Application of OsGRDP1 gene in regulation and control of Cd accumulation of rice

Abstract

The invention discloses an application of an OsGRDP1 gene in regulation and control of Cd accumulation of rice. Through construction of OsGRDP1 gene overexpression transgenic rice, it is found that OsGRDP1 gene overexpression can improve Cd accumulation in rice seeds, it is suggested that OsGRDP1 positively regulates accumulation of Cd in rice seeds, and the OsGRDP1 has good application potential in molecular breeding of low-cadmium rice.

Description

Technical Field

[0001] The invention relates to the technical field of gene breeding, and in particular to application of OsGRDP1 gene in regulating Cd accumulation in rice. Background Art

[0002] Cadmium (Cd) is a major pollutant in my country's soil. After being absorbed by plant roots, Cd not only affects plant growth and metabolism, leading to a decrease in crop yield and quality, but can also migrate and accumulate through the food chain, seriously threatening human health and causing poisoning diseases such as "Itai-itai disease" and "rickets".

[0003] Many rice fields with moderate to light Cd pollution cannot be stopped for restoration and must still be engaged in high-intensity agricultural production, which further increases the risk of Cd migrating to the human body.

[0004] Transgenic technology is a technology that uses genetic engineering methods to modify the genetic information of organisms. Rice transgenic technology can use beneficial genes to improve the agronomic traits of rice and enhance the ability of rice to resist biotic and abiotic stresses. However, in actual applications, strict safety assessment and supervision are required to ensure that the impact of genetically modified rice on the environment and human health is within a controllable range.

[0005] In the prior art, the genes reported for rice resistance to Cd include: OsbZIP39 gene, OsGSTU19 gene, miR268, OsABCC1 gene, OsGSTU37 gene, OsNramp5 gene, OsFWL7 gene, OsHMA3 gene, etc. The GRDP series of genes have been verified to improve rice disease resistance, but there are no reports on Cd resistance. Summary of the invention

[0006] In view of the limited gene resources for controlling Cd accumulation in rice in the prior art, which greatly restricts the technical problem of rice genetic improvement for coping with Cd pollution in cultivated land, the present invention aims to provide the application of OsGRDP1 gene in regulating Cd accumulation in rice. By constructing an OsGRDP1 overexpression vector, it is found that overexpression of OsGRDP1 gene can significantly increase the Cd content in rice seeds, which provides a new idea for molecular breeding of low-cadmium rice.

[0007] The present invention provides application of OsGRDP1 gene in regulating Cd accumulation in rice. The nucleotide sequence of the OsGRDP1 gene is shown as SEQ ID No.1.

[0008] The present invention verifies that overexpression of the OsGRDP1 gene can significantly increase the Cd content in rice seeds. Based on this, the present invention also provides the use of the OsGRDP1 gene in regulating Cd accumulation in rice seeds.

[0009] Furthermore, the present invention also provides the use of the OsGRDP1 gene in cultivating rice seeds with low Cd accumulation.

[0010] Furthermore, the present invention also provides the use of the OsGRDP1 gene in cultivating high Cd tolerance rice seeds.

[0011] Compared with the prior art, the present invention has the following beneficial effects:

[0012] The present invention verifies that the OsGRDP1 gene can be used as a gene for regulating Cd accumulation in rice seeds and verifies its function, providing theoretical support in molecular biology and potential gene improvement targets for genetic improvement of rice to cope with Cd pollution in cultivated land. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 This is the map of the pCAMBIA-OsGRDP1-eGFP vector in Example 1 of the present invention.

[0014] Figure 2 The expression levels of the OsGRDP1 gene in various rice tissues (a) and the Cd-induced expression level (b) in Example 3.

[0015] Figure 3 The gene expression level in the roots (a) and the Cd content in the grains (b) of the OsGRDP1 overexpressing rice lines in Example 3.

[0016] Figure 4 Schematic diagram of the PCR amplification process in Example 4 (a) and the Cd tolerance of OsGRDP1 transformed Cd-sensitive yeast Δyap1 (b). DETAILED DESCRIPTION

[0017] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with specific embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0018] It should be noted that the primers and the like involved in the embodiments of the present invention were all commissioned to be synthesized by Sangon Biotechnology (Shanghai) Co., Ltd.

