Construction method and application of pPB-CAG-hORMDL3 mouse model

Abstract

The invention discloses a construction method of a pPB-CAG-hORMDL3 mouse model and application of the pPB-CAG-hORMDL3 mouse model, and relates to the technical field of animal models. According to the present invention, the constructed pPB-CAG-hORMDL3 plasmid and the helper plasmid (expression transposase) are subjected to common pronucleus injection into the mouse embryo, and the pPB-CAG-hORMDL3 is integrated into the mouse genome under the transposase effect, such that the transposon system has advantages of high efficiency and stable inheritance, and the hORMDL3 overexpression transgenic mouse expressing the target fragment is finally obtained. According to the animal model systemic overexpression hORMDL3 transgenic mouse new strain disclosed by the invention, a research mode tool is provided for researching the gene function of ORMDL3 in all organ system diseases of the whole body, and a new strategy is provided for preparing medicines for preventing or treating asthma-related diseases. The hORMDL3 overexpression transgenic mouse animal model prepared by adopting the construction method disclosed by the invention can be used for research on effects and molecular mechanisms in occurrence and development of related diseases and screening and / or evaluation of drugs for related diseases.

Description

Technical Field

[0001] The present invention relates to the technical field of animal models, and in particular to a method for constructing a pPB-CAG-hORMDL3 mouse model and an application thereof. Background Art

[0002] ORMDL3 is located at 17q21 and is one of the asthma susceptibility genes. The ORMDL3 gene is not only related to the onset of childhood asthma, but also to respiratory viral infections in infancy. Therefore, hORMDL3 overexpression mice were established for basic research on the effects of ORMDL3 gene expression in vivo on asthma and other inflammatory diseases. At present, there are no transgenic mice with ORMDL3 overexpression in China. The hormdl3 gene was constructed into piggyBac using piggyBac transposon technology. Under the mediation of transposase, it was cut and inserted into the host genome. In the process of random insertion of transgenes, piggyBac is more inclined to insert into the 5' non-coding region of the gene, so that the exogenous gene is expressed in vivo. This method is more conducive to the production of transgenic mammals. Compared with the conditional overexpression mice constructed abroad, the construction process is simpler, and it does not need to be hybridized with cre mice, which reduces the problems of long cycles and difficult identification caused by repeated breeding. Summary of the invention

[0003] In view of the above-mentioned defects of the prior art, the purpose of the present invention is to provide a method for constructing an ORMDL3 overexpression transgenic mouse model and its application. Through the new strain of transgenic mice that overexpress hORMDL3 throughout the body, a research model tool is provided for studying the gene function of ORMDL3 in diseases of various organ systems throughout the body, and a new strategy is provided for preparing drugs for preventing or treating asthma-related diseases.

[0004] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions.

[0005] The invention discloses application of hORMDL3 gene in constructing an inflammatory mouse model.

[0006] Furthermore, the model specifically overexpresses the hORMDL3 gene, and the nucleotide sequence of the hORMDL3 gene is shown in SEQ ID NO.1.

[0007] Furthermore, the model is prepared by injecting the constructed pPB-CAG-hORMDL3 plasmid and helper plasmid (expressing transposase) into mouse embryos through pronuclear injection. Under the action of transposase, pPB-CAG-hORMDL3 is integrated into the genome of the mouse, thereby finally obtaining an animal model overexpressing the hORMDL3 gene.

[0008] Furthermore, the animal is a C57BL / 6J mouse.

[0009] The present invention also discloses a method for constructing a hORMDL3 gene overexpression mouse model, which is characterized by comprising the following steps: (1) Clone the target gene hORMDL3 into the vector backbone after restriction digestion to obtain the pPB-CAG-hORMDL3 vector; (2) The pPB-CAG-hORMDL3 plasmid and the linearized transgenic vector fragment of helper plasmid (expressing transposase) were injected into the male pronucleus of fertilized eggs by microinjection and cultured conventionally to obtain a mouse model with inducible overexpression of hORMDL3.

[0010] Furthermore, the nucleotide sequence of the hORMDL3 gene in (1) is shown in SEQ ID NO.1.

[0011] The present invention also discloses an inflammatory mouse model obtained by using any of the construction methods described above.

[0012] The present invention also discloses an application of the above-mentioned inflammatory mouse model in determining the pathogenesis of inflammation.

[0013] The present invention also discloses an application of the above-mentioned inflammatory mouse model in screening drugs for preventing and / or treating inflammation.

[0014] Compared with the prior art, the beneficial effects of the present invention are as follows.

