CML37 gene of beach cowpea root system and application of CML37 gene

Abstract

The invention provides a cowpea root system CML37 gene. The sequence of a coding region of the cowpea root system CML37 gene is shown as SEQ ID NO: 1. The cowpea root CML37 gene is cloned from the cowpea root for the first time, and research shows that the gene can remarkably improve the viability of plants under stress of high salinity and the like and promote the growth of the plants; the plant root length is increased, the plant chlorophyll content is increased, the plant electrolyte exosmosis rate and the dead leaf rate are reduced, the Na < + > content and the Cl <-> content in the plant are reduced, and the Ca < 2 + > content in the plant is increased. The salt resistance and drought resistance of the transgenic CML37 soybean are remarkably improved, and the transgenic CML37 soybean is expected to be cultivated into a salt-resistant or drought-resistant transgenic soybean variety to be planted in saline-alkali and drought regions. The invention provides a new candidate gene for research in the aspects of improving the stress resistance of plants, promoting the growth of the plants, changing the phenotypes of the plants and the like.

Description

Technical Field

[0001] The invention belongs to the biological field, and particularly relates to a CML37 gene of a Vigna serrata root system and an application thereof. Background Art

[0002] Vigna marina (Burm.) Merr. is a perennial herb of the genus Vigna. It is a creeping plant that can also climb and grow up to several meters long. It is a wild leguminous plant widely distributed in coastal sands. Vigna marina is found in tropical and subtropical areas and is widely distributed in the coastal areas of southern China. Vigna marina has morphological characteristics such as thick leaves, small specific leaf area, developed palisade tissue, high stomatal density, and large stomatal area index, which can adapt to high temperature, drought, and poor growth environments. Vigna marina is one of the "pantropical plants with drifting seeds in the ocean" and has a certain adaptability to marine propagation. Vigna marina has well-developed root nodules, and symbiotic nitrogen fixation with rhizobia increases soil fertility while improving saline-alkali land, which is beneficial to the growth of surrounding plant groups. The extracts from its stems and leaves have a significant effect on the treatment of skin trauma. Vigna marina grows vigorously in coastal tidal flats and is a potential gene source for breeding high-quality varieties that are drought-resistant and salt-tolerant. Currently, there are few studies on the genes regulating drought and salt tolerance in Vigna fasciata, making it difficult to reveal the unique ecological and biological characteristics of Vigna fasciata, especially the regulatory effects of drought and salt tolerance at the genetic level. Summary of the invention

[0003] The purpose of the present invention is to overcome the deficiencies in the prior art and provide a CML37 gene of the root system of Vigna serrata and its application.

[0004] The first aspect of the present invention is to provide a Vigna serrata root system CML37 gene, the coding region sequence of which is shown as SEQ ID NO:1.

[0005] The second aspect of the present invention is to provide a protein encoded by the CML37 gene of the Vigna serrata root system described in the first aspect of the present invention.

[0006] The third aspect of the present invention is to provide a recombinant vector containing the CML37 gene coding region of the Vigna serrata root system described in the first aspect of the present invention.

[0007] The original vector of the recombinant vector can be a vector commonly used in the field of gene recombination, such as a virus, a plasmid, etc. The present invention is not limited to this. In a specific embodiment of the present invention, the original vector is PHB and WMV069, but it should be understood that the present invention can also use other plasmids, or viruses, etc.

[0008] Preferably, the original vector of the recombinant vector is a PHB expression vector, and the coding region of the Vigna japonica root CML37 gene is located between the BamHI and PstI restriction endonuclease sites of the PHB expression vector.

[0009] Preferably, the original vector of the recombinant vector is the WMV069 expression vector, and the coding region of the Vigna japonica root CML37 gene is located between the BamHI and SpeI restriction endonuclease sites of the WMV069 expression vector.

[0010] The fourth aspect of the present invention is to provide a host bacteria containing the CML37 gene coding region of the cowpea root system described in the first aspect.

