26 results about "Necrovirus" patented technology

The invention discloses a detection reagent, a kit and a detection method for pathogens of micropterus salmoides. The micropterus salmoides pathogen detection reagent comprises primers and probes for specifically amplifying an infectious spleen and kidney necrosis virus, a viral nervous necrosis virus, flavobacterium columnar, a perch rhabdovirus, a micropterus salmoides double-RNA virus, edwardsiella tarda, nocardia and a micropterus salmoides iridovirus; specific upstream and downstream primers and probes of the eight pathogens are sequences as shown in SEQ ID NO.1 to SEQ ID NO.24 in sequence. The micropterus salmoides pathogen detection reagent and method can detect eight pathogens at the same time, have the advantages of high sensitivity, high specificity, good repeatability and the like, provide reliable basis for prevention and control of the pathogens, also improve the prevention and control work efficiency, and have good application prospects. The kit is especially suitable for large-scale rapid screening and mixed infection diagnosis of aquaculture pathogens, and has important value and significance for prevention and treatment of micropterus salmoides pathogens.

The invention discloses an application of Rottlerin in preparation of a medicine for preventing and treating nervous necrosis virus. According to the application disclosed by the invention, the fact that the rotinidin has high binding energy to RGNNV capsid protein is found, the rotinidin without toxic concentration is selected to carry out an RGNNV virus infected cell experiment, and the result shows that the rotinidin inhibits the replication of the RGNNV virus in a dose-dependent manner. The safe dosage of Rottlerin is obtained according to the survival rate of zebrafish treated with different doses, the influence of Rottlerin on the survival rate of zebrafish infected with RGNNV is researched, and finally it is proved that Rottlerin has a remarkable treatment effect on zebrafish infected with RGNNV. Rottlerin provides a new natural small molecule drug choice for prevention and treatment of VNN diseases, and has important research and development value and development significance for prevention and treatment of nervous necrosis viruses.

The invention discloses a method for visually detecting mandarin fish iridovirus and infectious spleen and kidney necrosis virus based on RPA-CRISPR Cas12a / Cas13a, and belongs to the technical field of biological diagnosis. According to the method, a CRISPR / Cas system is combined with RPA amplification, a fluorescent reporter and a test strip are used for naked eye observation, and the method combines the advantages of different isothermal amplification technologies, has the advantages of short detection time, high specificity, no cross reaction, high sensitivity and the like, realizes rapid and accurate diagnosis of the two pathogens, and has a good application prospect. Important technical support is provided for prevention and control of mandarin fish diseases.

The present invention relates to the technical field of prevention and control of aquatic animal diseases, and specifically relates to a nanocomposite for a nervous necrosis virus, a preparation method therefor, and the use thereof. Provided in the present invention is a nanocomposite consisting of poly(lactic-co-glycolic acid), polyethyleneimine and a siRNA. Also provided in the present invention are a preparation method for the nanocomposite and the use thereof in the preparation of a drug for improving the survival rate of fish eggs infected with a nervous necrosis virus. The present invention constructs a vector for a capsid protein of the nervous necrosis virus by means of simulating the nervous necrosis virus and expresses same in cells, and screens out a siRNA that can effectively inhibit the expression of the viral capsid protein, thus constructing the nanocomposite for the nervous necrosis virus. The nanocomposite can block NNVs at the embryonic phase (fertilized eggs), thereby improving the survival rate of fish fry, and further opening up new possibilities for the treatment of early stage diseases in fish fry. The method is innovative in the field of artificial breeding of aquatic animals and provides new ideas for virus prevention and control in the field of aquaculture.

This invention relates to the field of eDNA enrichment and detection, and discloses a highly efficient method for the enrichment and detection of infectious hematopoietic organ necrosis virus (IHNV) eDNA. The method includes the following steps: preparing and pretreating an IHNV virus sample to obtain a standardized raw solution; subsequently, using a tangential flow enrichment device to efficiently concentrate the IHNV virus particles in the raw solution, achieving the enrichment of viral eDNA; and constructing an RT-qPCR quantitative detection system. By plotting a standard curve and a sample amplification curve, the virus recovery rate is accurately calculated, enabling accurate evaluation of the efficiency of the entire enrichment process. This invention overcomes the shortcomings of traditional methods, such as small processing volume, low efficiency, and cumbersome operation, achieving the goal of efficient and stable recovery of viruses from large-volume water samples.

