Method for silencing oil tea fruit gene based on VIGS and application thereof

Abstract

The invention discloses a method for silencing a camellia oleifera fruit gene based on VIGS and application of the method. According to the method provided by the scheme of the invention, the oil-tea camellia fruits are used as materials, and agrobacterium tumefaciens is used for mediating and infecting the oil-tea camellia fruits to obtain the gene-silent oil-tea camellia fruits. According to the method provided by the scheme of the invention, the oil-tea camellia fruits are used as materials, and agrobacterium tumefaciens is used for mediating and infecting the oil-tea camellia fruits to obtain the gene-silent oil-tea camellia fruits. The method provided by the invention can effectively reduce the expression level of the target gene in the camellia oleifera fruit, obtain the gene silencing camellia oleifera fruit induced by the virus, verify the function of the target gene in the camellia oleifera fruit, is simple to operate, high in silencing efficiency and good in stability, can rapidly and efficiently infect the camellia oleifera pericarp, and identify the biological function of the gene for regulating the pericarp phenotype. The method is crucial for developing oil tea fruit key gene function research, and provides a thought for developing hard fruit peel gene function research.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and specifically relates to a method for silencing oil-tea camellia fruit genes based on VIGS and an application thereof. Background Art

[0002] Gaozhou Camellia drupifera, also known as big-fruited Camellia drupifera, has a large plant shape, large fruit shape and high oil content. The tea oil produced is rich in fragrance. It is planted in various parts of Guangdong Province. It is one of the famous geographical species of Camellia drupifera and an important component of the southern edge of Camellia drupifera. The husk accounts for a large proportion of the Camellia drupifera fruit. The outer skin has obvious color differences and is very thick. It is mainly used to resist biotic and abiotic stresses. At present, through the analysis and research of the Camellia drupifera reference genome, transcriptome, metabolome, and proteome, some candidate genes that regulate the thickness, color, and oil content of the peel of Camellia drupifera have been located. However, because Camellia drupifera is a woody crop with a long growth cycle and highly lignified peel, it lacks an efficient genetic transformation system. Therefore, many molecular regulatory mechanisms remain unclear.

[0003] There are many transient expression methods used in the field of plants. Virus-induced gene silencing (VIGS) uses the post-transcriptional gene silencing (PTGS) mechanism of plants to systematically inhibit viral infection and is used to downregulate endogenous genes in plants to prevent systemic viral infection. VIGS has the advantages of simple operation, short research cycle, and no genetic transformation. The main inoculation site of VIGS-TRV is through the inoculation of leaves. It has been used in jujube, citrus, tea, lemon, tung, oil palm and olive. However, inoculation in fruits, especially hard fruit peels, is relatively lacking, especially in perennial nuts including camellia oil. The difficulty of Agrobacterium-mediated recombinant virus plasmid infection of Gaozhou camellia oil fruit is that the fruit is very hard, and the conversion rate of the traditional acupuncture method is very low. Therefore, constructing a VIGS silencing system for camellia oil fruit and determining an efficient infection method are conducive to the study of key gene functions in camellia oil fruit, and at the same time provide ideas for the study of gene functions in the peel of hard fruits. Summary of the invention

[0004] The present invention aims to solve at least one of the technical problems existing in the above-mentioned prior art. To this end, the present invention proposes a method for silencing Camellia oleifera fruit genes based on VIGS.

[0005] The present invention also proposes the application of the above method.

[0006] The present invention also provides a target sequence for silencing the CdLAC15 gene or the CdCRY1 gene.

[0007] The present invention also provides a VIGS virus vector system for silencing the CdLAC15 gene or the CdCRY1 gene.

[0008] The present invention also provides an engineered bacterium for silencing the CdLAC15 gene or the CdCRY1 gene.

[0009] The present invention also provides an infection solution for silencing the CdLAC15 gene or the CdCRY1 gene.

[0010] The present invention also proposes the use of the above-mentioned target sequence, VIGS virus vector system, engineered bacteria or infection fluid in silencing the CdLAC15 gene or the CdCRY1 gene.

[0011] The present invention also proposes the use of the above-mentioned target sequence, VIGS virus vector system, engineered bacteria or infection liquid in the preparation of products for silencing CdLAC15 gene or CdCRY1 gene.

[0012] According to the first aspect of the present invention, a method for silencing genes in Camellia oleifera fruit based on VIGS is proposed, the method comprising the following steps: infecting Camellia oleifera fruit with a VIGS vector, and obtaining gene-silenced Camellia oleifera fruit after culturing; the VIGS vector is composed of a TRV2-specific fragment vector and a TRV1 vector.

[0013] In some embodiments of the present invention, the TRV2-specific fragment vector is a recombinant vector containing a target gene-specific fragment and a tobacco rattle virus coat protein encoding gene.

[0014] In some embodiments of the present invention, the target gene includes a pigment synthesis gene.

[0015] In some embodiments of the present invention, the pigment synthesis gene includes one of the CdCRY1 gene and the CdLAC15 gene.