[0011] The fifth aspect of the present invention is to provide an expression cassette containing the coding region of the CML37 gene of the Vigna serrata root system described in the first aspect of the present invention.

[0012] The sixth aspect of the present invention is to provide the use of the CML37 gene of the cowpea root system as described in the first aspect of the present invention, or the protein as described in the second aspect of the present invention, or the recombinant vector as described in the third aspect of the present invention, or the host bacteria as described in the fourth aspect of the present invention, or the expression cassette as described in the fifth aspect of the present invention in improving plant salt tolerance and / or improving plant drought tolerance.

[0013] The seventh aspect of the present invention is to provide the use of the CML37 gene of the cowpea root system as described in the first aspect of the present invention, or the protein as described in the second aspect of the present invention, or the recombinant vector as described in the third aspect of the present invention, or the host bacteria as described in the fourth aspect of the present invention, or the expression cassette as described in the fifth aspect of the present invention in promoting plant growth.

[0014] The eighth aspect of the present invention is to provide the use of the CML37 gene of the cowpea root system as described in the first aspect of the present invention, or the protein as described in the second aspect of the present invention, or the recombinant vector as described in the third aspect of the present invention, or the host bacteria as described in the fourth aspect of the present invention, or the expression box as described in the fifth aspect of the present invention in increasing the length of plant roots, and / or increasing the relative content of plant chlorophyll, and / or reducing the electrolyte exudation rate of plants.

[0015] In a specific embodiment of the present invention, the plant is Arabidopsis thaliana.

[0016] The ninth aspect of the present invention is to provide the CML37 gene of the cowpea root system as described in the first aspect of the present invention, or the protein as described in the second aspect of the present invention, or the recombinant vector as described in the third aspect of the present invention, or the host bacteria as described in the fourth aspect of the present invention, or the expression cassette as described in the fifth aspect of the present invention in increasing the photosynthetic rate of plants, and / or increasing the relative content of chlorophyll in plants, and / or reducing the electrolyte exudation rate of plants, and / or reducing Na in plants. + , Cl - content, and / or increase Ca in plants 2+Content and application in reducing plant leaf withering rate.

[0017] In a specific embodiment of the present invention, the plant is soybean.

[0018] The tenth aspect of the present invention is to provide a primer pair, wherein the primer pair is F':TCGAGTGATGGAAAGCGTGTG and R':TCTGCGGACTTGAAGACCTGG; or the primer pair is F':GAGCGTAATGTGTC GAGTGAT and R':CTGATTCTTCCGTCTCCGTTT.

[0019] The present invention cloned the CML37 gene of the root system of Vigna fasciata for the first time. Studies have shown that the gene can significantly improve the survival ability of plants under stresses such as salt tolerance and drought resistance, promote plant growth, increase plant root length, increase plant chlorophyll content, reduce plant electrolyte exudation rate, and reduce Na in plants. + , Cl - content, increase Ca content in plants 2+ The salt tolerance and drought resistance of CML37 transgenic soybeans are significantly improved, and it is expected that they can be cultivated into salt-tolerant or drought-resistant transgenic soybean varieties for planting in saline-alkali and arid areas. The present invention provides new candidate genes for research on improving plant stress resistance, promoting plant growth, changing plant phenotypes, etc. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 The phenotype, root length, relative chlorophyll content and electrolyte exudation rate of CML37 transgenic Arabidopsis after 6 days of 200mM NaCl treatment were measured. WT is wild-type Arabidopsis, and line1-3 are three types of SLAH1 transgenic Arabidopsis. The control is normal cultivation conditions.

[0021] Figure 2 This is the map of the WMV069 empty vector.

[0022] Figure 3 The phenotype, photosynthetic rate, relative chlorophyll content and electrolyte exudation rate of CML37 soybean transformed with 200 mM NaCl for 12 days were determined. The control was the normal cultivation condition, and JACK was the soybean variety transformed with an empty vector.

[0023] Figure 4 The Na content in roots, stems and leaves of CML37 soybeans treated with 200 mM NaCl for 12 days was + , Cl - , Ca 2+ JACK is the soybean variety transformed with an empty vector. CK is the normal cultivation condition, and T is the 200 mM NaCl stress treatment.