The invention discloses a primer and probe combination for detecting an infectious spleen and kidney necrosis virus and a rapid detection product, and relates to the technical field of biology. The primer and probe combination comprises an upstream primer of which the nucleotide sequence is shown as SEQ ID NO.6, a downstream primer of which the nucleotide sequence is shown as SEQ ID NO.7 and a probe of which the nucleotide sequence is shown as SEQ ID NO.17. The method has the advantages of high detection sensitivity and strong specificity. The method is adaptive to various basic layer detection scenes such as pond openings and ports, meanwhile, a complex sample pretreatment process is avoided, complex instruments and professional technologies are not needed in operation, integrated diagnosis of on-site sampling, rapid detection and instant interpretation can be achieved, and an efficient, accurate and convenient epidemic disease prevention and control technical support is provided for the aquaculture industry.

The invention discloses a fish nervous necrosis virus resisting medicine which is characterized by comprising baicalin. The invention also discloses a screening method of the drug for resisting the nervous necrosis virus of the fish, which comprises the following steps: constructing a recombinant prokaryotic expression plasmid with the HSC70 gene, transferring the plasmid into a BL21 (DE3) cell, inducing protein expression, and purifying to obtain the HSC70 protein; preparing to-be-detected compound solutions with different concentrations, and then dropwise adding the to-be-detected compound solutions into the solution containing the HSC70 protein for incubation; under the excitation wavelength of 285 nm, the fluorescence signal of the HSC70 protein in the range of 310-350 nm is detected, the compound for targeted inhibition of the HSC70 protein is determined according to the change of the fluorescence signal, and the fish nervous necrosis virus resisting medicine is screened out.

The invention provides shRNA for interfering nervous necrosis virus B2 protein, a recombinant plasmid as well as a preparation method and application of the shRNA and the recombinant plasmid, and belongs to the technical field of biological medicines. The shRNA (short hairpin ribonucleic acid) interfering with the nervous necrosis virus B2 protein is shRNA1 (short hairpin ribonucleic acid 1) or shRNA2; the positive-sense strand sequence of the shRNA1 is as shown in SEQ ID NO. 2, and the antisense strand sequence of the shRNA1 is as shown in SEQ ID NO. 3; the sequence of a positive-sense strand of the shRNA2 is as shown in SEQ ID NO.5, and the sequence of an antisense strand of the shRNA2 is as shown in SEQ ID NO.6. The shRNA recombinant plasmid is good in stability, has relatively high transfection efficiency in carp epithelial cells, can effectively interfere with the expression of B2 protein in the cells, has a virus replication inhibition rate of 80% or more on nervous necrosis viruses, and can be applied to preparation of drugs for resisting the nervous necrosis viruses in aquaculture so as to realize effective prevention and control on the nervous necrosis viruses in aquaculture.

The application discloses a kind of based on water body virus load and fish body tissue virus load correlation grouper nervous necrosis virus nondestructive testing method.The method is through optimizing the concentration condition of virus in aquaculture water, realize the efficient concentration and quantification of water body virus load, then combine water-water aquaculture animal virus load correlation model, indirectly and nondestructively assess the virus infection state of aquaculture animal.The application detects water environment instead of detecting animals itself, realizes nondestructive, dynamic, early warning monitoring of the health status of aquaculture animal population, with the advantages of low cost, simple operation, frequent implementation, etc., and has important application value in aquatic disease prevention and control, good seed selection and biological safety management.

The invention belongs to the technical field of marine aquaculture industry detection, and particularly relates to a primer probe combination for detecting viral nervous necrosis virus, an RPA (recombinase polymerase amplification) visual kit and application thereof. The invention relates to a primer probe combination for detecting viral nervous necrosis virus. The primer probe combination comprises an upstream primer F2, a Biotin downstream primer Biotin-R2 and a fluorescent nfo probe nfo-P2. The kit disclosed by the invention is visual; the specificity is high; the detection sensitivity is high and can reach 100 copies / mu L; the accuracy is high and reliable; the method is convenient and fast to operate, suitable for field detection and wide in application scene.

The present application belongs to the field of prevention and control of aquatic pathogenic microorganisms, and particularly relates to a fish nervous necrosis virus blocking protein as well as a preparation method and application thereof. Due to the special structure, the protein can specifically bind to the receptors on the surface of fish nervous necrosis virus particles, so that the fish nervous necrosis virus loses the ability to invade fish cells, thereby blocking the fish nervous necrosis virus from infecting the host cells of fish, and avoiding the replication and proliferation of the fish nervous necrosis virus in the host. The fish nervous necrosis virus blocking protein provided by the present application has a high anti-nervous necrosis virus effect. The biological preparation product prepared by using the fish nervous necrosis virus blocking protein as an active material can significantly improve the anti-nervous necrosis virus ability of fish fry by using the oral method, is safe and pollution-free, can be applied on a large scale, provides a new way for the prevention and control of fish nervous necrosis virus disease, and further improves the economic benefits of fish culture.