[0016] In some embodiments of the present invention, when the target gene is the CdLAC15 gene, the target gene-specific fragment sequence is shown in SEQ ID NO:3.

[0017] In some embodiments of the present invention, when the target gene is the CdCRY1 gene, the target gene-specific fragment sequence is shown in SEQ ID NO:4.

[0018] In some embodiments of the present invention, the TRV1 vector is a vector containing an RNA-dependent RNA polymerase.

[0019] In some embodiments of the present invention, the oil-tea camellia fruit is a oil-tea camellia fruit that has grown to the 64th to 187th day from the fertilization development period.

[0020] In some embodiments of the present invention, the oil-tea camellia fruit is a oil-tea camellia fruit that has grown to the 156th to 187th day from the fertilization development period.

[0021] In some embodiments of the present invention, the infection includes the following steps: introducing the TRV2-specific fragment vector into Agrobacterium tumefaciens to obtain recombinant Agrobacterium tumefaciens 2, and introducing the TRV1 vector into Agrobacterium tumefaciens to obtain recombinant Agrobacterium tumefaciens 1; mixing the recombinant Agrobacterium tumefaciens 2 and the recombinant Agrobacterium tumefaciens 1 to prepare an infection solution; and transferring the infection solution into tea oil fruits.

[0022] In some embodiments of the present invention, the volume ratio of the recombinant Agrobacterium tumefaciens 2 to the recombinant Agrobacterium tumefaciens 1 is (1-2):(1-3).

[0023] In some embodiments of the present invention, the added volume ratio of the recombinant Agrobacterium tumefaciens 2 and the recombinant Agrobacterium tumefaciens 1 is 1:1.

[0024] In some embodiments of the present invention, the OD600 value of the recombinant Agrobacterium tumefaciens in the infection solution is 0.6-1.0.

[0025] In some embodiments of the present invention, the transfer method includes one of the following: fruit stalk injection method, fruit peel direct injection method, fruit peel wound immersion method, and fruiting mother branch infusion method. Through the optimization of the transfer method in the scheme of the present invention, the oil-tea camellia peel can be quickly and efficiently infected, and the biological function of genes regulating the peel phenotype can be identified, which is very important for conducting research on the key gene functions of oil-tea camellia fruits, and at the same time provides ideas for conducting research on the gene functions of the peels of hard fruits.

[0026] In some embodiments of the present invention, the fruit stalk injection method includes the following steps: using a syringe to draw 1-3 mL of infection liquid, then inserting the needle into the fruit stalk with an insertion depth of 5-8 mm, after injecting 3-5 times, soaking the fruit in the infection liquid for 20-40 seconds, and protecting from light after the injection is completed.

[0027] In some embodiments of the present invention, the light-shielding treatment is performed by wrapping in a kraft bag.

[0028] In some embodiments of the present invention, the peel injection method includes the following steps: using a syringe to draw 1-3 mL of the infection solution, inserting the needle into the surface of the peel to a depth of 1-2 cm; after injection, soaking the fruit in the infection solution for 20-40 seconds, wrapping it with gauze and dripping it until the gauze is moistened, and then wrapping it with plastic wrap to protect it from light.

[0029] In some embodiments of the present invention, the drip irrigation time is 4-6s.

[0030] In some embodiments of the present invention, the light-shielding treatment is performed by wrapping in a kraft bag.

[0031] In some embodiments of the present invention, the peel wound immersion method includes the following steps: making a wound about 1 cm long and 5 mm deep on the peel of the tea oil fruit, with the number of wounds being 3-5; soaking the fruit in the infection solution for 30 seconds, wrapping it with gauze and drip-irrigating it, and after moistening the gauze, wrapping it with plastic wrap and then protecting it from light.

[0032] In some embodiments of the present invention, the drip irrigation time is 4-6s.

[0033] In some embodiments of the present invention, the light-shielding treatment is performed by wrapping in a kraft bag.

[0034] In some embodiments of the present invention, the fruiting mother branch infusion method includes the following steps: selecting a mother branch about 20-30 cm away from the fruit, inserting an infusion needle containing an infectious solution into the transmissive layer of the mother branch about 1 cm for infusion; the infusion volume of the infectious solution is 400-600 mL, and the infusion flow rate is 100 to 150 drops per minute.

[0035] In some embodiments of the present invention, the transfer method includes one of a fruit stalk injection method, a fruit peel direct injection method, and a fruit peel wound immersion method.

[0036] In some embodiments of the present invention, the culture is normal growth on a tea oil tree.

[0037] According to a second aspect of the present invention, an application of the above method is proposed, wherein the application is application in silencing Camellia oleifera fruit genes.

[0038] In some embodiments of the present invention, the target gene includes a pigment synthesis gene.

[0039] In some embodiments of the present invention, the pigment synthesis gene includes one of the CdCRY1 gene and the CdLAC15 gene.