[0024] Figure 5 The results of fresh weight and dead leaf rate of CML37 soybeans after 12 days of 200mM NaCl treatment. JACK is an empty vector-transformed soybean variety. The control is normal cultivation conditions.

[0025] Figure 6 The results of phenotype, relative water content and relative chlorophyll content of CML37 soybean after 20 days of 6% PEG simulated drought treatment. JACK is a soybean variety transformed with an empty vector. The control is normal cultivation conditions.

[0026] Figure 7 The results of photosynthetic rate and leaf dead rate of CML37 soybean after 20 days of 6% PEG simulated drought treatment. JACK is an empty vector transformed soybean variety. The control is normal cultivation conditions. DETAILED DESCRIPTION

[0027] The present invention will be further described below with reference to the accompanying drawings in conjunction with specific embodiments to better understand the present invention. Where specific techniques or conditions are not indicated in the embodiments, the techniques or conditions described in the literature in this area or the product specifications are used. Where the manufacturer of the reagents or instruments used is not indicated, they are all conventional products that can be obtained commercially.

[0028] Example 1: Cloning of CML37 gene

[0029] Vigna serrata germplasm was collected from the seaside of Gancheng Town, Dongfang City, Hainan Province, at longitude 108.634, latitude 18.867, and altitude -9.35 meters. Total RNA was extracted from the root system of Vigna serrata, and the first strand of cDNA was obtained by reverse transcription. PCR amplification reaction was performed using the first strand of cDNA as a template and primers F':TCGAGTGATGGAAAGCGTGTG and R':TCTGCGGACTTGAAGACCTGG.

[0030] (1) PCR amplification reaction system:

[0031]

[0032] (2) PCR amplification reaction conditions:

[0033]

[0034] Melting curve:

[0035]

[0036] The amplified product was recovered to obtain the CML37 gene of the Vigna fasciata root system, which was sequenced. The coding region sequence of the CML37 gene of the Vigna fasciata root system is shown in SEQ ID NO:1.

[0037] Example 2: Transgenic Arabidopsis thaliana with CML37 gene

[0038] 1. Planting of Arabidopsis

[0039] 1) Preparation of culture medium: MS was selected as the culture medium for Arabidopsis thaliana and was prepared in advance (pH = 5.8).

[0040] 2) Seed disinfection: Add 1 ml of 5% sodium hypochlorite solution (containing 1 drop of Tween) to a 1.5 ml centrifuge tube, mix by inversion for 8 minutes, and rinse with sterile water 5 times;

[0041] 3) After the sterilized seeds are divided into packages, they are mixed with a 40-50°C culture medium, poured into a plate, and evenly spread in one layer (a small culture dish requires about 4-5 ml of culture medium);

[0042] 4) Seal the plate, put it in a 4℃ refrigerator for 2-3 days, and place it in an artificial climate chamber to start germination and growth. The plant growth environment is 60% relative humidity; constant temperature 21-23℃; photoperiod is 16h light, 8h dark; light intensity is 80-200μmol / M 2 / S;

[0043] 5) Preparation of planting soil: Mix peat soil and vermiculite in a ratio of 2:1 and set aside for later use;

[0044] 6) Soaking the soil: put the soil into the planting pot to about 1cm from the pot mouth, and use Huawuque compound fertilizer (N, P, K = 20%, 20%, 20%) to completely soak it;

[0045] 7) Transplantation: 7 to 12 days after germination, select the healthy and uniformly growing seedlings and transplant them into the culture soil that has been soaked in Huawuque beforehand. Cover it with plastic wrap and remove it after the seedlings are alive.

[0046] 8) Cultivate until it sprouts and flowers.