The invention relates to the technical field of molecular biological detection, and discloses a composition and a kit for detecting pathogenic microorganisms of fish and application of the composition and the kit. The composition provided by the invention comprises a primer pair aiming at a target sequence of at least one of infectious hematopoietic necrosis virus, infectious pancreatic necrosis virus, viral hemorrhagic septicemia virus, flavobacterium psychrophilum, aeromonas salmonicida and aeromonas hydrophila; according to the method, multiple fish pathogenic microorganisms in a sample can be detected and confirmed only through one-time PCR, the detection efficiency is greatly improved, the detection cost is reduced, and the method has good specificity, high detection sensitivity, convenience in operation and excellent stability.

The present application relates to a circRNA vaccine for anti-infectious hematopoietic necrosis virus, the circRNA vaccine is a covalently closed circular structure, comprising an internal ribosome entry site, a G protein sequence of the infectious hematopoietic necrosis virus, and a Kozak sequence located between the internal ribosome entry site and the G protein sequence of the infectious hematopoietic necrosis virus;The circRNA vaccine comprises a cyclization connection sequence formed by a fish tRNA Leu I type intron self-splicing;The internal ribosome entry site is one or more of the following: coxsackievirus 3 IRES, infectious pancreatic necrosis virus IRES, encephalomyocarditis virus IRES, Ythdc2 IRES, and hepatitis C virus IRES;The amino acid sequence of the G protein of the infectious hematopoietic necrosis virus has at least 90% sequence identity with the amino acid sequence encoded by SEQ ID NO. 1.

The invention discloses a kit and a method for high-sensitivity detection of nervous necrosis virus of grouper based on RT-ERA-Cas12a. An ERA enzymatic recombinant isothermal amplification technology is combined with CRISPR / cas12a, on the basis of designing and screening appropriate ERA primers, crRNA and ssDNA probes, reverse transcription of RGNNV viruses, recombinase polymerase amplification and a CRISPR / cas12a in-vitro cutting system are integrated in a PCR tube, and the grouper nervous necrosis virus is detected through one-tube type RT-ERA-Cas12a. The method provides a means for detecting the nervous necrosis virus of grouper on site, has the characteristics of rapidness (40-50 minutes), high sensitivity (5 copies / reaction) and no need of expensive instruments at normal temperature (35-40 DEG C), and has practical significance for farmers to timely know the illness state of cultured fishes and take prevention and control measures on site.

The invention discloses a triple RT-qPCR (Reverse Transcription-Quantitative Polymerase Chain Reaction) method and a kit for simultaneously detecting IMNV (Immunodeficiency Virus), CMNV (Cytomegalovirus) and DIV1 (Deoxyribose Immunodeficiency Virus According to the invention, PCR primers and TaqMan probes for detecting IMNV, CMNV and DIV1 are respectively designed, and the nucleotide sequences of the PCR primers and TaqMan probes are shown as SEQ ID NO: 1-9. The primer and the probe can be used for simultaneously qualitatively and quantitatively detecting the infectious muscle necrosis virus, the secretly death nodavirus and the full-eye iridovirus 1 through a triple RT-qPCR (Reverse Transcription-Quantitative Polymerase Chain Reaction) method. According to the invention, common detection of RNA virus and DNA virus is realized for the first time, the kit has the characteristics of high efficiency and convenience, and the advantages of high sensitivity, high specificity and quantitability, and meanwhile, due to the addition of the molecular crowding agent, the detection efficiency and detection speed of medium and low-concentration virus load can be effectively improved, and the detection cost is reduced. The invention provides a convenient and reliable detection method and product for early monitoring, early warning and diagnosis of the three virus diseases of the penaeus vannamei boone.

