Circular RNA for targeted inhibition of fish nervous necrosis virus replication and preparation method and application thereof

Abstract

The invention relates to circular RNA for targeted inhibition of fish nervous necrosis virus replication and a preparation method and application of the circular RNA, the circular RNA is NNV-circRNA-1, the nucleotide sequence of the circular RNA is shown as SEQ ID NO: 1, and the circular RNA is prepared by cyclizing linear NNV-circRNA-1 through T4 RNA ligase 1 and then removing residual linear RNA in a reaction system through RNase R enzyme. The circular RNA prepared by adopting the method is good in stability and high in purity, the NNV-circRNA-1 and NNV-RdRp protein have relatively strong binding capacity, replication of NNV viruses can be effectively inhibited, and the circular RNA can be used for preparing vaccines, antiviral drugs and other biological immune products of fish nervous necrosis viruses in the field of aquaculture.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to a circular RNA for targeted inhibition of fish neuronecrosis virus replication, and a preparation method and application thereof. Background Art

[0002] Fish Nervous Necrosis Virus (NNV) is a highly pathogenic RNA virus that causes significant economic losses to the global aquaculture industry. Viral nervous necrosis (VNN) caused by NNV virus infection is a Class II infectious disease that is prevalent in marine fish in almost all regions of the world except the Americas and Africa. The mortality rate for fry and young fish is extremely high, with a mortality rate of up to 100% within a week in severe cases. In recent years, the number of infected fish species and the degree of damage have increased rapidly. NNV virus belongs to the Nodaviridae family and has a single-stranded positive-strand RNA genome composed of two main single-stranded RNA segments: RNA1 is mainly responsible for encoding RNA polymerase (RNA-dependentRNA polymerase, RdRp), while RNA2 encodes the virus's only structural protein, the capsid protein (CP). In addition, some NNV strains also produce a subgenome RNA3 that encodes two non-structural proteins, B1 and B2.

[0003] NNV poses a serious threat to many farmed fish species with its rapid spread and high mortality rate, and causes huge economic losses. NNV mainly infects the central nervous system and retinal nervous system of fish, and can cause mass mortality of larvae and juvenile populations of many marine fish. Fish neuronecrosis viruses are sensitive to environmental factors, such as temperature and pH, which affect the stability and infectivity of the virus. They can induce metabolic reprogramming of host cells to meet the needs of viral replication and trigger a series of immune responses in the host. The viral neuronecrosis disease caused by NNV has caused serious economic losses to aquaculture fish. Therefore, the development of effective prevention and control measures, such as vaccines, antiviral drugs and biological immune products, is crucial to ensure the sustainable development of the aquaculture industry.

[0004] In recent years, circular RNA (circRNA), as a new type of non-coding RNA molecule, has shown an important role in regulating gene expression, participating in RNA-protein interactions, and serving as a disease marker. CircRNA has a unique closed circular structure and exhibits higher stability and longer half-life in cells compared to linear RNA. In the study of NNV, the application of circular RNA technology provides a new perspective for understanding the interaction between viruses and hosts, and may provide a potential tool for developing new therapeutic strategies. Summary of the invention

[0005] The present invention aims to solve the above problems and provides a circular RNA for inhibiting the replication of fish neural necrosis virus in a targeted manner and a preparation method and application thereof.

[0006] The present invention adopts the following technical scheme: a circular RNA that targets and inhibits the replication of fish neural necrosis virus, wherein the circular RNA is NNV-circRNA-1, and the nucleotide sequence is shown in SEQ ID NO:1.

[0007] SEQ ID NO: 1: GGGUAACAUCACCUUCUUGCUCUGUUGAGUAAUCACUUACGCAAGGUUACCGUUCAGCUUAGACAACGACAAGUCUACGCCAAGCUUGGUACCGAGCUCGG.

[0008] A method for preparing circular RNA for targeted inhibition of fish neural necrosis virus replication comprises the following steps: (1) Analyze the viral NNV genome sequence and design primers NNV-circRNA-1-F and NNV-circRNA-1-R for annealing to form a double-stranded DNA template. T7 RNA polymerase and the double-stranded DNA template are used for T7 RNA transcription to obtain linear RNA, which is then purified by ethanol precipitation. (2) Circularization: Use T4 RNA ligase 1 to circularize the purified linear RNA and purify it; (3) RNase R was used to remove the residual linear RNA, and the circularized RNA was purified again by ethanol precipitation to obtain the circular RNA: NNV-circRNA-1.