[0047] 2. CML37 gene positive Agrobacterium

[0048] (1) Construction of recombinant vector

[0049] Total RNA was extracted from the root system of Vigna serrata and reverse transcribed to obtain the first strand of cDNA. The first strand of cDNA was used as a template and F':TCGAGTGATGGAAAGCGTGTG and R':TCTGCGGACTTGAAGACCTGG were used as primers to perform PCR amplification. The reaction system and reaction procedure were as follows:

[0050] PCR system:

[0051]

[0052] Reaction conditions:

[0053]

[0054] The amplified product was recovered to obtain the full-length sequence of CML37 with BamHI and PstI restriction sites. The PHB empty vector and the full-length sequence of CML37 with added restriction sites were double-digested with BamHI and PstI, and then the two fragments were connected, transformed into competent Escherichia coli, and spread on LB solid culture medium. After a single colony was grown, a positive PCR test was performed to obtain the PHB expression vector.

[0055] (2) Cultivation of Agrobacterium

[0056] The Agrobacterium culture medium used was LB medium: 10 g / L peptone, 5 g / L yeast extract, 10 g / L NaCl, pH 7.0 (Note: 15 g agar was added per liter when preparing the solid culture medium.

[0057] Take the competent Agrobacterium stored at -80℃ and place it at room temperature or in the palm of your hand for a while until it partially melts. When it is in an ice-water mixing state, insert it into ice. Add 0.1μg (volume not more than 10μl) plasmid DNA for every 100μl competent state, stir the bottom of the tube by hand to mix, and let it stand on ice for 5min, liquid nitrogen for 5min, 37℃ water bath for 5min, and ice bath for 5min. Add 700μl LB liquid culture medium without antibiotics and culture at 28℃ and 200rpm for 2-3h. Centrifuge at 6000rpm for one minute to collect the bacteria, keep about 100μl of supernatant, gently blow and resuspend the bacteria block, apply it on the LB plate containing 50μg / ml kanamycin, and invert it in a 28℃ incubator for 2-3d. Randomly select a single colony, do colony PCR, identify the correct Agrobacterium monoclone and mark it for use.

[0058] Use a sterile pipette to pick up the marked Agrobacterium monoclone and inoculate it into 1.5ml LB liquid medium containing the corresponding antibiotics (use a 50ml blue-capped centrifuge tube) and shake culture at 30℃, 200rpm for 24h. Inoculate the Agrobacterium culture with a small shake at a ratio of 1% into 100ml LB liquid medium containing antibiotics and shake culture at 30℃ until OD600 = 1.0. Centrifuge at 20℃, 4,000rpm for 15min to collect the bacteria. Use the transformation buffer to evenly blow the bacteria and resuspend them to about OD600 = 1.0 for use.

[0059]

[0060] 3. Transformation of Arabidopsis

[0061] Water the plants that are about to sprout and bloom one day in advance. Invert the small pot and place all the inflorescences in the bacterial solution suspended in the transformation buffer for about 30 seconds. Repeat the transformation once after 7 days. After 2-3 weeks, try to use less nutrient solution to accelerate aging. Collect the mature seeds in a paper bag and put them in a desiccator for 7 days.

[0062] 4. Screening of transgenic Arabidopsis

[0063] 1) Preparation of culture medium: The culture medium for Arabidopsis thaliana is 1 / 2MS (0.8% agar powder, without sucrose, pH 5.8).

[0064] 1 / 2MS (1L) preparation method:

[0065] MS Basal Salt Mixture (Phyto Technology Laboratories#M524): 2.17g

[0066] Murashige and SkoogVitaminpowder(Sigma#M3900): 0.5ml

[0067] Inositol 50mg

[0068] Add water to 1L and adjust the pH to 5.8

[0069] Add 8 g of fat powder and sterilize at 121°C for 20 min.

[0070] 2) Seed disinfection: 70% ethanol for 1 min, add 1 ml of 7% sodium hypochlorite solution (containing 1 drop of Tween) for disinfection for 10 min, invert and mix for 5 min, and rinse with sterile water 5 times.

[0071] 3) Resuspend the sterilized seeds with 100 μl sterile water, pipette with a 1 ml pipette tip, and spot on a 1 / 2 MS medium (selective antibiotics are added to the medium: 50 μg / ml KAN or 30 μg / ml HYG or 50 μM Glufosinate-ammonium) plate.