[0015] (1) The present invention is the first to obtain a new strain of transgenic mice that overexpress hORMDL3 throughout the body, providing a research model tool for studying the genetic function of ORMDL3 in diseases of various organ systems throughout the body.

[0016] (2) The present invention is the first to obtain a transgenic mouse model overexpressing hORMDL3, providing a new strategy for preparing drugs to prevent or treat asthma-related diseases.

[0017] (3) The method for constructing the hORMDL3 overexpression transgenic mouse model of the present invention and its application solve the problem that there is no independently developed hORMDL3 overexpression mouse model. The model is of great significance for exploring the pathogenesis of people carrying the asthma susceptibility gene ORMDL3 and drug development. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 Schematic diagram of the hORMDL3 overexpression vector of the present invention.

[0019] Figure 2These are the different growth stages of hORMDL3-overexpressing mice (d1, d7, d14, and 5 weeks after birth, respectively).

[0020] Figure 3 The genotype of hORMDL3 overexpressing mice in the present invention is identified. A is compared with wild-type mice, ORMDL3 Tg Appearance and lung tissue of mice; B is the result of agarose gel electrophoresis showing that Lane 1 and 2 are wild-type mice; Lane 3, 4, and 5 are ORMDL3Tg-positive mice; Lane 6 is the positive control (the template is pPB-CAG-ORMDL3-IRES-ZsGreen1 plasmid); Lane 7 is the wild-type control; Lane 8 is the blank control (the template is water).

[0021] Figure 4 The immunohistochemical staining of ORMDL3 in lung tissue of hORMDL3 overexpressing mice of the present invention is shown in Figure A. The immunohistochemical staining diagram and B. the bar chart.

[0022] Figure 5 Detection of ORMDL3 by Western Blot Tg ORMDL3 protein expression in mouse lung tissue. A is the Western Blot result, and B is the bar chart analysis.

[0023] Figure 6 ORMDL3 is involved in multiple inflammatory pathways. A is hORMDL3 Tg The difference in protein expression between mice and WT group; B is the protein difference volcano map; CD is the differential protein GO analysis map; EF is the differential protein KEGG enrichment analysis map; G is the PPI network analysis of related differentially expressed protein-protein interactions. DETAILED DESCRIPTION

[0024] The present invention is further described in detail below with specific embodiments, but it should not be understood that the scope of the above subject matter of the present invention is limited to the following embodiments, and all technologies realized based on the content of the present invention belong to the scope of the present invention.

[0025] Unless otherwise specified, all reagents and materials used in the present invention are commercially available.

[0026] Example 1 Construction of a transgenic mouse model overexpressing hORMDL3.

[0027] The construction method includes the following steps.

[0028] 1. Construct pPB-CAG-hORMDL3 plasmid.

[0029] (1)In this project, the hORMDL3 CDS was amplified against Homo sapiens ORMDL transcript variant 1 NM_001320801.2. https: / / www.ncbi.nlm.nih.gov / nuccore / NM_001320801.2.

[0030] The hORMDL3 CDS sequence is shown in SEQ ID NO. 1.

[0031] SEQ ID NO. 1: ATGAATGTGGGCACAGCGCACAGCGAGGTGAACCCCAACACGCGGGTGATGAACAGCCGTGGCATCTGGCTCTCCTACGTGCTGGCCATCGGTCTCCTCCACATCGTGCTGCTGAGCATCCCGTTTGTGAGTGTCCCTGTCGTCTGGACCCTCACCAACCTCATTCACAACATGGGCATGTATATCTTCCTGCACACGGTGAAGGGGACACCCTTTGAGACCCCGGACCAGGGCAAGGCGAGGCTGCTAACCCACTGGGAGCAGATGGATTATGGGGTCCAGTTCACGGCCTCTCGGAAGTTCTTGACCATCACACCCATCGTGCTGTACTTCCTCACCAGCTTCTACACTAAGTACGACCAGATCCATTTTGTGCTCAACACCGTGTCCCTGATGAGCGTGCTTATCCCCAAGCTGCCCCAGCTCCACGGAGTCCGGATTTTTGGAATCAATAAGTACTGA.

[0032] (2)PCR amplification of EcoRI-IRES-ZsGreen1-NotI DNA fragment 1: EcoRI-IRES-F: TCAGGAATTCCCGCCCCTCTCCCTC; NotI-ZsGreen1-R: TATGCGGCCGCGATATCAGGGCAAGGCGGAGCCG; pLVX-IRES-ZsGreen1 10 ng - 50 ng EcoRI-IRES-F 1.5 μL NotI-ZsGreen1-R 1.5 μL PrimerstarMax 25μL H 2 O add to 50μL 98℃ 20sec 98℃ 10sec 61℃ 10sec 35 cycles 72℃ 80sec 72℃ 2min 4℃ stop.