[0009] Furthermore, the nucleotide sequence of the primer NNV-circRNA-1-F in step (1) is shown in SEQ ID NO: 2.

[0010] SEQ ID NO:2: TAATACGACTCACTATAGGGUAACAUCACCUUCUUGCUCUGUUGAGUAAUCACUUACGCAAGGUUACC.

[0011] Furthermore, the nucleotide sequence of the primer NNV-circRNA-1-R in step (1) is shown in SEQ ID NO: 3.

[0012] SEQ ID NO:3: CCGAGCTCGGTACCAAGCTTGGCGTAGACTTGTCGTTGTCTAAGCTGAACGGTAACCTTGCGTAAGTG.

[0013] A circular RNA preparation for targeted inhibition of fish neural necrosis virus replication, wherein the prepared circular RNA is loaded onto a lipid nanocarrier, the mass ratio of the circular RNA to the lipid nanocarrier is 1:10, and an NNV-circRNA-1 circular RNA preparation is obtained.

[0014] Furthermore, the preparation method of the lipid nanocarrier is: 4-(N,N-dimethylamino)butyric acid (dilinoleyl) methyl ester DLin-MC3-DMA, distearoylphosphatidylcholine DSPC, cholesterol and DMG-PEG2000 are mixed in a mass ratio of 5:1:3.8:0.2 and added into an ethanol solution to prepare a lipid nanocarrier.

[0015] The invention discloses an application of a circular RNA preparation for inhibiting the replication of fish nervous necrosis virus in a targeted manner, and is used for the preparation of vaccines and antiviral drugs for fish nervous necrosis virus.

[0016] The NNV viral genome consists of two single-stranded RNA segments, RNA1 encodes the nonstructural protein RdRp (NNV-RdRp), and RNA2 encodes the main structural protein CP. The replication mechanism of NNV involves the virus entering the host cell through endocytosis, releasing the RNA genome, and using the host cell's machinery for replication and transcription. RdRp plays a central role in viral replication. It anchors on the mitochondrial membrane of the host cell through its mitochondrial membrane localization signal and is able to activate and bind to the glucose-regulated protein GRP78 in the endoplasmic reticulum. This process triggers the endoplasmic reticulum stress response, which in turn activates caspase-12, promotes PERK phosphorylation, and reduces the expression of the Bcl-2 gene, thereby providing favorable conditions for viral transcription and replication. Therefore, the normal binding of the RdRp protein to the viral positive-strand RNA template is essential for the correct replication and transcription of the NNV virus.

[0017] In the present invention, a circular RNA molecule that can bind to NNV-RdRp protein was initially designed, and then optimized by Alphafold3 software and verified by interaction experiments such as RNA-pulldown. Finally, a circular RNA molecule with strong binding ability to NNV-RdRp protein was designed, and it was named circular RNANNV-circRNA-1. The RNA pulldown molecular interaction experiment proved that circular RNANNV-circRNA-1 has a strong binding ability with NNV-RdRp protein.

[0018] Beneficial effects of the present invention: The circular RNA prepared by the present invention: NNV-circRNA-1 has a strong binding ability with NNV-RdRp protein, good stability and high purity. The circular RNA preparation can significantly reduce the virus titer by more than 90% in cell culture and reduce the mRNA level of NNV virus in both NNV post-exposure treatment and pre-exposure prevention, providing a new disease prevention and control technical means for fish farming industry, and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 Schematic diagram of the cyclization process of NNV-circRNA-1 of the present invention.

[0020] Figure 2 Schematic diagram of the direct interaction between NNV-circRNA-1 and NNV-RdRp protein of the present invention.

[0021] Figure 3 This is a gel electrophoresis analysis diagram of NNV-circRNA-1 and linear RNA of the present invention.

[0022] Figure 4 This is a diagram showing the effect of the NNV-circRNA-1 circular RNA preparation of the present invention on treatment after NNV virus exposure.

[0023] Figure 5 This is a diagram showing the effect of the NNV-circRNA-1 circular RNA preparation of the present invention on pre-exposure prevention of NNV virus.

[0024] Figure 6 This is the effect of the NNV-circRNA-1 circular RNA preparation of the present invention on the expression level of NNV virus mRNA during post-exposure treatment.

[0025] Figure 7 This is a diagram showing the effect of the NNV-circRNA-1 circular RNA preparation of the present invention on the expression level of NNV virus mRNA during pre-exposure prevention.