[0072] 4) Seal the plate, place in a 4℃ refrigerator for 48 hours, and place in an artificial climate chamber to start germination and growth. The plant growth environment is 60% relative humidity; constant temperature 20-22℃; photoperiod is 16h light, 8h dark; light intensity is 80-200μmol / M 2 / S.

[0073] 5) Observe after 8-15 days, identify the positive ones through positive PCR detection and transplant them into planting soil.

[0074] Preparation of planting soil: Mix peat soil and vermiculite in a ratio of 2:1 and set aside.

[0075] 6) Soaking the soil: Fill the soil into the planting pot to about 1 cm from the pot mouth, and use Huawuque compound fertilizer (N, P, K = 20%, 20%, 20%) to completely soak it.

[0076] 7) Transplantation: 20 days after germination, select the healthy and uniformly growing seedlings and transplant them into the culture soil that has been soaked with Huawuque fertilizer in advance. Cover it with plastic wrap and remove it after the seedlings are alive.

[0077] 8) Continue to culture according to the culture method of non-transgenic normal Arabidopsis to obtain transgenic Arabidopsis seeds.

[0078] 5. Salt tolerance test

[0079] Transgenic Arabidopsis seeds were germinated on a medium containing hygromycin and 200 mM NaCl. Wild-type Arabidopsis was used as a control (WT). The control medium was not treated with NaCl and cultured normally. The results were observed after 6 days. Figure 1 As shown, under 200 mM NaCl treatment, the root length of transgenic Arabidopsis was significantly longer than that of the control, the chlorophyll content was significantly increased, and the electrolyte permeability was significantly reduced.

[0080] Method for determining the relative content of chlorophyll: Use a TYS-B chlorophyll meter (Zhejiang Top Company) to measure the SPAD value of chlorophyll content, and randomly select healthy and mature leaves on the upper part of the plant for determination.

[0081] Electrolyte extravasation rate determination method: refer to Zou Qi's method (2004), adopt the conductivity method and improve it. Add 20ml of deionized water to a 50ml centrifuge tube and measure the initial conductivity E0 (S0<0.4); randomly cut healthy and mature leaves from the upper part of the plant, wash with distilled water, dry the water on the leaves with absorbent paper, then accurately weigh 0.5g, cut into 1cm small sections, put in a test tube with the initial conductivity value measured, shake for 24h, and then use a DDS-320 digital conductivity meter (produced by Shanghai Dapu Instrument Co., Ltd.) to measure its conductivity value E1. Then seal the test tube and place it in a boiling water bath for 30min to kill the plant tissue. After taking out the test tube, cool it to room temperature with tap water, shake it well and use a conductivity meter to measure its conductivity value E2. Calculate the relative conductivity according to the formula EL (%) = (E1-E0 / E2-E0) × 100%.

[0082] Example 3: Transgenic soybean with CML37 gene

[0083] 1. CML37 gene positive Agrobacterium

[0084] (1) Construction of recombinant vector

[0085] Total RNA was extracted from the root system of Vigna serrata and reverse transcribed to obtain the first strand of cDNA. The first strand of cDNA was used as a template and PCR amplification was performed with F':GAGCGTAATGTGTCGAGTGAT and R':CTGATTCTTCCGTCTCCGTTT.

[0086] PCR reaction 50μm system:

[0087]

[0088] The reaction procedure is as follows:

[0089] The PCR machine runs the following series of reactions

[0090]

[0091] The amplified product was recovered to obtain the full-length sequence of CML37 with BamHI and SpeI restriction sites. The WMV069 empty vector and the full-length sequence of CML37 with added restriction sites were double-digested with BamHI and SpeI, and then the two fragments were connected, transformed into competent E. coli, and spread on LB solid culture medium. After a single colony was grown, a positive PCR test was performed to obtain the WMV069 expression vector.