[0033] Take 2~3μL 1% gel electrophoresis test, the target band is 1298bp. If the band is single, perform PCR product recovery; if not, perform gel excision recovery. After recovery, measure the concentration by ND2000.

[0034] (3) EcoRI / NotI double digestion of pCAG-EGFPN1 plasmid and EcoRI-IRES-ZsGreen1-NotI DNA fragment 1: pCAG-EGFPN1 ≥2ug EcoRI-HF 1μL NotI-HF 1μL CutSmart buffer 5μL H 2 2. Add 10 μL of HO to 50 μL.

[0035] The enzyme digestion was carried out overnight at 37°C. The digestion products were a 4794 bp vector part and a 757 bp DNA fragment part. After gel running, the 4794 bp vector fragment was recovered by gel cutting.

[0036] DNA fragment 1 ≥2ug EcoRI-HF 1μL NotI-HF 1μL CutSmart buffer 5μL H 2 O add to 50μL.

[0037] The PCR products were recovered after overnight digestion at 37°C.

[0038] (4) Connection conversion: T4 Ligase 1 μL T4 ligation buffer 2μL 2 μL of double-digested vector 5 μL of double-digested fragments After adding according to the above system, mix well by pipetting and incubate at 25°C for no less than 10 min.

[0039] Take one competent cell for transformation, spread on the plate and culture overnight at 37°C. The next day, pick a single clone for PCR identification. Use a 10μL sterile pipette tip to pick a single clone colony and resuspend it in 10μL sterile water; Bacterial liquid 1μL EcoRI-IRES-F 1.5μL NotI-ZsGreen-R 1.5μL GenestarMix 2X 5μL H 2 O add to 10μL 95℃ 3min 95℃ 20sec 65℃ 20sec 35cycles 72℃ 45sec 72℃ 2min 4℃ stop 1% gel electrophoresis detected that the correct band size was 1298bp. The correct PCR clone was sent for sequencing.

[0040] The clones that were sequenced correctly were amplified and the plasmid was extracted and set aside. The plasmid was pCAG-IRES-ZsGreen1.

[0041] (5) PCR amplification of XhoI-ORMDL3-EcoRI DNA fragment 2: XhoI-ORMDL3-F: TAGACTCGAGCCACCATGAATGTGGGCACAG; EcoRI-ORMDL3-R:TCAGGAATTCAGTACTTATTGATTCCAAAAATCCG; hORMDL3 cloning vector 1~10ng XhoI-ORMDL3-F 1.5μL EcoRI-ORMDL3-R 1.5μL PrimerstarMax 25μL H 2 O add to 50μL 98℃ 20sec 98℃ 10sec 56℃ 10sec 35 cycles 72℃ 30sec 72℃ 2min 4℃ stop.

[0042] Take 2~3μL of 1% gel electrophoresis for detection. The target band is 485bp. If the band is single, perform PCR product recovery; if not, perform gel excision recovery. After recovery, measure the concentration by ND2000.

[0043] (6) XhoI / EcoRI double digestion of pCAG-IRES-ZsGreen1 plasmid and XhoI-ORMDL3-EcoRI DNA fragment 2: pCAG-IRES-ZsGreen1 ≥2ug EcoRI-HF 1μL XhoI-HF 1μL CutSmart buffer 5μL H 2 2. Add 10 μL of HO to 50 μL.

[0044] The PCR products were recovered after overnight digestion at 37°C.

[0045] DNA fragment2 ≥2ug EcoRI-HF 1μL XhoI-HF 1μL CutSmart buffer 5μL H 2 2. Add 10 μL of HO to 50 μL.

[0046] The PCR products were recovered after overnight digestion at 37°C.

[0047] (7) Connection conversion: T4 Ligase 1 μL T4 ligation buffer 2μL 2 μL of double-digested vector 5 μL of double-digested fragments After adding according to the above system, mix well by pipetting and incubate at 25°C for no less than 10 min.

[0048] Take one competent cell for transformation, spread on the plate and culture overnight at 37°C. The next day, pick a single clone for PCR identification. Use a 10μL sterile pipette tip to pick a single clone colony and resuspend it in 10μL sterile water; Bacterial liquid 1μL XhoI-ORMDL3-F 1.5μL EcoRI-ORMDL3-R 1.5μL GenestarMix 2X 5μL H 2 O add to 10μL 95℃ 3min 95℃ 20sec 60℃ 20sec 35cycles 72℃ 30sec 72℃ 2min 4℃ stop.