[0026] Figure 8Schematic diagram of NNV-circRNA-1 stability detection of the present invention. DETAILED DESCRIPTION

[0027] In order to enable those skilled in the art to better understand the solutions of the present invention, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the accompanying drawings in the embodiments of the present invention.

[0028] Carp epithelial cells (EPC cells) are a cell model widely used in fish immunology and virology research. EPC cells adhere to the wall and grow in a cell culture medium in a constant temperature incubator at 5% CO2 and 28°C. Medium 199 medium (Invitrogen) containing 10% fetal bovine serum, 100U / ml penicillin and 100mg / ml streptomycin is used as the cell culture medium for EPC cells; medium 199 medium containing only 2% fetal bovine serum is used as the cell maintenance medium during virus culture.

[0029] The Nervous Necrosis Virus (NNV) in the present invention is stored in the National Aquatic Animal Pathogen Bank of the Ministry of Agriculture and Rural Affairs. Embodiment 1:

[0030] 1. Preparation of NNV-circRNA-1 circular RNA: Its nucleotide sequence is GGGUAACAUCACCUUCUUGCUCUGUUGAGUAAUCACUUACGCAAGGUUACCGUUCAGCUUAGACAACGACAAGUCUACGCCAAGCUUGGUACCGAGCUCGG.

[0031] (1) First, primers NNV-circRNA-1-F, whose sequence is shown in SEQ ID NO:2, and primers NNV-circRNA-1-R, whose sequence is shown in SEQ ID NO:3, are annealed to form a double-stranded DNA template. The specific steps are as follows: NNV-circRNA-1-F 10 μL (100 μM), NNV-circRNA-1-R 10 μL (100 μM), annealed according to the following procedure, 95°C for 5 min, 94°C-46°C (cooling at a rate of 1°C / min), 46°C-26°C (cooling at a rate of 2°C / min), stored at 4°C, and T7 RNA polymerase and the DNA template annealed above are used to perform T7 RNA transcription of linear RNA. The specific steps are as follows: DNA template 1 μg, T7 transcription buffer 2 μL, NTP mixture (10 mM) 4 μL, T7 RNA polymerase (1 kU / μl) 0.1 μL, add nuclease-free pure water to 20 μL, and incubate at 37°C for 120 minutes; (2) After the reaction is completed, the transcribed linear RNA is purified by ethanol precipitation. The specific steps are as follows: first, add 160 μL of nuclease-free pure water to expand the reaction volume to 180 μL, then add 20 μL of 3M sodium acetate (pH 5.2) or 20 μL of 5M ammonium acetate and mix thoroughly; add an equal volume of phenol / chloroform mixture (1:1) to extract once (vortex mix for 20-30 seconds, then centrifuge at 14000g for 5-10 minutes to obtain the supernatant), and then extract with chloroform 1-2 times (vortex mix for 20-30 seconds each time, then centrifuge at 14000g for 5-10 minutes to obtain the supernatant). Precipitate the RNA with double volume of anhydrous ethanol and incubate at -20°C for at least 30 minutes. Then centrifuge at 14000g at 4°C for 5-10 minutes to precipitate the RNA. Discard the supernatant, wash the precipitate with 500 μL of pre-cooled 70% ethanol, and resuspend and dissolve the RNA with 20 μL of nuclease-free pure water; (3) Use T4 RNA ligase 1 to circularize the purified linear RNA. The specific steps are as follows: take 20 µM linear RNA, 2 µL T4 RNA ligase buffer, 1 µL 1 mM ATP, and 1 µL T4 RNA ligase 1, add nuclease-free pure water to 20 µL, incubate at 37 °C for 1 hour, and purify the circularized RNA using the ethanol precipitation method mentioned above.

[0032] (4) Use RNase R enzyme to remove the residual linear RNA in the above reaction system. Take 20 μL of the above purified RNA and 3 μL of RNase R enzyme buffer, add nuclease-free pure water to 30 μL, incubate at 37°C for 30 minutes, and then purify the circularized RNA according to the above ethanol precipitation method to finally obtain the purified NNV-circRNA-1.