[0092] WMV069 empty vector was commissioned by Weimi Biotechnology Co., Ltd. to be transformed from PCAMBIA3300 vector. The map of WMV069 empty vector is as follows Figure 2 shown.

[0093] (2) Cultivation of Agrobacterium

[0094] 1) 20μl Agrobacterium (EHA105-WM) + 1μl recombinant plasmid, ice bath for 5min, quick freeze in liquid nitrogen for 5min, 37℃ water bath for 5min, ice bath for 5min. Add 100μl antibiotic-free LB, shake at 28℃ 200rpm for 2h, directly apply on the plate with corresponding bacterial antibiotics + rifampicin, and culture at 28℃ for two days.

[0095] 2) Picking single clone bacteria:

[0096] Two days later, pick a single clone and put it into a 5 ml sterile EP tube, add 2 ml of the corresponding bacterial antibiotic + rifampicin in advance, and shake the bacteria overnight.

[0097] 3) Preservation of glycerol bacteria: 400μl bacterial solution + 100μl 75% sterile glycerol, mark well, and store in a -70 degree refrigerator. Use the remaining bacterial solution to extract the plasmid and transform E. coli (1μl plasmid + 20μl competent E. coli, stand on ice for 30min, heat shock at 42℃ for 35s, stand on ice for 2min, add 100μl LB without antibiotics, shake at 37℃, 200rpm, for 1h, plate, LB + corresponding bacterial antibiotics, and culture at 37℃ for one day).

[0098] 4) Pick a single clone and shake the bacteria in the morning, send the bacterial solution directly for sequencing in the evening, and select part of it for sequencing.

[0099] 5) The sequencing feedback is correct, verifying that there is no problem with the Agrobacterium, and the prepared Agrobacterium can be used for the subsequent transformation experiment.

[0100] 2. Genetic transformation

[0101] The soybean variety JACK, which has germinated for 1 day, was used as the material and placed in a culture dish containing 50 ml of Agrobacterium suspension. About 150 explants were treated within 2 hours and placed at room temperature for 30 minutes for infection. After the infection, the Agrobacterium liquid was discarded, and the explants were placed in a co-culture medium and co-cultured in the dark at 23°C for 3 days. After co-culture, the embryos were transferred to a resting culture medium, cultured in light at 25°C for 7 days, and then placed on a screening culture medium with corresponding resistance, cultured for three weeks, and induced resistant buds. Then they were transferred to an elongation culture medium with corresponding resistance and cultured in light for 6-9 weeks. The regenerated elongated seedlings were cultured for rooting.

[0102] After transplanting the plug tray, the T0 plants were tested for genes and positive plants were obtained. Primers: Bar-F1: CCATCGTCAACCACTACATCGAGACA and Bar-R1: CTTCAGCAGGTGGGTGTAGAGCGT, amplification size 269bp. The reaction system (20μl) is: 10μl 2*PCR buffer, 7μl H2O, 1μl upstream primer (10μM) 1μl downstream primer (10μM) 1μl DNA. The reaction procedure is as follows:

[0103]

[0104]

[0105] 3. Salt tolerance test

[0106] After the transgenic soybean seedlings were cultured to the T2 generation, the transgenic soybean seedlings (CML37) of 1 month old in sand culture were taken and irrigated with Hongland nutrient solution (control) and Hongland nutrient solution containing 200mM NaCl, respectively, once a day. The soybean seedlings transformed with an empty vector were used as blank control (JACK) and observed after 12 days. Figure 3 and Figure 4 , Figure 5 As shown, Figure 3 In the above figure, the first pot on the left is the control (empty vector-transformed soybean), and the second to fourth pots on the left are CML37-transformed soybeans. Under salt treatment conditions, the growth potential, plant height, and biomass of transgenic soybean seedlings (CML37) were significantly higher than those of empty vector-transformed soybeans (JACK), the photosynthetic rate and relative chlorophyll content were significantly increased, and the electrolyte exudation rate was significantly reduced; the Na in the leaves of transgenic soybean plants + , Cl - The contents of Ca in roots and leaves were significantly lower than those in soybean transformed with empty vector. 2+ The content of Na in the roots, stems and leaves was significantly higher than that in the empty vector transformed soybeans, and the leaf dead rate of the transgenic soybeans was significantly lower than that of the empty vector transformed soybeans. This indicates that the salt tolerance of transgenic soybeans has been significantly improved, and it is expected that they will be cultivated into salt-tolerant transgenic soybean varieties for planting in saline-alkali land. Under normal cultivation conditions, the photosynthetic rate, chlorophyll and electrolyte exudation rate did not change significantly, while the Na in the roots, stems and leaves did not change significantly. + , Ca 2+ The content did not change significantly ( Figure 3 The control group and Figure 4 Under normal cultivation conditions, no dead leaves appeared in soybeans transformed with empty vector and soybeans transformed with CML37, that is, the dead leaf rate was 0.