[0040] In some embodiments of the present invention, the application is application in gene function verification in Camellia oleifera fruit.

[0041] According to the third aspect of the present invention, a target sequence for silencing the CdLAC15 gene or the CdCRY1 gene is proposed, wherein the target sequence for silencing the CdLAC15 gene is shown as SEQ ID NO.3; the target sequence for silencing the CdCRY1 gene is shown as SEQ ID NO.4.

[0042] According to a fourth aspect of the present invention, a VIGS viral vector system for silencing the CdLAC15 gene or the CdCRY1 gene is proposed, wherein the VIGS vector system contains the above-mentioned target sequence.

[0043] According to a fifth aspect of the present invention, an engineered bacterium for silencing the CdLAC15 gene or the CdCRY1 gene is provided, wherein the engineered bacterium contains the above-mentioned vector system.

[0044] In some embodiments of the present invention, the engineered bacteria include Agrobacterium tumefaciens.

[0045] According to a sixth aspect of the present invention, an infection solution for silencing the CdLAC15 gene or the CdCRY1 gene is provided, wherein the infection solution contains the above-mentioned engineered bacteria.

[0046] According to a seventh aspect of the present invention, the use of the above-mentioned target sequence, VIGS viral vector system, engineered bacteria or infection fluid in silencing the CdLAC15 gene or the CdCRY1 gene is proposed.

[0047] According to an eighth aspect of the present invention, the use of the above-mentioned target sequence, VIGS viral vector system, engineered bacteria or infection fluid in the preparation of a product for silencing the CdLAC15 gene or the CdCRY1 gene is proposed.

[0048] According to some embodiments of the present invention, at least the following beneficial effects are achieved: The method of the scheme of the present invention uses tea-oil fruit as a material and uses Agrobacterium-mediated infection of tea-oil fruit to obtain gene-silenced tea-oil fruit. The method of the present invention can effectively reduce the expression level of target genes (such as CdLAC15 and CdCRY1 genes) in tea-oil fruit, obtain virus-induced gene-silenced tea-oil fruit, verify the function of the target gene in tea-oil fruit, is simple to operate, has high silencing efficiency, good stability, can quickly and efficiently infect tea-oil peel, identify the biological function of genes that regulate peel phenotypes, is crucial for conducting research on the key gene functions of tea-oil fruit, and provides ideas for conducting research on the gene functions of the peel of hard fruits.

[0049] At the same time, the scheme of the present invention uses Camellia oleifera fruit as the infection object of the VIGS system for the first time, transforms the TRV2 virus silencing expression vector TRV2-CdCRY1 or TRV2-CdLAC15 containing the CdCRY1 gene or CdLAC15 gene specific fragment into Agrobacterium, mixes the Agrobacterium liquid containing TRV1 and the Agrobacterium liquid containing TRV2-CdCRY1 or TRV2-CdLAC15, and obtains the silencing system. The above-mentioned silencing system is used to infect Camellia oleifera fruit, which can effectively reduce the expression level of CdCRY1 gene or CdLAC15 gene in Camellia oleifera fruit, obtain the virus-induced gene silencing phenotype, and verify the function of CdCRY1 gene or CdLAC15 gene in Camellia oleifera fruit, providing technical support for the verification of gene function in Camellia oleifera fruit, which will greatly promote the functional genomics research on Camellia oleifera fruit organs, and lay a theoretical foundation for the molecular research and breeding of Camellia oleifera, which has important application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0050] The present invention will be further described below with reference to the accompanying drawings and embodiments, wherein:

[0051] Figure 1 This is a diagram for constructing the Camellia oleifera pNC-TRV2-CdCRY1 vector in Example 1 of the present invention;

[0052] Figure 2 This is a diagram for constructing the Camellia oleifera pNC-TRV2-CdLAC15 vector in Example 1 of the present invention;

[0053] Figure 3 This is an operational flow chart of infecting Gaozhou oil-tea tea fruits using four inoculation methods in Example 2 of the present invention, wherein I is a fruit stalk inoculation method, II is a peel inoculation method, III is a peel wound immersion method, and IV is a fruiting mother branch immersion method;

[0054] Figure 4 This is a diagram showing the results of fruit peel silencing of C. drupifera VIGS mediated by TRV2 in Example 2 of the present invention; wherein TRV2 represents the fruit inoculated with TRV2-TRV1, and TRV2-CdCRY1 represents the fruit inoculated with TRV2-CdCRY1-TRV1;

[0055] Figure 5 This is a diagram showing the results of fruit pulp silencing of C. drupifera VIGS mediated by TRV2 in Example 2 of the present invention; wherein TRV2 represents the fruit inoculated with TRV2-TRV1, and TRV2-CdLAC15-TRV1 represents the fruit inoculated with TRV2-CdLAC15-TRV1;

[0056] Figure 6This is a graph showing the expression results of the CdCRY1 gene in TRV2-CdCRY1 and TRV2-empty strains analyzed by real-time quantitative PCR (RT-qPCR) in Example 2 of the present invention, wherein a, b, and c indicate significant differences;