[0019] Example 1 Construction of OsGRDP1 overexpression vector in rice

[0020] The CDS sequence of the gene OsGRDP1 was obtained from the official website of the Rice Genome Annotation Project (RGAP). The sequence number was Os11g0621300, and the AC number in NCBI was LOC4350947. The specific nucleotide sequence was shown in SEQ ID No. 1. Specific primers for PCR amplification were designed. The wild-type rice ZH11 genomic cDNA was selected as a template, and the designed primers (Primer-F1: acgggggactctagaggatccATGGACGGGGAGCAAGAGGC (SEQID No. 2), Primer-R1: gcccttgctcaccatactagtGGTGCTCGCGTTGAGCATCG (SEQ ID No. 3)) were used to amplify the target gene DNA fragment by PCR technology, as shown in FIG. Figure 1 The pCAMBIA1300-35s vector BamH1 and Spe1 double restriction enzyme digestion system (Table 1) was prepared and reacted at 37°C for 45 min.

[0021] Table 1 Double enzyme digestion system

[0022]

[0023] After the reaction is completed, the target fragment and the linear vector are immediately subjected to gel electrophoresis (155v, 20min), and then the gel is placed in a chemiluminescence imaging system to observe the band position, and the agarose gel block containing the target DNA fragment is cut out under ultraviolet light. The AxyPrep DNA gel recovery kit is used for recovery.

[0024] The specific steps are as follows:

[0025] a. Use a paper towel to absorb the liquid on the surface of the agarose gel containing the target DNA and chop it into pieces.

[0026] b. Add about 600 μL Buffer DE-A, mix well, and heat at 75°C, mixing intermittently every 2-3 minutes until the gel block is completely melted (about 6-8 minutes).

[0027] c. Add 0.5 volume of Buffer DE-B to Buffer DE-A, i.e. 300μL DE-B, and mix well. (When the separated DNA fragment is less than 400bp, add 1 gel volume of isopropanol.)

[0028] d. Pipette the mixed solution from step c, transfer it to the DNA preparation tube, place it in a 2 mL ep tube, centrifuge at 12000g for 1 min, and discard the filtrate.

[0029] e. Place the preparation tube back into a 2 mL centrifuge tube, add 500 μL of Buffer W1, centrifuge at 12000 g for 30 s, and discard the filtrate.

[0030] f. Place the preparation tube back into a 2 mL centrifuge tube, add 700 μL Buffer W2, centrifuge at 12000 g for 30 s, and discard the filtrate.

[0031] g. Wash once more with 700 μL Buffer W2 in the same way, centrifuge at 12000 g for 1 min, and discard the filtrate.

[0032] h. Place the preparation tube back into the 2 mL ep tube and centrifuge at 12000 g for 1 min.

[0033] i. Place the preparation tube in a clean 1.5mL Eppendorf tube, add 25-30μL Eluent or ddH2O in the center of the preparation membrane (heating Eluent or ddH2O to 65°C will improve the elution efficiency), let stand at room temperature for 1 minute, and centrifuge at 12000g for 1 minute to elute the DNA.

[0034] After the PCR product was purified and recovered, the product concentration was measured with an ELISA instrument, and then the ClonExpress II One Step Cloning Kit from Vazyme was used for recombination and ligation. The reaction solution was prepared according to the system shown in (Table 2) according to the fragment concentration, and the reaction was carried out at 37°C for 30 minutes. After the reaction was completed, it was placed on ice.