[0107] Photosynthetic rate determination method: The net photosynthetic rate of leaves (Pn, μmol·CO2 m -2 s -1 ). The parameters for photosynthesis determination were set as follows: CO2 concentration 400 μmol·mol -1 , flow rate 400 μmol·s -1 , the light intensity was 1000 μmol·m -2 s -1 The leaves measured were randomly selected from the upper part of the plant, which were healthy and mature.

[0108] The formula for calculating the leaf withering rate is: the percentage of leaves with withering symptoms in 50% of the area to the total number of leaves (Feng, 2018).

[0109] Method for determining the relative content of chlorophyll: Use a TYS-B chlorophyll meter (Zhejiang Top Company) to measure the SPAD value of chlorophyll content, and randomly select healthy and mature leaves on the upper part of the plant for determination.

[0110] Electrolyte extravasation rate determination method: refer to Zou Qi's method (2004), adopt the conductivity method and improve it. Add 20ml of deionized water to a 50ml centrifuge tube and measure the initial conductivity E0 (S0<0.4); randomly cut healthy and mature leaves from the upper part of the plant, wash with distilled water, dry the water on the leaves with absorbent paper, then accurately weigh 0.5g, cut into 1cm small sections, put in a test tube with the initial conductivity value measured, shake for 24h, and then use a DDS-320 digital conductivity meter (produced by Shanghai Dapu Instrument Co., Ltd.) to measure its conductivity value E1. Then seal the test tube and place it in a boiling water bath for 30min to kill the plant tissue. After taking out the test tube, cool it to room temperature with tap water, shake it well and use a conductivity meter to measure its conductivity value E2. Calculate the relative conductivity according to the formula EL (%) = (E1-E0 / E2-E0) × 100%.

[0111] Na + , Ca 2+ Content determination method: microwave digestion-ICP OES method; Cl - Content determination method: Argentometric method (direct titration method).

[0112] 4. Drought tolerance experiment

[0113] After the transgenic soybean seedlings were cultured to the T2 generation, the transgenic soybean seedlings (CML37) that had been cultured in the sand for 12 days were taken and treated with 6% PEG for 20 days. The experimental materials were placed in a plastic pot (90×70×9 cm) for simulated drought treatment. The pot contained Hongland nutrient solution containing 6% PEG and was oxygenated by an air pump. Soybeans transformed with an empty vector were used as blank controls (JACK) and observed after 20 days. The control group was cultivated normally without any stress treatment. The results are shown in Figure 2. Figure 6 and Figure 7 shown. Figure 6 The above picture shows the phenotype of soybean plants under drought treatment conditions. Among them, the first to third pots on the left are empty vector transformed soybeans, and the fourth to sixth pots on the left are CML37 transformed soybeans. The results showed that under drought treatment conditions, the dead leaf rate of CML37 transformed soybeans was significantly reduced, and the relative chlorophyll content, relative water content and photosynthetic rate were significantly higher than those of the control empty vector transformed soybeans. This shows that the drought resistance of CML37 gene-transformed soybeans has been significantly improved, and it is expected to be cultivated into drought-resistant transgenic soybean varieties. However, under normal cultivation conditions, empty vector-transformed soybeans and CML37-transformed soybeans had no dead leaves, that is, the dead leaf rate was 0. Therefore, under normal cultivation conditions, there were no significant differences in photosynthetic rate, relative chlorophyll content, relative water content and dead leaf rate between empty vector-transformed soybeans and CML37-transformed soybeans.