[0057] Figure 7 This is a graph showing the expression results of the CdLAC15 gene in the TRV2-CdLAC15 and TRV2-empty strains analyzed by real-time quantitative PCR (RT-qPCR) in Example 2 of the present invention, wherein a, b, c, and d indicate significant differences;

[0058] Figure 8 This is a graph showing the change in anthocyanin content in the pericarp after VIGS silencing in Example 2 of the present invention;

[0059] Fig. 9 This is a graph showing the change in proanthocyanidin content in flesh after VIGS silencing in Example 2 of the present invention;

[0060] Fig.10 drupifera VIGS gene functional expression mediated by TRV2, wherein A is a graph showing the effect of different inoculation methods on the gene silencing efficiency of CdCRY1 gene at different DAPs, and B is a graph showing the effect of different inoculation methods on the gene silencing efficiency of CdLAC15 gene at different DAPs, a, b, c, d indicate significant differences, infiltration method I is inoculation on peduncle; II is inoculation on peel; III is immersion on peel wound; IV is immersion on fruiting mother branch; fruit development stage 1 is 64dap; 2 is 95dap; 3 is 126dap; 4 is 156dap; 5 is 187dap. DETAILED DESCRIPTION

[0061] The following will be combined with the embodiments to clearly and completely describe the concept of the present invention and the technical effects produced, so as to fully understand the purpose, characteristics and effects of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative work are all within the scope of protection of the present invention.

[0062] Materials and Reagents:

[0063] The experimental samples were taken from 20-year-old oil-tea plants, which were planted in Fengji Oil-tea Base, Boluo County, Huizhou City, Guangdong Province (longitude 114°34'E, latitude 23°23'N). The base is located in the central and southern part of Lingnan, belonging to the subtropical monsoon climate zone, with sufficient sunshine and abundant rainfall. The average maximum temperature is 28.0℃, and the average minimum temperature is 20.0℃. The forest land is mainly yellow soil, with many mountains and lush vegetation, which is very suitable for the growth of Gaozhou oil-tea.

[0064] The silencing vectors include TRV1, pNC-TRV2 modified from TRV2, and its green fluorescent protein version with PNC-TRV2-GFP. The silencing vectors were all provided by Dr. Yan Pu from the Chinese Academy of Tropical Agricultural Sciences.

[0065] Example 1 Construction of Gaozhou Camellia oleifera gene VIGS silencing system

[0066] This example constructs a VIGS silencing system for gene silencing in Gaozhou Camellia oleifera fruit.

[0067] 1. Acquisition of interference fragments of CdCRY1 gene and CdLAC15 gene

[0068] Based on the CDS sequence of CdCRY1 gene or CdLAC15 gene, Camellia sinensis shuchazao V2 CDS database was selected for screening using SGN VIGS Tool (https: / / vigs.solgenomics.net / ), and suitable restriction sites of 200-300 bp were selected. Through homology family analysis, the selected region was selected to determine whether it was a specific region. Subsequently, these sequences were submitted to NCBI for comparison, and the sequences with highly consistent comparison results with the corresponding genes and less than 40% similarity with other similar genes were retained. Finally, the complete sequence of CdLAC15 gene was shown in SEQ ID NO.1, and the complete sequence of CdCR1Y1 gene was shown in SEQ ID NO.2 for constructing VIGS vector. The silencing sequence of CdLAC15 gene is shown in SEQ ID NO.3, and the silencing sequence of CdCR1Y1 gene is shown in SEQ ID NO.4.

[0069] >Complete sequence of CdLAC15 gene:

[0070]

[0071] >Complete sequence of CRY1-1 gene:

[0072]

[0073] CdLAC15 gene silencing fragment:

[0074] CGTGCCATCCCAACCGTACATGCTTGGGACCGAATGGGACCCGATTGGCTGCGAGCATGAACAACTTAAGTTGGGTGAACCCATCCCTTGATATCCTCCAAGCTTACTATTATCACATTAAGGGCGTGTTTGGGGATCGATTTCCGAACTTTCCACCATATGTGTTTAATTTTACGGCTGATTATTTTCCGATGGAGTTGGAGATACCGAAGAAAACCAGACAGGTGAAGATTTTGAAGTATAATTCAACCGTGGAGGTGGTTTTTCAAGGGACTAATTTGGTGGCTGGGATTGATCAT(SEQ ID NO.1).

[0075] CdCRY1 gene silencing fragment:

[0076] GCTGCAGGAGTGAGGGCAGGGGCAGTGGTTGCAGTGTTCATATGGGCACCTGAAGAAGAAGGCCGCTACTACCCAGGTAGGGTCTCTAGGTGGTGGCTCAAGCACAGTTTGGCTTACCTTGATTCATCTTTGAAGAGCCTTGGTACCTCTCTCATCACCAAGAGATCTACTGATACTGTCTCTACTCTCCTTGAGGTTGTCAAATCTACTGGTGCTACTCAGCTCTTCTTCAATCACCTATATGATCCCTTTTCGCTCGATAGGGATCACAGGGCAAAGGAGGTTTTAACTGCTCAAGGCATAGCCGTGCGTACCT(SEQ ID NO.2).