[0033] The process of NNV-circRNA-1 from linear to circular Figure 1 As shown by Figure 1 It can be seen that the linear RNA is formed by reverse splicing of the linker sequence 1, shown in SEQ ID NO:4 (CCAAGCUUGGUACCGAGCUCGG) and the linker sequence 2 (GGGUAA). During the preparation process, the residual linear RNA in the reaction system was removed by RNase R enzyme. Figure 3 It can be seen from the gel electrophoresis diagram that after the linear RNA is treated with RNase R, the RNA band disappears, while the circular RNA band still exists after the RNase R treatment, and the concentration is similar to the RNA concentration before the RNase R treatment, indicating that the circular RNA has been successfully synthesized in the present invention.

[0034] Depend on Figure 2 It can be seen that the NNV-circRNA-1 prepared by the present invention has a strong binding ability with the NNV-RdRp protein, so it can be seen that NNV-circRNA-1 has the potential to target and inhibit the replication of the NNV virus.

[0035] 2. Preparation of circular RNA preparations: 4-(N,N-dimethylamino)butyric acid (dilinoleyl) methyl ester DLin-MC3-DMA, distearoylphosphatidylcholine DSPC, cholesterol, and DMG-PEG2000 were mixed in a mass ratio of 5:1:3.8:0.2 and added to an ethanol solution to prepare a lipid carrier. The lipid carrier and the circular RNA solution were mixed in a volume ratio of 1:4 through a microfluidic chip to prepare a circular RNA-LNP solution (the mass ratio of circular RNA to nanolipid material was 1:10), and then the ethanol was removed by a tangential flow system to obtain a circular RNA lipid nanoparticle preparation, namely, the NNV-circRNA-1 circular RNA preparation. Embodiment 2:

[0036] Effect of NNV-circRNA-1 circular RNA preparation on NNV virus titer in post-exposure treatment and pre-exposure prevention: 1. Effect of post-exposure therapy on viral titer: EPC cells in the logarithmic growth phase were taken and digested with trypsin solution, and then diluted with cell culture medium (without adding double antibody) to a cell density of 2.5×10 5cells / ml to form a cell suspension, add the above cell suspension into a 12-well cell culture plate at 1 ml / well, then add the NNV virus solution into the cell culture plate containing the EPC cell suspension at MOI=0.1 / well, set up a negative control at the same time, and culture in a cell culture incubator with a CO2 volume content of 5% and a temperature of 28°C.

[0037] After culturing the cells for 24 h, the supernatant was discarded, the cells were rinsed with sterile PBS, and then 1 ml of cell culture medium was added per well. Then the prepared NNV-circRNA-1 circular RNA preparation was added to the EPC cells. After 48 h of transfection, the cell supernatant of each well was collected. The cells were maintained with 10% PBS. 1 , 10 2 , 10 3 , 10 4 , 10 5 , 10 6 , 10 7 , 10 8 Serially dilute the cell supernatant obtained in the previous step by multiple times to obtain gradient concentration virus dilution solutions; EPC cells in the logarithmic growth phase were taken and digested with trypsin solution, and then diluted with cell culture medium (without adding double antibody) to a cell density of 2.5×10 5 cells / ml to form a cell suspension. The cell suspension was added to a 96-well cell culture plate at 0.1 ml / well, and the cell culture plate was placed in a cell culture incubator for culture. The CO2 volume content in the cell culture incubator was 5% and the temperature was 28°C. After culturing the cells for 24 hours, the culture medium in the 96-well cell culture plate was removed and the cell suspension was added to a 96-well cell culture plate at 10 1 , 10 2 , 10 3 , 10 4 , 10 5 , 10 6 , 10 7 , 10 8 The virus dilutions of different concentrations obtained by multiple dilution were added to the cell culture plates containing cells at 0.1 ml / well, and each concentration was repeated 3 wells. After 48 hours of cell culture, the cytopathic effect was observed and recorded, and the virus titer was calculated.

[0038] The results are as follows Figure 4 It is knowable.

[0039] 2. Effect on virus titer in pre-exposure prophylaxis: Take EPC cells in the logarithmic growth phase. Digest the cells with trypsin and then dilute them with cell culture medium to a cell density of 2.5×10 5The cell suspension was added into a 12-well cell culture plate at 1 ml / well and placed in a cell culture incubator for culture. The CO2 volume content in the cell culture incubator was 5% and the temperature was 28°C.