[0049] 1% gel electrophoresis detected that the correct band size was 485bp. The correct PCR clone was sent for sequencing.

[0050] The clones that were sequenced correctly were amplified and the plasmid was extracted and set aside. The plasmid was pCAG-ORMDL3-IRES-ZsGreen1.

[0051] (8) pCAG-ORMDL3-IRES-ZsGreen1 plasmid digested with SpeI / EcoRV, and PiggyBac Dual promoter (PB513B-1) plasmid digested with SpeI / HpaI: pCAG-ORMDL3-IRES-ZsGreen1 ≥2ug SpeI-HF 1 μL EcoRV-HF 1μL CutSmart buffer 5μL H 2 2. Add 10 μL of HO to 50 μL.

[0052] The enzyme digestion was carried out overnight at 37°C. The digested bands were a 3453 bp DNA fragment and a 3083 bp vector backbone. After gel running, the 3746 bp DNA fragment band was recovered by gel cutting.

[0053] PiggyBac Dual promoter (PB513B-1) ≥2ug SpeI-HF 1 μL HpaI 1 μL CutSmart buffer 5μL H 2 2. Add 10 μL of HO to 50 μL.

[0054] The enzyme digestion was carried out overnight at 37°C. The digested bands were a 4789 bp vector portion and a 2469 bp DNA fragment portion. After gel running, the 4789 bp vector band was recovered by gel cutting.

[0055] (9) Connection conversion: T4 Ligase 1 μL T4 ligation buffer 2μL 3 μL of double-digested vector 4 μL of double-digested fragments After adding according to the above system, mix well by pipetting and incubate at 25°C for no less than 10 min.

[0056] Take one competent cell for transformation, spread on the plate and culture overnight at 37°C. The next day, pick a single clone for PCR identification. Use a 10μL sterile pipette tip to pick a single clone colony and resuspend it in 10μL sterile water; Bacterial liquid 1μL XhoI-ORMDL3-F 1.5μL EcoRI-ORMDL3-R 1.5μL GenestarMix 2X 5μL H 2 O add to 10μL 95℃ 3min 95℃ 20sec 65℃ 20sec 35cycles 72℃ 45sec 72℃ 2min 4℃ stop.

[0057] 1% gel electrophoresis detection, the correct band size is 485bp. The correct PCR clone was shaken overnight, the plasmid was extracted, and then digested with EcoRI, SpeI and EcoRV for identification. The correct clone restriction enzyme bands were 4177bp, 2467bp and 1891bp.

[0058] 2. Construction of hORMDL3 transgenic mice.

[0059] (1) Superovulation operation, that is, inject 10 IU of pregnant mare serum gonadotropin per mouse on the first day, and inject 10 IU of human chorionic gonadotropin per mouse 48 hours later; at the same time, select healthy 6-week-old male C57BL / 6 mice and mate them with the female mice that have undergone the above-mentioned ovulation induction operation in a 1:1 cage, observe the vaginal plug, and put the mice with vaginal plugs aside for use, that is, the egg donor mice.

[0060] (2) Egg retrieval: After anesthetizing the egg donor mouse, place it with its abdomen facing upwards, prepare the skin and expose the abdomen, use scissors and forceps to separate the skin, fascia and muscle layer by layer, expose the ovary, fallopian tube and uterus, separate the fallopian tube, use forceps to place the fallopian tube in M2 culture medium, open the ampulla of the fallopian tube under a dissecting microscope, and allow the egg to flow into the culture medium; add 1 mg / mL hyaluronidase to the culture medium, and rinse with M2 culture medium 3-4 times to remove granulosa cells; observe under a microscope to distinguish the fertilized egg from other cells, because the fertilized egg expels the second polar body, while the unfertilized egg and other eggs with abnormal morphology can be easily distinguished; the selected fertilized egg is transferred to a plastic dish containing droplets of M2 culture medium, and transferred to a carbon dioxide incubator for culture until the fertilized egg is suitable for injection.

[0061] (3) Microinjection: The pPB-CAG-hORMDL3 plasmid and the linearized transgenic vector fragment of helper plasmid (expressing transposase) were injected into the male pronucleus of the fertilized egg of C57BL / 6 mice by microinjection. The fertilized eggs with full cells, clear zona pellucida and clearly visible male pronucleus were selected for use under a microscope. A drop of culture fluid and a drop of transgenic vector fragment solution with 20 fertilized eggs were made on a slide and fixed on the stage. The fertilized eggs were fixed with an egg-holding pipette, and the drop of transgenic vector fragment solution was injected into the glass pipette and slowly injected into the male pronucleus. After the injection, the fertilized eggs were collected and cultured in a carbon dioxide incubator at 37°C overnight.