[0077] Use Primer Premier 5.0 software to design VIGS specific primers for CdCRY1 gene and CdLAC15 gene. The specific sequences are as follows:

[0078] CdLAC15-VF:

[0079] AGTGGTCTCTGTCCAGTCCTCGTGCCATCCCAACCGTAG(SEQ ID NO.1);

[0080] CdLAC15-VR:

[0081] GGTCTCAGCAGACCACAAGATGATCAATCCCAGCCACCA (SEQ ID NO. 2);

[0082] CdCRY1-VF:

[0083] AGTGGTCTCTGTCCAGTCCTTGGCTATCCGTTGGTGGATG (SEQ ID NO. 3);

[0084] CdCRY1-VR:

[0085] GGTTCCAGCAGACCACAAGACTGCCAACCAAGAGCATC (SEQ ID NO. 4).

[0086] The PCR reaction system was as follows: cDNA 1 μL, upstream primer (CdLAC15-F or CdCRY1-VF) 2.5 μL, downstream primer (CdLAC15-R or CdCRY1-VR) 2.5 μL, RobustPCRMasterMix 25μL, make up to 50L with ddH2O.

[0087] PCR amplification program: 98°C for 4 min; cycling phase: 98°C for 10 s, 59°C for 15 s, 72°C for 20 s, 30 cycles; extension at 72°C for 5 min.

[0088] The total RNA of Camellia oleifera (extracted by Tiangen RNA kit) was used as a template to obtain the Camellia oleifera cDNA by reverse transcription, and the amplification product (interference fragment) was obtained by using the above-mentioned amplification system and amplification procedure, and the amplification product was recovered by gel recovery.

[0089] 2. Construction of recombinant viral vector

[0090] After the purity and concentration of the gel recovery product are tested to be qualified, the gel recovery product is connected to the PNC-TRV2 vector using the NC cloning kit (purchased from Hainan Nixing Biotechnology Co., Ltd.). Specifically, the PCR recovery product is first mixed with the PNC-TRV2 empty plasmid, 5 μL of Mix is ​​added, and the mixture is blown 10-20 times with a pipette to mix thoroughly. The PCR reaction is carried out at 50°C. After 50 minutes, 5 μL of the reaction product is transformed into 50 μL of Escherichia coli competent DH5α (product number: CAT#: DL10001), and then a single clone is picked for culture and positive clone sequencing. If the final sequencing result is correctly aligned, it means that the vector construction is complete, and TRV2-CdCRY1 containing the CdCRY1 gene or the CdLAC15 gene fragment is obtained (the vector map is as shown in FIG. Figure 1 As shown) or TRV2-CdLAC15 recombinant vector (vector map as shown Figure 2 shown).

[0091] 3. Preparation of Agrobacterium carrying TRV2-CdCRY1 or TRV2-CdLAC15

[0092] The constructed recombinant vector TRV2-CdCRY1 / CdLAC15 was transformed into GV3101 Agrobacterium competent cells (product number: CAT#: AC1001), cultured at 28°C for 2 days, selected a single plaque, and continued to culture in 4 mL liquid YEB medium containing 25 μg / mL kanamycin and 50 μg / mL rifampicin for 2 days. The temperature was maintained at 28°C and the rotation speed was set at 200-240 rpm.

[0093] The uniform bacterial solution obtained after 2 days of culture was transferred to 50 mL YEB medium containing 25 μL rifampicin (50 mg / mL), 25 μL kanamycin (100 mg / mL), 5 mL MES (pH5.6, 0.2 M) and 5 μL acetosyringone (0.1 M), and amplified at a ratio of 1:20. Continue to culture at 28 ° C and 200-240 rpm for 24 hours. When the OD600 value reaches 0.9-1.0, the YEB bacterial solution that has been cultured is centrifuged at 5000 rpm for 15 minutes and the supernatant is removed. The bacterial solution containing TRV1 in the control group was mixed with the Agrobacterium solution containing TRV2-empty in a volume ratio of 1:1. In the experimental group, TRV1 was mixed with the bacterial solutions containing TRV2-CdCRY1 and TRV2-CdLAC15 in a volume ratio of 1:1, respectively. The bacterial solution was then resuspended in infiltration buffer (10mM MES, 10mMMgCl2 and 200μM AS), and the OD600 value after mixing was adjusted to 0.8 and allowed to stand at room temperature for 2 to 3 hours.