[0035] Table 2 Recombination reaction system

[0036]

[0037] Take 10μl of the recombinant product and add it to 100μl of competent cells that have been thawed on ice in advance. Tap the tube wall to mix evenly and let it stand on ice for 10 minutes. Heat shock the mixture in a 42℃ water bath for 90 seconds, and immediately cool it on ice for 2 minutes. Add 1mL of liquid LB culture medium without antibiotics to the mixture, and put it in a shaker at 37℃ and 200rpm for 30 minutes to recover. After recovery, centrifuge at 5000rpm for 30s, discard part of the supernatant, use a pipette to blow the remaining LB culture medium in the tube to resuspend the bacteria, and then use a sterile coating stick to evenly spread it on the Kan. + Place the plate on the antibiotic LB plate, let it air dry, and place it in a 37°C biochemical incubator for 16-18 hours. In the clean bench, pick the monoclonal colony on the LB plate and inject it into the Kan +In liquid LB containing antibiotics, culture in a shaker at 37°C and 220 rpm for about 8 hours. Take a certain amount of bacterial solution to prepare the reaction system (Table 3) for PCR bacterial solution identification, and perform gel electrophoresis to preliminarily determine whether the bacterial solution is correct.

[0038] Table 3 Bacterial liquid PCR reaction system

[0039]

[0040] If the gel electrophoresis bands are correct, the bacterial solution is entrusted to Sangon to be sequenced. After the sequencing results are correct, the plasmid is extracted using the SanPrep column plasmid DNA small-scale extraction kit and entrusted to Wuhan Boyuan Company for genetic transformation into rice ZH11. The plasmid extraction steps are as follows:

[0041] a. Use a pipette to aspirate 2 ml of cultured bacterial solution and transfer it to a 2 ml centrifuge tube. Centrifuge at 8000 g for 2 min to collect the bacteria and discard the supernatant.

[0042] b. Add 250 μl Buffer P1 to a 2 ml centrifuge tube and thoroughly suspend the bacteria.

[0043] c. Add 250 μl of Buffer P2, mix immediately by gentle inversion (5-10 times), and let stand at room temperature for 2 min.

[0044] d. Add 350 μl Buffer P3 and immediately mix by gentle inversion (5-10 times).

[0045] e. Then centrifuge at 12,000 g for 10 min, transfer the supernatant into the adsorption column with a pipette, centrifuge at 8,000 g for 30 s, and discard the filtrate.

[0046] f. Add 500 μl Buffer DW1, centrifuge at 9,000 g for 30 s, and discard the filtrate.

[0047] g. Add 500 μl Wash Solution, centrifuge at 9,000 g for 30 s, and discard the filtrate.

[0048] h. Repeat step 7 once.

[0049] i. Place the adsorption column in a centrifuge tube and centrifuge at 9,000 g for 1 min.

[0050] j. Place the adsorption column in a new 1.5 ml centrifuge tube, add 50-100 μl Elution Buffer to the center of the filter membrane, let it stand at room temperature for 1 min, centrifuge at 9,000 g for 1 min, and store the obtained plasmid at -20°C.

[0051] Example 2 Identification of rice overexpression lines

[0052] After obtaining the T0 generation transgenic seedlings, the leaves were cut to extract DNA, and PCR amplification and identification were performed using the specific primers of the hygromycin resistance gene Hyg-F: TCCTGCGGGTAAATAGCTGC (SEQ ID No. 4); Hyg-R: CTCGTCTGGCTAAGATCGGC (SEQ ID No. 5). According to the gel electrophoresis imaging gel map, if there is a band at the 250bp size position, it means that the strain has hygromycin resistance, and if there is no band, the strain does not have hygromycin resistance. The positive plants containing hygromycin were transplanted to the field for seed breeding.

[0053] After harvesting the T1 generation seeds, the seeds were germinated in a hydroponic box for 5 days and cultured with a hygromycin solution at a concentration of 50 mg / L. The wild type ZH11 (without hygromycin resistance) was used as a negative control. The survival of the overexpression material and the negative control was observed, and the positive homozygous strains were screened. The homozygous strains were re-germinated and hydroponically cultured to the two-leaf and one-heart stage. The roots and aerial parts were taken to extract RNA and reverse transcribed into cDNA. With OsActin1 as the internal reference gene, primers were designed to identify the expression of the OsGRDP1 gene. Primers qRT-F: CTACCTGCACTGGCATTTCT (SEQ ID No. 6); qRT-R: GCTCCGACAATGGAGAACAA (SEQ ID No. 7); strains with higher expression levels were screened.