[0062] (4) Transplantation: Anesthetize the pseudo-pregnant mouse, surgically remove the ovary and connect it to the fallopian tube, fix it with fat forceps, find the opening of the fallopian tube under a microscope, pick out the fertilized egg that has split into two cells under the microscope, and set it aside; suck out the fertilized egg, insert the transplant tube into the fallopian tube, and gently blow the liquid in the transplant tube into it. When the ampulla of the fallopian tube swells and three bubbles are clearly seen, the transplantation is successful; put the ovary and the fallopian tube back into the abdominal cavity and suture them layer by layer.

[0063] (5) PCR was used to identify positive transgenic mice. The tails of transgenic mice were cut at 3 weeks of age, and the cut tissues were collected. The genomic DNA was extracted by alkaline lysis method and detected by PCR using specific primers. Those with positive PCR identification were used as the experimental group, and those with negative PCR identification were used as the wild-type control group. Transgenic mice overexpressing hORMDL3 expressing the target fragment were obtained.

[0064] (6) RT-PCR and Western blot techniques were used to screen out the strain with the highest hORMDL3 expression level and establish a stable hORMDL3 overexpression mouse model; the hORMDL3 overexpression transgenic F0 generation mice were obtained after the mice were first caged together.

[0065] (7) The founder mice were mated with wild-type mice (C57BL / 6J) to conceive, and after natural birth, the mice that tested positive for the genotype of the mouse tail were multiplied, and the mice that could stably overexpress the gene were selected for mating to the F3 generation or above. ORMDL3 Transgenic mice with littermates were used as experimental subjects.

[0066] The present invention found that ORMDL3 is involved in multiple inflammatory pathways and regulates the expression of inflammatory factors. Using the Olink proteomic detection method, the hORMDL3 Tg The difference in protein expression between mice and WT group ( Figure 6 A); Protein difference volcano map ( Figure 6 B) shows that there is one protein with decreased expression and three proteins with increased expression. We further studied the potential functions of the differentially expressed proteins and performed GO and KEGG enrichment analysis. The results showed that these proteins were enriched in multiple GO terms such as cell aggregation and proliferation, prolongation, negative regulation of apoptosis, inflammatory response, and neutrophil differentiation ( Figure 6 CD), and has multiple pathways and diseases such as asthma and inflammatory bowel disease, involving multiple signaling pathways such as MAPK and TNF ( Figure 6 ).

[0067] The model construction method described above is used to construct a hORMDL3 overexpression transgenic mouse model for use in studying the pathogenesis and treatment of asthma and autoinflammatory diseases.

[0068] The above description is only a preferred embodiment of the present invention and is not intended to limit the scope of the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. Application of hORMDL3 gene in constructing inflammatory mouse model.

2. The use according to claim 1, characterized in that: The model specifically overexpresses the hORMDL3 gene, and the nucleotide sequence of the hORMDL3 gene is shown in SEQ ID NO.

1.

3. The use according to claim 1, characterized in that: The model is prepared by injecting the constructed pPB-CAG-hORMDL3 plasmid and helper plasmid (expressing transposase) into mouse embryos through pronuclear injection. Under the action of transposase, pPB-CAG-hORMDL3 is integrated into the genome of the mouse, and finally an animal model overexpressing the hORMDL3 gene is obtained.

4. The use according to claim 1, characterized in that: The animals are C57BL / 6J mice.

5. A method for constructing a hORMDL3 gene overexpression mouse model, characterized in that: The steps include: (1) Clone the target gene hORMDL3 into the vector backbone after restriction digestion to obtain the pPB-CAG-hORMDL3 vector; (2) The pPB-CAG-hORMDL3 plasmid and the linearized transgenic vector fragment of helper plasmid (expressing transposase) were injected into the male pronucleus of fertilized eggs by microinjection and cultured conventionally to obtain a mouse model with inducible overexpression of hORMDL3.

6. The construction method according to claim 5, characterized in that: The nucleotide sequence of the hORMDL3 gene in (1) is shown in SEQ ID NO.

1.

7. An inflammatory mouse model obtained by the construction method according to any one of claims 5 to 6.

8. Use of the inflammatory mouse model according to claim 7 in determining the pathogenesis of inflammation.

9. Use of the inflammatory mouse model according to claim 7 in screening drugs for preventing and / or treating inflammation.

Images