[0114] The formula for calculating the leaf withering rate is: the percentage of leaves with withering symptoms in 50% of the area to the total number of leaves (Feng, 2018).

[0115] Method for determining the relative content of chlorophyll: Use a TYS-B chlorophyll meter (Zhejiang Top Company) to measure the SPAD value of chlorophyll content, and randomly select healthy and mature leaves on the upper part of the plant for determination.

[0116] Method for determining relative water content of leaves: Use the saturated weighing method to measure the relative water content of leaves. Cut about 0.2g of the leaves to be tested, put them into a centrifuge tube of known weight, and immediately weigh their fresh weight (W1) with a 1 / 10,000 balance. Then, soak the weighed fresh plant material in water for 24 hours, take out the leaves to absorb the water on the surface, and weigh their saturated weight (W2); finally, after drying in a 105℃ oven for 1 hour, dry them at 85℃ to constant weight, and weigh their dry weight (W3). The calculation formula is:

[0117]

[0118] The specific embodiments of the present invention are described in detail above, but they are only examples, and the present invention is not limited to the specific embodiments described above. For those skilled in the art, any equivalent modification and substitution of the practical is also within the scope of the present invention. Therefore, the equalization transformation and modification made without departing from the spirit and scope of the present invention should be included in the scope of the present invention.

Claims

1. A CML37 gene of Vigna serrata root system, characterized in that: The coding region sequence is shown in SEQ ID NO:

1.

2. The protein encoded by the CML37 gene of the Vigna foetida root system according to claim 1.

3. A recombinant vector or host bacteria or expression cassette containing the CML37 gene coding region of Vigna foetida root system according to claim 1.

4. The recombinant vector according to claim 3, characterized in that The original vector of the recombinant vector is the PHB expression vector, and the coding region of the CML37 gene of the cowpea root system is located between the BamHI and PstI restriction endonuclease sites of the PHB expression vector; or, the original vector of the recombinant vector is the WMV069 expression vector, and the coding region of the SLAH1 gene of the cowpea root system is located between the BamHI and SpeI restriction endonuclease sites of the WMV069 expression vector.

5. Use of the CML37 gene of the root system of Vigna caerulea as claimed in claim 1, or the protein as claimed in claim 2, or the recombinant vector or host bacteria or expression cassette as claimed in any one of claims 3 to 5 in improving plant salt tolerance, and / or improving plant drought tolerance, and / or promoting plant growth.

6. Use of the CML37 gene of the Vigna sibiricum root system as described in claim 1, or the protein as described in claim 2, or the recombinant vector or host bacteria or expression cassette as described in any one of claims 3 to 5 in increasing the length of plant roots, and / or increasing the relative content of plant chlorophyll, and / or reducing the electrolyte exudation rate of plants.

7. The use according to claim 6, characterized in that The plant is Arabidopsis thaliana.

8. The CML37 gene of the cowpea root system as claimed in claim 1, or the protein as claimed in claim 2, or the recombinant vector or host bacteria or expression cassette as claimed in any one of claims 3 to 5 is effective in increasing the photosynthetic rate of plants, and / or increasing the relative content of chlorophyll in plants, and / or reducing the electrolyte exudation rate of plants, and / or reducing the Na in plants + , Cl - content, and / or increase Ca in plants 2+ content, and / or reducing plant leaf decay rate, and / or increasing plant biomass.

9. The use according to claim 8, characterized in that The plant is soybean.

10. A primer pair, characterized in that: The primer pair is F':TCGAGTGATGGAAAG CGTGTG and R':TCTGCGGACTTGAAGACCTGG; or F':GAGCGTAATGT GTCGAGTGAT and R':CTGATTCTTCCGTCTCCGTTT.

Images