[0094] Example 2: Verification of Agrobacterium-mediated silencing vector infection of Camellia oleifera fruit

[0095] 1. Agrobacterium-mediated silencing vector infects tea fruit

[0096] Two Gaozhou oil-tea camellia varieties were selected for the experiment: one is a red-skin variety (its skin is red and its flesh is white), and the other is a red-fleshed variety (its skin is green and its flesh is red). The CdCRY1 gene was used to identify the red-skin variety, and the CdLAC15 gene was used to identify the red-fleshed variety. Four inoculation methods were used (fruit stalk injection method, fruit skin direct injection method, fruit skin wound immersion method, and fruiting mother branch infusion method, the inoculation flow chart is shown in Figure 1). Figure 3 As shown); the Agrobacterium carrying TRV2-CdCRY1 / CdLAC15 constructed in Example 1 (OD600 of 0.8) was inoculated in 4 ways according to different varieties, and five different inoculation periods of 64 days, 95 days, 126 days, 156 days and 187 days, i.e. 64DAP, 95DAP, 126DAP, 156DAP and 187DAP, were tested. The control group was inoculated with an equal amount of a bacterial solution containing TRV1 mixed with TRV2-empty.

[0097] The four inoculation methods were injected into the fruits on the same tree, 10 fruits were injected for each inoculation method, and three trees of the same asexual line were selected for three biological replicates with a total of 30 fruits.

[0098] Fruit stalk injection method: Use a disposable syringe to draw 2mL of suspension, then insert the needle into the fruit stalk to a depth of about 5-8mm. After 3-5 injections, soak the fruit in the suspension for 30 seconds, and wrap it in a cowhide bag to avoid light after the injection is completed.

[0099] Peel injection method: Also use a disposable syringe to absorb 2mL of suspension, and insert the needle into the surface of the peel to a depth of about 1-2cm. Then soak the fruit in the suspension for 30 seconds, wrap it with gauze and drip it for about 5 seconds, making sure the gauze is moist, then wrap it with plastic wrap and use a cowhide bag to protect it from light.

[0100] Peel wound soaking method: Use a knife to make wounds about 1 cm long and 5 mm deep on the peel of the oil tea fruit, with about 3-5 wounds. Soak the fruit in the suspension for 30 seconds, wrap it with gauze and drip it for about 5 seconds to make the gauze fully wet, and finally wrap it with plastic wrap and use a cowhide bag to protect it from light.

[0101] Results Mother branch infusion method: 500mL of Agrobacterium suspension was transferred to the mother branch through the infusion bag. The mother branch contained more than 10 fruits. The tube puncture needle was inserted into the tree's transmissive layer about 1cm deep, 20-30cm away from the fruit (25cm in this embodiment), and infused at a rate of 100-150 (125 in this embodiment) drops per minute until the liquid was discharged.

[0102] 2. Verification of Silence Effect Results

[0103] (1) Observation of photobleaching phenotype

[0104] The peel and pulp of the infected 217-day-old tea oil fruit were observed under a laser confocal microscope, and the samples that could excite green fluorescence signals were effectively infected.

[0105] The results are as follows Figure 4 and Figure 5 As shown, it can be seen that after the CdCRY1 and CdLAC15 genes were silenced, the color of the oil-tea camellia peel and flesh faded, and more than 90% of the infected fruits showed a systemic photobleaching phenotype, while the phenotype of the negative control plants (inoculated empty vector) had no obvious change from the phenotype of normally developing fruits, which preliminarily indicated that the VIGS vector was successfully constructed.

[0106] (2) Gene expression analysis

[0107] qRT-PCR was performed on samples from each group (tea peel and pulp samples) collected 217 days after infection. Total RNA from each group of tea fruits was extracted (using Tiangen RNA extraction kit) and reverse transcribed into cDNA using a reverse transcription kit. Real-time fluorescence quantitative PCR (RT-qPCR) was performed using SYBR Green Premix ProTaqPCR reagent and CFX96 fluorescence quantitative PCR instrument using qRT-PCR primers specifically expressed in the silencing region (as shown in SEQ ID NO.9-12), CdNC2 as the internal reference gene, and the cDNA obtained by reverse transcription as a template.

[0108] The amplification system is 20 μL, including TB Premix Ex Taq TM II (Tli RNaseH Plus) (2×) 10 μL, upstream and downstream primers 0.4 μL each, template cDNA 1 μL, and double distilled water (ddH2O) 8.2 μL.

[0109] The amplification program was set as follows: initial denaturation at 95°C for 30 seconds; entering the cycling phase: 95°C for 5 seconds, 60°C for 30 seconds, and 30 cycles.

[0110] Each sample was tested three times. -△△CtThe effective silencing efficiency of TRV2-CdCRY1 / CdLAC15 injected fruits was calculated by the R software, and data analysis and graphics were performed.

[0111] qRT-PCR primers are as follows:

[0112] CdLAC15-QF: GCGTGTTTGGGGATCGATTT (SEQ ID NO. 9);

[0113] CdLAC15-QR: ATGATCAATCCCAGCCACCA (SEQ ID NO. 10);

[0114] CdCRY1-QF:CGTTGCATTCCCTCCTGACA (SEQ ID NO. 11);

[0115] CdCRY1-QF: TTCGTTGGCACTTCAGCTCT (SEQ ID NO. 5).