The application discloses application of MG-132 in preparation of a drug for resisting nerve necrosis virus. Researches of the application show that MG-132 can significantly reduce the cytopathic effect caused by nerve necrosis virus infection, reduce the number of positive cells expressing RGNNV capsid protein, and also can significantly reduce the mRNA transcription level of a key gene of RGNNV, the protein expression level and the copy number of virus genomic RNA; and with the extension of RGNNV infection time, MG-132 can also significantly inhibit virus gene transcription, protein synthesis and genome replication, and reduce virus titer. Therefore, MG-132 treatment can significantly reduce the virulence of RGNNV to cells, has the efficacy of resisting nerve necrosis virus, and has low cytotoxicity and good safety. The application provides a new drug intervention strategy for prevention and treatment of nerve necrosis virus infection, and has important application value for prevention and control of NNV related diseases in aquaculture.

The present disclosure relates to the technical field of prevention and control of diseases in aquatic animals, and particularly relates to a nanocomplex targeting a nervous necrosis virus as well as a preparation method and use thereof. The present disclosure provides a nanocomplex composed of poly(lactic-co-glycolic acid), polyethyleneimine and siRNA. The present disclosure further provides a preparation method of the nanocomplex and use of the nanocomplex in the preparation of a drug for improving the survival rate of fish eggs infected with NNV. In the present disclosure, a vector for an NNV capsid protein is constructed by simulating the NNV; the constructed NNV capsid protein is expressed in cells; the siRNA capable of effectively inhibiting the expression of the viral capsid protein is screened, and then the nanocomplex of the NNV is constructed; and the NNV is blocked in the embryonic stage (fertilized eggs).

The application discloses application of NM107 in resisting infectious pancreatic necrosis virus. The application provides application of NM107 or a derivative thereof or a pharmaceutically acceptable salt thereof or a substance taking NM107 or the derivative thereof or the pharmaceutically acceptable salt thereof as an active ingredient in preparation of a product for resisting infectious pancreatic necrosis virus. NM107 has an anti-IPNV effect in vivo and in vitro, and is a potential candidate drug for resisting IPNV infection.

The invention discloses an aeromonas salmonicida and infectious hematopoietic necrosis bivalent subunit vaccine and application thereof, and belongs to the technical field of aquatic vaccines. The vaccine is characterized in that it comprises a fusion protein and an immunologic adjuvant. The fusion protein comprises a VapA protein antigen of aeromonas salmonicida and a G protein antigen of infectious haematopoietic necrosis virus, the VapA protein antigen and the G protein antigen are connected through a flexible Linker, and the preferable structure of the fusion protein is VapA-Linker-IHNV-G-6 * His. The invention also discloses a preparation method of the vaccine. The preparation method comprises the following steps: constructing a fusion protein expression vector, transforming a host, inducing expression, purifying the fusion protein and emulsifying with an adjuvant. The bivalent vaccine disclosed by the invention can simultaneously stimulate dual specific immune response aiming at bacteria and viruses, has a remarkable immune protection effect on aeromonas salmonicida and infectious hematopoietic necrosis viruses, is high in safety as a subunit vaccine, and provides an effective new way for prevention and control of multi-pathogen cross infection in aquaculture.

The invention discloses an infectious hematopoietic necrosis virus monoclonal antibody, a hybridoma cell strain and application. The invention relates to the technical field of biology, and provides a complete set of hybridoma cell strain which is composed of a hybridoma cell strain IHNV-N-15-5H3 (CCTCC (China Center for Type Culture Collection) NO: C2024366) and a hybridoma cell strain IHNV-N-151-3A9 (CCTCC NO: C2024367). The invention also provides a complete set of monoclonal antibody secreted by the complete set of hybridoma cell strain. The antigen capture ELISA detection method aiming at the IHNV virus N protein is established by utilizing two monoclonal antibodies, and the effect of the antigen capture ELISA detection method is evaluated to find that the antigen capture ELISA detection method can be used for specifically, quickly and sensitively detecting the infectious hematopoietic necrosis virus.

Provided is a set of shark nanobodies targeting an infectious hypodermal and haematopoietic necrosis virus of shrimp. The amino acid sequence of each nanobody in the set is selected from any one of SEQ ID NOs. 8-14. The nanobodies are useful for detecting cp, nsp1, and nsp2 antigens of the infectious hypodermal and haematopoietic necrosis virus. A preparation or screening method for the nanobodies comprises the following steps: step A: expression and purification of cp, nsp1, and nsp2 antigens; step B: construction of a shark naive library and / or a shark immune library; step C: helper phage rescue and purification to obtain a phage library; step D: panning of anti-cp, anti-nsp1, and anti-nsp2 antigen phage libraries; and step E: identification by phage-ELISA and sequencing, and sequence alignment to obtain cp, nsp1, and nsp2 nanobodies having different CDR3 region sequences.