[0040] After 24 hours of cell culture, discard the supernatant in the above 12-well cell culture plate, rinse it with sterile PBS, and then add cell culture medium at 1 ml / well. Then add the prepared NNV-circRNA-1 circular RNA preparation into the above EPC cells. After 24 hours of transfection, discard the supernatant in the above cell culture plate and rinse it with sterile PBS. Add NNV virus venom to the cell culture plate with EPC cells at MOI = 0.1 / well, set up a negative control at the same time, and culture it in a CO2 incubator with a CO2 volume content of 5% and a temperature of 28°C. After 48 hours of culture, collect the cell supernatant of each well and use cell maintenance solution at 10 1 , 10 2 , 10 3 , 10 4 , 10 5 , 10 6 , 10 7 , 10 8 The cell supernatant obtained by multiple dilutions was used to obtain virus dilutions with gradient concentrations; EPC cells in the logarithmic growth phase were taken and digested with trypsin solution, and then diluted with cell culture medium to a cell density of 2.5×10 5 cells / ml to form a cell suspension. The cell suspension was added to a 96-well cell culture plate at 0.1 ml / well, and the cell culture plate was placed in a cell culture incubator for culture. The CO2 volume content in the cell culture incubator was 5% and the temperature was 28°C. After culturing the cells for 24 hours, the culture medium in the 96-well cell culture plate was removed and the cell suspension was added to a 96-well cell culture plate at 10 1 , 10 2 , 10 3 , 10 4 , 10 5 , 10 6 , 10 7 , 10 8 The virus dilutions of different concentrations obtained by serial dilution were added to the cell culture plate containing cells at 0.1 ml / well, and each concentration was repeated 3 wells. After 48 hours of cell culture, the cytopathic effect was observed and recorded, and the virus titer was calculated. The results are as follows Figure 5 shown.

[0041] In order to verify the effect of NNV-circRNA-1 circular RNA preparation in inhibiting viral replication, we first tested the therapeutic effect of NNV-circRNA-1 circular RNA preparation on cells after NNV virus exposure. Figure 4 It can be seen that compared with the control group, the NNV virus titer in cells transfected with NNV-circRNA-1 circular RNA preparation was significantly reduced, and the virus titer was reduced by more than 90%. At the same time, the preventive effect of NNV-circRNA-1 circular RNA preparation before NNV virus exposure was also tested, and it was found that it could also significantly reduce the virus titer. Figure 5 It can be seen that the NNV virus titer was reduced by about 90% compared with the control group.

[0042] In summary, the NNV-circRNA-1 circular RNA preparation is suitable for post-exposure treatment and pre-exposure prevention of fish neuronecrosis virus, and can significantly reduce the virus titer in cell culture by more than 90%. Embodiment three:

[0043] Effect of NNV-circRNA-1 circular RNA preparation on NNV virus mRNA expression level: 1. Effect of NNV-circRNA-1 circular RNA preparation on NNV virus mRNA expression during post-exposure therapy: EPC cells in the logarithmic growth phase were digested with trypsin and then diluted with cell culture medium (without adding double antibody) to a cell density of 2.5×10 5 cells / ml to form a cell suspension. The above cell suspension was added to a 12-well cell culture plate at 1 ml / well, and then the NNV virus solution was added to the cell culture plate containing the EPC cell suspension at MOI = 0.1 / well. A negative control was set at the same time, and the cells were cultured in a cell culture incubator with a CO2 volume content of 5% and a temperature of 28°C.

[0044] After culturing the above cells for 24 hours, the supernatant in the cell culture plate was discarded, the plates were rinsed once with sterile PBS, and then cell culture medium was added at 1 ml / well; the prepared NNV-circRNA-1 circular RNA preparation was then added to the above EPC cells.

[0045] After 48 hours of cell transfection, the supernatant in the cell culture plate was discarded and rinsed with sterile PBS; then 1 ml of Trizol lysis solution was added to each well for lysis at room temperature for 10 minutes, and then RNA was extracted using a total RNA extraction kit (Kangwei Century). The total RNA was reverse transcribed using a full-length cDNA single-strand synthesis kit (Novozyme). The mRNA level of the NNV virus RdRp gene was then detected using a universal high-sensitivity dye quantitative PCR detection kit and primers (NNV-RdRp-RT-1F: 5'-ATAGTCTGGCGGATTTTC-3', as shown in SEQ ID NO: 5. NNV-RdRp-RT-1R: 5'-TCGGGAGCACACATACAT-3' as shown in SEQ ID NO: 6).

