (C). Therefore, it is speculated that MIR172c can inhibit the accumulation of strawberry anthocyanins.

[0056] Figure 5 The results of the experiment on the promotion of anthocyanin accumulation in strawberries by FveMIR172c-STTM show that after silencing the expression of MIR172c, the strawberry fruit peel color was redder compared to the control group. Furthermore, silencing the expression of MIR172c significantly reduced its expression level. Figure 5 In the control group (B), the anthocyanin content was significantly higher than that in the fruit overexpressing FveMIR172c, and the anthocyanin content was slightly higher than that in the blank control group. Figure 5 (C, D)

[0057] The results show that overexpression of FveMIR172c can inhibit the accumulation of anthocyanins in strawberry fruits, while silencing FveMIR172c can promote the accumulation of anthocyanins in strawberry fruits. Therefore, FveMIR172c can be used to regulate the anthocyanin content in strawberry fruits.

[0058] The above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A FvemiR172c gene that regulates anthocyanin accumulation in strawberry fruit, characterized in that, The nucleotide sequence of the FvemiR172c gene is shown in SEQ ID NO.

1.

2. An application of the FvemiR172c gene as described in claim 1 in regulating anthocyanin accumulation in strawberry fruit, characterized in that, The expression of the FvemiR172c gene was inhibited by the silencing vector STTM-miR172, thereby increasing the accumulation of anthocyanins in strawberry fruits. The sequence of STTM-miR172 is shown in SEQ ID NO.

2. Alternatively, the expression of the FvemiR172c gene was increased by the FveMIR172c overexpression vector, thereby decreasing the accumulation of anthocyanins in strawberry fruits. The FveMIR172c overexpression vector was pK7WG2D-FvemiR172c. The PCR product of the FveMIR172c gene was obtained using "Ruegen" strawberry fruit cDNA as a template and then ligated into the pK7WG2D vector.

3. An application of the FvemiR172c gene as described in claim 1 in regulating strawberry fruit color, characterized in that, The expression of the FvemiR172c gene was inhibited by the silencing vector STTM-miR172 to promote the reddening of strawberry fruits. The sequence of STTM-miR172 is shown in SEQ ID NO.

2. Alternatively, the expression of the FvemiR172c gene was increased by the FvemiR172c overexpression vector to delay the reddening of strawberry fruits. The FvemiR172c overexpression vector was pK7WG2D-FvemiR172c. The PCR product of the FvemiR172c gene was obtained using "Ruegen" strawberry fruit cDNA as a template and then ligated into the pK7WG2D vector.

4. A construct for increasing the expression level of the FvemiR172c gene in strawberry, characterized in that, It contains the FvemiR172c gene as described in claim 1.

5. A construct for reducing or eliminating FvemiR172c gene expression in strawberries, characterized in that, The silencing vector STTM-miR172, which suppresses the expression of the FvemiR172c gene, has the sequence shown in SEQ ID NO.

2.

6. The application of the construct as described in claim 4 or 5 in regulating anthocyanin accumulation or color regulation in strawberry fruit, characterized in that, By using constructs that reduce or eliminate the expression of the FvemiR172c gene in strawberries, the accumulation of anthocyanins in strawberry fruits can be increased and the reddening of strawberry fruits can be promoted; or by using constructs that increase the expression of the FvemiR172c gene in strawberries, the accumulation of anthocyanins in strawberry fruits can be reduced and the reddening of strawberry fruits can be delayed.

Citation Information

Patent Citations

  • Application of microRNA172 to regulation of plant height, ear type and leaf size of rice

    CN106701756A

  • Methods and materials for producing fruit of altered size

    CN107075500A