The invention belongs to the technical field of genetic engineering, and particularly relates to a grouper nervous necrosis virus yeast oral vaccine as well as a preparation method and application thereof. The invention firstly provides a saccharomyces cerevisiae engineering bacterium capable of efficiently expressing the RGNNV capsid protein, and the saccharomyces cerevisiae engineering bacterium comprises an RGNNV-CP gene cDNA sequence of which the nucleotide sequence is shown as SEQ ID NO.1 and which can efficiently express the RGNNV capsid protein, and a saccharomyces cerevisiae engineering bacterium capable of efficiently expressing the RGNNV capsid protein, on the basis, the invention further provides a grouper nervous necrosis virus yeast oral vaccine, the active ingredients of the oral vaccine comprise the saccharomyces cerevisiae engineering bacteria in the technical scheme, the vaccine is an oral dosage form aiming at fry, administration is convenient, professional equipment is not needed, stability is high, and storage and popularization are convenient; the method is especially suitable for artificial breeding requirements of marine fishes in tropical areas such as Hainan islands. Therefore, the technical scheme provided by the invention can be used for treating or preventing nervous necrosis viruses of groupers and improving the survival rate of fries.

This invention discloses the brown-spotted grouper. EfBAG4 The application of genes in combating neuronecrosis virus infection involves the field of genetic engineering technology. EfBAG4 The nucleotide sequence of the gene is shown in SEQ ID NO.1. Experiments have shown that overexpression... EfBAG4 The gene can significantly reduce RGNNV virus titers, decrease hepatocyte shedding and damage caused by viral infection, and effectively inhibit viral replication in host cells. It can also promote immune genes in fish. IRF3 , IRF7 , ISG15 and IFN‑α This invention enables precise antiviral immune activation through the expression of [specific expression]. It provides a novel drug intervention strategy for the prevention and treatment of RGNNV infection, and has significant application value in the control of RGNNV-related diseases in aquaculture.

The invention discloses a recombinant fusion protein subunit vaccine of an infectious spleen and kidney necrosis virus as well as a preparation method and application of the recombinant fusion protein subunit vaccine. The truncated protein of the main capsid protein of the infectious spleen and kidney necrosis virus and the truncated protein of the 051L protein form the recombinant fusion protein t051L-tMCP, and the recombinant fusion protein can simultaneously express dominant epitopes of two immunizing antigens and can be stirred and mixed with an oil-in-water emulsion adjuvant to prepare a vaccine preparation. Experiments prove that the recombinant fusion protein subunit vaccine has high immunogenicity and can recognize and combine tMCP and t051L, and the relative immune protection rate of a 1.0 mg / mL dosage group reaches 95.50%. The recombinant fusion protein provided by the invention is simple to prepare and operate, and the prepared vaccine not only solves the bottleneck problem of low immunogenicity of an infectious spleen and kidney necrosis virus subunit vaccine, but also can be widely applied to protection of fry against infectious spleen and kidney necrosis virus infection in the breeding process of micropterus salmoides.

The application discloses a ssDNA aptamer for detecting a nerve necrosis virus, and the sequence of the ssDNA aptamer is tggttgtgggggagg tccgtcttgcagtgctggctacgcttcgggtagag or a derivative thereof. The ssDNA aptamer can be applied to detecting an anti-nerve necrosis virus or screening a drug for resisting a nerve necrosis virus infection. This is beneficial to rapidly detecting an anti-fish nerve necrosis virus and screening a drug for resisting a nerve necrosis virus infection, and lays a foundation for preventing and treating a nerve necrosis virus disease in seawater fish culture.

This invention belongs to the field of biomedical technology and discloses a grouper neuronecrosis virus (NNV) vaccine, its preparation method, and its application. The invention connects the dominant NNV epitope CP4, the small molecule penetrating peptide LMWP, and grouper ferritin via a linker sequence to obtain a fusion gene fragment LCF. A recombinant expression vector is constructed based on the pET28a plasmid and expressed in *E. coli* to obtain the recombinant fusion protein rLCF. This protein aggregates and self-assembles into a nanocage-like structure based on its own characteristics, thus obtaining an NNV self-assembled vaccine. The NNV self-assembled vaccine can significantly enhance the level of specific serum antibodies and non-specific enzyme activity in grouper through immersion immunization and provides good protection after grouper infection with neuronecrosis virus (NNV), providing an important reference for the immunoprevention and control of this virus.