[0046] The results are as follows Figure 6 It can be seen that in the treatment after NNV virus exposure, the NNV-circRNA-1 circular RNA preparation significantly reduced the level of NNV virus mRNA (RdRp gene), and the mRNA expression of the NNV-RdRp gene in cells transfected with the NNV-circRNA-1 circular RNA preparation was reduced by about 80% compared with the control group.

[0047] 2. Effect of NNV-circRNA-1 circular RNA preparation on NNV virus mRNA expression in pre-exposure prevention: Take EPC cells in the logarithmic growth phase, digest the cells with the corresponding digestion solution, and then dilute them with cell culture medium to a cell density of 2.5×10 5 The cell suspension was added into a 12-well cell culture plate at 1 ml / well and placed in a cell culture incubator for culture. The CO2 volume content in the cell culture incubator was 5% and the temperature was 28°C.

[0048] After 24 hours of cell culture, the supernatant in the 12-well cell culture plate was discarded, rinsed with sterile PBS, and then cell culture medium was added at 1 ml / well. Then the prepared NNV-circRNA-1 circular RNA preparation was added to the above EPC cells. After 24 hours of transfection, the supernatant in the above cell culture plate was discarded and rinsed with sterile PBS. The NNV virus venom was added to the cell culture plate with EPC cells at MOI = 0.1 / well, and a negative control was set up at the same time. It was placed in a CO2 incubator for culture, and the CO2 volume content of the CO2 incubator was 5% and the temperature was 28°C.

[0049] After the cells were cultured for 48 hours, the supernatant in the cell culture plate was discarded and the plates were rinsed with sterile PBS; then 1 ml of Trizol lysis buffer was added to each well for lysis at room temperature for 10 minutes, and then RNA was extracted using a total RNA extraction kit (Kangwei Century). The total RNA was reverse transcribed using an efficient second-generation full-length cDNA single-strand synthesis kit (Novozymes). The mRNA level of the NNV virus RdRp gene was then detected using a universal high-sensitivity dye-based quantitative PCR detection kit and primers (NNV-RdRp-RT-1F: 5'-ATAGTCTGGCGGATTTTC-3', NNV-RdRp-RT-1R: 5'-TCGGGAGCACACATACAT-3'). The results are as follows: Figure 7 As shown: In pre-exposure prevention of NNV virus, NNV-circRNA-1 circular RNA preparation can also significantly reduce the level of NNV virus mRNA (RdRp gene). The mRNA level of NNV-RdRp gene in cells transfected with NNV-circRNA-1 circular RNA preparation was reduced by more than 90% compared with the control.

[0050] In summary, the therapeutic effect of NNV-circRNA-1 circular RNA preparation after NNV virus exposure and the preventive effect before exposure are very excellent, and both have the ability to significantly reduce the level of NNV virus mRNA, further confirming the therapeutic potential of NNV-circRNA-1 circular RNA preparation in controlling NNV virus replication.

[0051] Therefore, the NNV-circRNA-1 circular RNA preparation of the present invention can be used in the preparation of vaccines, antiviral drugs and other biological immune products for fish neuronecrosis virus in aquaculture. The NNV-circRNA-1 circular RNA preparation can inhibit the replication and proliferation of the fish neuronecrosis virus NNV by specifically binding to the fish neuronecrosis virus NNV, effectively blocking the spread of NNV in a variety of economically farmed fish, greatly reducing the risk of outbreaks of fish viral diseases caused by NNV virus infection, and effectively protecting the healthy breeding of a variety of economically farmed fish, thereby significantly improving the yield and economic benefits of fish breeding.

[0052] In addition, since this circular RNA can greatly reduce the outbreak of fish viral diseases, it can also reduce the risk of later complications such as bacterial diseases caused by viral diseases. In traditional aquaculture, the treatment of bacterial diseases often relies on the extensive use of antibiotics, which not only pollutes the environment, but also may lead to drug residues and the emergence of drug-resistant strains. Therefore, the introduction of NNV-circRNA-1 circular RNA preparations not only reduces the use of antibiotics, but also has important practical significance in protecting the ecological environment, reducing drug residues, and reducing the risk of the emergence of drug-resistant strains. Embodiment 4:

[0053] Stability test of NNV-circRNA-1 circular RNA preparation: Detection method: Take EPC cells in the logarithmic growth phase, digest the cells with the corresponding digestion solution, and then dilute them with cell culture medium to a cell density of 2.5×10 5 The cell suspension was added into a 12-well cell culture plate at 1 ml / well and placed in a cell culture incubator for culture. The CO2 volume content in the cell culture incubator was 5% and the temperature was 28°C.