[0116] The primers for internal reference gene detection are as follows:

[0117] CdNC2-F: AGCTAAGTTCGCCGATGAGA (SEQ ID NO.7);

[0118] CdNC2-R:CGATCGCCTTCACAACATCC (SEQ ID NO. 8).

[0119] The CdCRY1 gene expression results of TRV2-CdCRY1 and TRV2-empty strains are shown in Figure 6 As shown in the figure, it can be seen that the expression level of CdCRY1 gene was significantly reduced in the oil-tea tea fruit successfully transfected with TRV2-CdCRY1.

[0120] The expression results of CdLAC15 gene in TRV2-CdLAC15 and TRV2-empty strains are shown in Figure 7 As shown in the figure, it can be seen that the expression level of CdLAC15 gene was significantly reduced in the oil-tea tea fruit that was successfully transfected with TRV2-CdLAC15.

[0121] (3) Changes in anthocyanin content in fruit peel after gene silencing

[0122] Detection method: The control group samples of Camellia oleifera fruit peel samples 217 days after TRV2-CdCRY1 infection were ground into fine powder in liquid nitrogen, with an amount of 0.1 g. Then, the powder samples were completely suspended in a 15.0 mL polypropylene tube containing 5 mL of 80% methanol and 0.2% hydrochloric acid (HCl), and vortexed for 30 seconds. After that, the mixture was ultrasonically treated for 15 minutes in a low temperature environment of 10°C. After treatment, the sample was allowed to stand for 24 hours in a dark environment, and then centrifuged at a centrifugal force of 5000 rpm for 10 minutes. Finally, the supernatant was transferred to a new test tube. The content of anthocyanins in the peel can be evaluated by measuring the absorbance of the extract at a wavelength of 530 nanometers.

[0123] Test results such as Figure 8 As shown in the figure, it can be seen that after silencing the CdCRY1 gene, the content of anthocyanins in the peel was significantly reduced.

[0124] (4) Changes in proanthocyanidin content in fruits after gene silencing

[0125] Detection method: The pulp samples of Camellia oleifera fruits 217 days after TRV2-CdLAC15 infection and the control group samples were ground into fine powder in liquid nitrogen, with an amount of 0.1 g. Then, these powder samples were completely suspended in a 15.0 mL polypropylene tube containing 5 mL of 80% methanol and 0.2% hydrochloric acid (HCl), and vortex mixed for 30 seconds. After that, the mixture was ultrasonically treated for 15 minutes in a low temperature environment of 10°C to obtain an 80% methanol extract. Take 0.3 mL of the 80% methanol extract, mix it with 1 mL of DMACA (0.2% w / v), let it stand for 1 minute, and measure the absorbance of the mixture at a wavelength of 640 nm. The absorbance value is used to quantitatively analyze the content of total soluble proanthocyanidins in the sample.

[0126] Test results such as Fig. 9 As shown in the figure, it can be seen that after silencing the CdLAC15 gene, the content of anthocyanins in the fruit was significantly reduced.

[0127] (5) Vaccination rate statistics

[0128] The inoculation rates of tea oil fruits infected by the four methods were counted on day 25. The results are shown in Tables 1 and Fig.10 As shown, among them, the infiltration method I is inoculation of inflorescence peduncle; II is inoculation of pericarp; III is immersion of pericarp wound; IV is immersion of fruiting mother branch; fruit development stage 1 is 64dap; 2 is 95dap; 3 is 126dap; 4 is 156dap; 5 is 187dap.

[0129] Table 1 Experimental results of four infection methods

[0130]

[0131]

[0132]

[0133] As can be seen from the chart, the observation and quantitative statistics of the fruit stalk injection method in red fruit peel inoculation rate reached 20.00%, while the red fruit flesh inoculation rate was only 10.67%. The fruit peel injection method inoculation rate reached 43.33% in red fruit peel, while the red fruit flesh inoculation rate was only 39.33%. The fruit peel wound immersion method inoculation rate reached 48.67% in red fruit peel, while the red fruit flesh inoculation rate was only 50.00%. The result mother branch inoculation method was the worst, with only 1.67% and 1.77% respectively. These results show that the fruit peel wound immersion method is the most effective experimental condition. The second is the injection method. The worst is the fruit mother branch infusion method.

[0134] The fruit stalk injection method was used during the development period of the red fruit peel from 64DAP to 187DAP. The best effect was achieved at 186DAP, with an effective inoculation rate of 60.00% and an effective silencing rate of 43.33%. The effective inoculation rate was 6.67% at 64DAD, and the effective silencing rate was 6.67%, which was the worst effect. The fruit peel injection method was used at 156DAP, with an effective inoculation rate of 86.67% and an effective silencing rate of 83.33%. The worst effect was achieved at 64DAD, with all the seeds dying. The fruit peel wound immersion method was used at 156DAP, with an effective inoculation rate of 93.33% and an effective silencing rate of 90.00%. The effective inoculation rate was 6.67% at 64DAD, and the effective silencing rate was 6.67%, which was the worst effect. The effective silencing rate of the fruit mother branch injection method was only 3.33% at 126DAP and 187DAP, and the effective silencing rate was 0 at other periods.

