Wheat salicylic acid receptor NPR3 gene and application thereof in wheat disease resistance

Abstract

The invention discloses a wheat salicylic acid receptor NPR3 gene and application thereof in wheat disease resistance, and belongs to the technical field of plant genetic engineering. The invention discloses application of a wheat salicylic acid receptor NPR3 gene or related biological materials thereof. The application is any one of the following applications: A1, improving the resistance of wheat to stripe rust; a2, the resistance of wheat to powdery mildew is improved; a3, the resistance of wheat to leaf rust is improved; the nucleotide sequence of the wheat salicylic acid receptor NPR3 gene is as shown in SEQ ID NO. 3. Results of the invention show that the NPR3 gene knockout strain has resistance to different stripe rust physiological races CYR17, CYR32, CYR33 and CYR34, and further resistance identification shows that the NPR3 gene knockout strain has resistance to powdery mildew and leaf rust. The invention provides theoretical guidance and genetic gene resources for wheat breeding for disease resistance.

Description

Technical Field

[0001] The invention relates to the technical field of plant genetic engineering, and in particular to a wheat salicylic acid receptor NPR3 gene and application thereof in wheat disease resistance. Background Art

[0002] Wheat is one of the most important food crops in the world and my country. Its global planting area is second only to corn and rice, and it provides food for about 35% of the world's population. Ensuring the safe and efficient production of wheat is crucial to ensuring global food and nutrition security. However, during the growth of wheat, there are several serious fungal diseases that continuously and frequently harm the yield and quality of wheat, posing serious challenges to the safe production of wheat. These include stripe rust caused by Puccinia striata, leaf rust caused by Puccinia recondita, and powdery mildew caused by Puccinia graminis. Planting resistant wheat varieties is a very effective, economical and environmentally friendly measure to prevent and control diseases.

[0003] The proteins encoded by susceptible genes help pathogens identify, invade, reproduce and spread in host cells. They have a negative regulatory effect in plant immunity and are mainly divided into two categories: one is the positive regulatory factors of pathogen infection. This type of gene can be hijacked by the effector factors of pathogens to inhibit immune response or promote pathogen infection; the other is the negative regulatory factors in plant immune response. Editing or knocking out susceptible genes can enhance the potential of plants to resist broad-spectrum diseases. Therefore, susceptible genes are considered to replace disease-resistant genes for plant disease-resistant breeding. At present, the typical susceptible gene is the MLO gene, which is very conservative in higher plants. Mutated MLO genes can confer broad-spectrum resistance to powdery mildew in plants such as wheat, barley and tomatoes. A recent major discovery showed that inactivating the cytoplasmic receptor kinase gene TaPsIPK1 can make wheat resistant to multiple stripe rust species without affecting important agronomic traits. This gene is the first disease-susceptibility gene identified to be hijacked by pathogen effector targets. The stripe rust toxic protein PsSpg1 binds to TaPsIPK1, enhancing its phosphorylation kinase activity and its nuclear localization. TaPsIPK1 binds to and phosphorylates TaCBF1d in the nucleus, mediating wheat's susceptibility to stripe rust. Obtaining more genes that can enhance plant resistance to pathogens is of great significance for wheat disease resistance breeding. Summary of the invention

[0004] The purpose of the present invention is to provide a wheat salicylic acid receptor NPR3 gene and its application in wheat disease resistance to solve the problems existing in the above-mentioned prior art. The salicylic acid receptor NPR3 gene can be used for wheat broad-spectrum resistance breeding.

[0005] To achieve the above object, the present invention provides the following solutions:

[0006] Technical solution 1: The application of wheat salicylic acid receptor NPR3 gene or its related biological materials is any of the following applications:

[0007] A1. Improve wheat's resistance to stripe rust;

[0008] A2. Improve wheat's resistance to powdery mildew;

[0009] A3. Improve wheat's resistance to leaf rust;

[0010] The nucleotide sequence of the wheat salicylic acid receptor NPR3 gene is shown in SEQ ID NO.3.

[0011] Furthermore, the related biological material is a transgenic material including the protein encoded by the wheat salicylic acid receptor NPR3 gene and the wheat salicylic acid receptor NPR3 gene.