[0054] Example 3 Determination of Cd accumulation content in transgenic rice

[0055] OsGRDP1 overexpression material with ZH11 as background was constructed, and overexpression strains OsGRDP1-1 and OsGRDP1-4 were obtained through hygromycin identification and gene expression analysis. The Cd content of the grains of overexpression rice lines grown in Cd-contaminated fields was determined. The rice grains were first dried in an oven at 85℃ for 3 days; steel balls were placed in a centrifuge tube containing the dried samples and crushed using a high-throughput grinder at 40HZ for 12 minutes; the corresponding weight (<100mg) of powder samples were weighed and placed in a cell flow tube that is resistant to high temperature and acid and alkali; 1mL 65% nitric acid was added to each sample tube, and after shaking and mixing, it was placed in a fume hood for static digestion overnight; the digested samples were placed in a 100℃ water bath and digested until the samples were clear and transparent; the digested samples were diluted 13 times with ultrapure water for determination, and the Cd ion content was determined using an inductively coupled plasma mass spectrometer (PerkinElmer NexION 300).

[0056] The OsGRDP1 gene is mainly expressed in the aboveground tissues of the seedling stage and in the nodes of the mature stage ( Figure 2 a), and was up-regulated by Cd treatment in roots ( Figure 2b). Transgenic rice lines in which the OsGRDP1 gene is overexpressed were constructed. The expression level of the OsGRDP1 gene in the two overexpression lines was increased by about 3 times compared with that in wild-type rice ( Figure 3 a). The Cd accumulation concentration in the rice seeds of the transgenic overexpression lines was significantly higher than that of the wild-type rice, reaching about 2 times the concentration in the wild-type rice seeds ( Figure 3 b), suggesting that overexpression of the OsGRDP1 gene positively regulates Cd accumulation in rice seeds.

[0057] Example 4 Construction of transgenic yeast and determination of tolerance to Cd stress

[0058] The wild-type rice ZH11 genomic cDNA was selected as a template, and the target gene DNA fragment was amplified by PCR technology using the designed primers (Primer-F2: cttggtaccgagctcggatccatggacggggagcaagaggc (SEQ ID No.8), Primer-R2: tgatggatatctgcagaattctcaggtgctcgcgttgagca (SEQ ID No.9)). Figure 4 (a) As shown. The pYES2-OsGRDP1 vector was constructed using the method in Example 1 with BamH1 and EcoRI enzyme sites, and the Cd-sensitive yeast mutant Δyap1 was transformed using the PEG-mediated Saccharomyces cerevisiae transformation method. The tolerance of the transgenic yeast to Cd stress was verified by culturing on a medium containing high concentrations of Cd. The experimental results are shown in Figure 4 As shown in b, the growth of the Δyap1 yeast strain transformed with the empty vector and the OsGRDP1 gene on normal culture medium was the same, but under 20 μmol / L Cd stress, the growth of the yeast strain transformed with the OsGRDP1 gene was significantly better than that of the yeast strain transformed with the empty vector. This indicates that the expression of the OsGRDP1 gene can enhance the tolerance of yeast cells to Cd toxicity. This suggests that the OsGRDP1 gene can improve the tolerance of rice to cadmium.

[0059] The above description is only a preferred specific implementation manner of the present invention, but the protection scope of the present invention is not limited thereto. Any technician familiar with the technical field can make equivalent replacements or changes according to the technical scheme and inventive concept of the present invention within the technical scope disclosed by the present invention, which should be covered by the protection scope of the present invention.

Claims

1. Application of OsGRDP1 gene in regulating Cd accumulation in rice, characterized in that: The nucleotide sequence of the OsGRDP1 gene is shown in SEQ ID No.

1.

2. Application of OsGRDP1 gene in regulating Cd accumulation in rice seeds, characterized in that: The nucleotide sequence of the OsGRDP1 gene is shown in SEQ ID No.

1.

3. Application of OsGRDP1 gene in breeding rice seeds with low Cd accumulation.

4. Application of OsGRDP1 gene in breeding high Cd tolerance rice seeds.

Images