[0135] For red meat varieties, the fruit stalk injection method had the best effect at 156DAP during the development period of 64DAP-187DAP, with an effective inoculation rate of 36.67% and an effective silencing rate of 26.67%. The worst effect was at 64DAP, with all fruits falling off; the peel injection method had the best effect at 187DAP, with an effective inoculation rate of 80.00% and an effective silencing rate of 76.67%. At 64DAP, the effective inoculation rate and effective silencing rate were 3.33%; the peel wound immersion method had the best effect at 187DAP, with an effective inoculation rate of 96.67% and an effective silencing rate of 93.33%. At 64DAP, the effective inoculation rate was 16.67%, and the effective silencing rate was 10.00%, which was the worst effect; the effective silencing rate of the fruit mother branch injection method reached 3.33% only at 126DAP and 156DAP, and the effective silencing rate was 0 at other periods.

[0136] The results showed that the most effective experimental conditions for fruit inoculation were at 156 DAP and 187 DAP during the fruit development period.

[0137] The embodiments of the present invention are described in detail above in conjunction with the accompanying drawings, but the present invention is not limited to the above embodiments. Various changes can be made within the knowledge of ordinary technicians in the relevant technical field without departing from the purpose of the present invention. In addition, the embodiments of the present invention and the features in the embodiments can be combined with each other without conflict.

Claims

1. A method for silencing Camellia oleifera fruit genes based on VIGS, characterized in that: The method comprises the following steps: infecting camellia oleifera fruit with a VIGS vector, and obtaining gene-silenced camellia oleifera fruit after culturing; the VIGS vector is composed of a TRV2-specific fragment vector and a TRV1 vector.

2. The method according to claim 1, characterized in that The TRV2-specific fragment vector is a recombinant vector containing a specific fragment of a target gene and a gene encoding a tobacco rattle virus coat protein; Preferably, the target gene includes a pigment synthesis gene; More preferably, the pigment synthesis gene includes one of the CdCRY1 gene and the CdLAC15 gene.

3. The method according to claim 1, characterized in that The TRV1 vector is a vector containing an RNA-dependent RNA polymerase; And / or, the oil-tea camellia fruit is a oil-tea camellia fruit that has grown to the 64th to 187th day from the fertilization development period; And / or, the infection comprises the following steps: introducing the TRV2-specific fragment vector into Agrobacterium tumefaciens to obtain recombinant Agrobacterium tumefaciens 2, and introducing the TRV1 vector into Agrobacterium tumefaciens to obtain recombinant Agrobacterium tumefaciens 1; mixing the recombinant Agrobacterium tumefaciens 2 and the recombinant Agrobacterium tumefaciens 1 to prepare an infection solution; and transferring the infection solution into Camellia oleifera fruit; Preferably, the added volume ratio of the recombinant Agrobacterium tumefaciens 2 and the recombinant Agrobacterium tumefaciens 1 is (1-2):(1-3); Preferably, the OD600 value of the recombinant Agrobacterium tumefaciens in the infection solution is 0.6 to 1.0; Preferably, the transfer method includes one of the following methods: fruit stalk injection method, fruit peel direct injection method, fruit peel wound immersion method and fruiting mother branch infusion method.

4. Application of the method according to any one of claims 1 to 3 in any one of the following: (1) Silencing genes in Camellia oleifera fruit; (2) Verification of gene function in Camellia oleifera fruit.

5. A target sequence for silencing CdLAC15 gene or CdCRY1 gene, characterized in that: The target sequence for silencing the CdLAC15 gene is shown as SEQ ID NO.3; the target sequence for silencing the CdCRY1 gene is shown as SEQ ID NO.

4.

6. A VIGS viral vector system for silencing CdLAC15 gene or CdCRY1 gene, characterized in that: The VIGS vector system contains the target sequence as claimed in claim 5.

7. An engineered bacterium for silencing CdLAC15 gene or CdCRY1 gene, characterized in that: The engineered bacteria contains the vector system as claimed in claim 6.

8. The engineered bacteria according to claim 7, characterized in that The engineered bacteria include Agrobacterium tumefaciens.

9. An infection solution for silencing CdLAC15 gene or CdCRY1 gene, characterized in that: The infection solution contains the engineered bacteria as described in claim 7 or 8.

10. Use of the target sequence of claim 5, the VIGS virus vector system of claim 6, the engineered bacteria of claim 7 or 8, or the infection solution of claim 9 in any of the following: 1) Silencing the CdLAC15 gene or CdCRY1 gene; 2) Application in the preparation of products for silencing CdLAC15 gene or CdCRY1 gene.

Images