[0012] Furthermore, the amino acid sequence of the protein encoded by the wheat salicylic acid receptor NPR3 gene is shown in SEQ ID NO.4.

[0013] Furthermore, the recombinant vector comprises the wheat salicylic acid receptor NPR3 gene with the sequence shown in SEQ ID NO.3.

[0014] Furthermore, the recombinant microorganism comprises the wheat salicylic acid receptor NPR3 gene with the sequence shown in SEQ ID NO.3.

[0015] Technical solution 2: A knockout material for editing the wheat salicylic acid receptor NPR3 gene, the nucleotide sequence of the wheat salicylic acid receptor NPR3 gene is shown in SEQ ID NO.3.

[0016] Technical solution three: Application of the knockout material in improving wheat resistance to stripe rust, powdery mildew and leaf rust.

[0017] Technical solution 4: A method for improving wheat resistance to stripe rust, powdery mildew and leaf rust, comprising the step of blocking or inhibiting the expression of the NPR3 gene, wherein the nucleotide sequence of the wheat salicylic acid receptor NPR3 gene is shown in SEQ ID NO.3.

[0018] Technical Solution 5: A method for cultivating wheat strains resistant to stripe rust, powdery mildew and leaf rust, comprising the step of knocking out the wheat salicylic acid receptor NPR3 gene to cultivate wheat strains resistant to stripe rust, powdery mildew and leaf rust, wherein the nucleotide sequence of the wheat salicylic acid receptor NPR3 gene is shown in SEQ ID NO.3.

[0019] The present invention discloses the following technical effects:

[0020] The present invention clones homologous genes of the NPR3 gene in the Urartu wheat material and the common wheat material, respectively. The virus-induced gene silencing technology preliminarily verifies that the NPR3 gene negatively regulates wheat resistance to stripe rust. Gene editing is further used to knock out the NPR3 gene in the common hexaploid wheat Fielder to verify its negative regulation of wheat resistance to stripe rust. The stripe rust resistance identification results show that the NPR3 gene knockout strain is resistant to different stripe rust physiological races CYR17, CYR32, CYR33 and CYR34. Further resistance identification shows that the NPR3 gene knockout strain is resistant to both powdery mildew and leaf rust. The present invention provides theoretical guidance and genetic gene resources for wheat disease resistance breeding by knocking out a susceptible gene NPR3 to give wheat broad-spectrum resistance to pathogens. The salicylic acid receptor NPR3 gene disclosed in the present invention can be used for wheat broad-spectrum resistance breeding, which has important application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0022] Figure 1 The results showed that silencing TuNPR3 by barley mosaic virus in the Urartu wheat material G1812 could enhance the resistance of the material to stripe rust CYR34, where A: relative expression of TuNPR3 gene in BSMV:GFP and BSMV:TuNPR3 plants; B: silencing TuNPR3 enhanced the resistance of the susceptible material G1812 to stripe rust CYR34; C: the biomass of stripe rust in the infected leaves of BSMV:TuNPR3 plants was significantly lower than that of BSMV:GFP plants;

[0023] Figure 2 The NPR3 gene was knocked out in the common wheat susceptible variety Fielder, which enhanced Fielder's resistance to stripe rust CYR34. A: Three NPR3 gene mutant sites created by gene editing; B: NPR3 protein accumulation in three NPR3 gene-edited mutants and wild-type Fielder; C: The biomass of stripe rust in the infected leaves of NPR3 gene-edited mutant plants was significantly lower than that of wild-type Fielder; D: The growth of stripe rust summer spores on the leaf surface of NPR3 gene-edited mutants and wild-type Fielder;

[0024] Figure 3Knocking out the NPR3 gene enhanced Fielder's resistance to stripe rust fungi CYR17, CYR32, and CYR33;

[0025] Figure 4 Knocking out the NPR3 gene enhanced Fielder's resistance to powdery mildew E09, where A: Observation of cell death on the leaf surface of NPR3 gene-edited mutant plants and wild-type Fielder plants inoculated with powdery mildew E09 for 48 h; B: H2O2 accumulation on the leaves of NPR3 gene-edited mutant plants and wild-type Fielder plants inoculated with powdery mildew E09 for 48 h; C: Powdery mildew growth on the leaf surface of NPR3 gene-edited mutant plants and wild-type Fielder plants;