[0054] After 24 hours of cell culture, the supernatant in the 12-well cell culture plate was discarded, rinsed with sterile PBS, and then cell culture medium was added at 1 ml / well. The prepared NNV-circRNA-1 circular RNA preparation was delivered into EPC cells and transfected into 5 replicate wells. After 24 hours, 36 hours, 48 ​​hours, 60 hours, 72 hours and 96 hours of transfection, the cells in each well were selected, the supernatant in the well was discarded, rinsed with sterile PBS, and then 1 ml of Trizol lysis solution was added for lysis at room temperature for 10 minutes, and then RNA was extracted using a total RNA extraction kit (Kangwei Century).

[0055] Total RNA was reverse transcribed using a full-length cDNA first-strand synthesis kit (Novozymes).

[0056] Then, the level of NNV-circRNA-1 was detected using a universal high-sensitivity dye-based quantitative PCR detection kit and primers (NNV-circRNA-1-RT-1F: 5'-CATCACCTTCTTGCTCTG-3' as shown in SEQ ID NO:7, NNV-circRNA-1-RT-1R: 5'-GCGTAGACTTGTCGTTGT-3' as shown in SEQ ID NO:8). The results are shown in Figure 8 shown.

[0057] Depend on Figure 8 The results showed that the relative levels of the prepared NNV-circRNA-1 circular RNA preparations were detected after 24h, 36h, 48h, 60h, 72h and 96h of delivery into EPC cells. The NNV-circRNA-1 circular RNA preparation showed almost no degradation trend within 48h of transfection, began to degrade after 72h of transfection, and degraded by 40%-50% after 96h of transfection. Therefore, it can be seen that the half-life of the NNV-circRNA-1 circular RNA preparation in EPC cells is 96h, which has good stability.

[0058] The above shows and describes the basic principles and main features of the present invention and the advantages of the present invention. It should be understood by those skilled in the art that the present invention is not limited to the above embodiments. The above embodiments and descriptions are only for explaining the principles of the present invention. Without departing from the spirit and scope of the present invention, the present invention may have various changes and improvements, which fall within the scope of the present invention to be protected. The scope of protection of the present invention is defined by the attached claims and their equivalents.

Claims

1. A circular RNA that targets and inhibits the replication of fish neural necrosis virus, characterized in that: The circular RNA is NNV-circRNA-1, and the nucleotide sequence is shown in SEQ ID NO:

1.

2. A method for preparing circular RNA that targets and inhibits the replication of fish neural necrosis virus, characterized in that: The steps include: (1) Analyzing the viral NNV genome sequence, designing primers NNV-circRNA-1-F and primer NNV-circRNA-1-R, annealing and renaturing to form a double-stranded DNA template, and using T7 RNA polymerase and the double-stranded DNA template to perform T7 RNA transcription to obtain linear RNA, which was purified by ethanol precipitation. The nucleotide sequence of the primer NNV-circRNA-1-F is shown in SEQ ID NO: 2, and the nucleotide sequence of the primer NNV-circRNA-1-R is shown in SEQ ID NO: 3; (2) Circularization: Use T4 RNA ligase 1 to circularize the purified linear RNA and purify it; (3) RNase R was used to remove the residual linear RNA, and the circularized RNA was purified again by ethanol precipitation to obtain the circular RNA: NNV-circRNA-1.

3. A circular RNA preparation for targeted inhibition of fish neural necrosis virus replication, wherein the circular RNA described in claim 1 is loaded onto a lipid nanocarrier, and the mass ratio of the circular RNA to the lipid nanocarrier is 1: 10 to obtain an NNV-circRNA-1 circular RNA preparation.

4. The circular RNA preparation for targeted inhibition of fish neural necrosis virus replication according to claim 3, characterized in that: The preparation method of the lipid nanocarrier is as follows: 4-(N,N-dimethylamino)butyric acid (dilinoleyl) methyl ester DLin-MC3-DMA, distearoylphosphatidylcholine DSPC, cholesterol and DMG-PEG2000 are mixed in a mass ratio of 5:1:3.8:0.2 and added into an ethanol solution to prepare the lipid nanocarrier.

5. Use of a circular RNA preparation for targeted inhibition of fish nervous necrosis virus replication as claimed in claim 3 for the preparation of vaccines and antiviral drugs for fish nervous necrosis virus.

Images