[0026] Figure 5 Knocking out the NPR3 gene enhanced Fielder's resistance to leaf rust Pt23a. A: The phenotypes of NPR3 gene-edited mutant plants and wild-type Fielder plants 14 days after inoculation with leaf rust Pt23a. B: The leaf rust biomass in the infected leaves of NPR3 gene-edited mutant plants was significantly lower than that of wild-type Fielder. DETAILED DESCRIPTION

[0027] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0028] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0029] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0030] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0031] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0032] Example 1

[0033] Obtaining the gene sequence of salicylic acid receptor NPR3

[0034] Obtaining the TuNPR3 gene sequence in Urartu wheat: Gene-specific primers were designed based on the CDS sequence of TuG1812G0300003503 of G1812 in the Urartu wheat database, and amplified in the cDNA sample of the leaves of the Urartu wheat material G1812 to obtain the full-length sequence of TuNPR3. The specific operation process is as follows: At room temperature, the Urartu wheat material G1812 (from the Laboratory of Crop Genomics and Molecular Breeding Center, College of Agriculture, Henan Agricultural University) was planted in a seedling pot, and the leaves were taken when the seedlings grew to 10 days old, and RNA was extracted using Trizol reagent, and reverse transcribed using First-strand cDNA Synthesis Mix. Then, FP: 5'-ATGGAGCCGTCGTCGTCC-3' (SEQ ID NO.1) and RF: 5'-TCACTTCATCGCCGAGGACGAG-3' (SEQ ID NO.2) were used as primers, G1812 leaf cDNA was used as template, and KOD-FX high-fidelity enzyme was used for PCR amplification (amplification program was 94°C pre-denaturation for 5 min; 98°C denaturation for 20 s, 58°C annealing for 15 s, 68°C extension for 2 min, 35 cycles; 68°C extension for 10 min. The reaction system was 50 μL, and its components were 2 μL cDNA, 1.5 μL 10 μM primer FP, 1.5 μL 10 μM primer RF, 10 μL 2 mM dNTPs, 1 μL KOD-FX Taq (Toyobo), 25 μL 2×KOD-FXPCR Buffer and 9 μL ddH2O) to obtain the full-length CDS sequence of TuNPR3, the specific sequence is shown in SEQ ID NO.3, and the amino acid sequence encoded by it is shown in SEQ ID NO.4.

[0035] SEQ ID NO.3:

[0036]

[0037] SEQ ID NO.4:

[0038] MEPSSSITFASSSSYLSNGSSPCSGALAPLPAADGWGGGGGGGGGGSSSSVEAVSLNRLSSNLERLLLDSELDCSDADVDVADGGPPIPVHRCILAVRSSFFHDLFRARGSRSDGAVTASASATGGGAGGDVNGRPQYKMEDLVPGGRVGREAFLAFMGYLYTGRLRPAPLDVVSCADLVCPHDSCPPAIRFAVELMYAAWTFRIPELMSLFQRRLMNFVDKTLAEDVLPILQVAFHSELTQVREKCVQRIARSDLDILSLDKELPPEIADEIKKIRQKSPPIDGDTIISDPVHEKRVRRIHRALDSDDVELVKLLLNESEITLDDANALHYAAAYCDSKVLTELLGLELANLNLKNSRGYTALHLAAMRREPAIIMCLLSKGAVASQLTDDGRLASNICRRLTRLKDYNAKMEQGQESNKDRMCIDILEREMMRNPMTAEDSVTSPLLADDLHMKLSYLENRVAFARLFFPAEAKVAMQIAQADVTPEVGGFSAASTSGKLREVDLNETPVTKNKRLRSRVDALAKTVELGRRYFPNCSQVLDKFLEDGLPDGLDAFQQQSGTPDEQQVKKMRFCEVKENVRKAYSKDTADNSMFSALSSNSSSSAMK*。

[0039] The present invention further transfers the NPR3 gene into the common susceptible wheat Fielder (derived from the Crop Genomics and Molecular Breeding Center Laboratory of the College of Agriculture of Henan Agricultural University). The TaNPR3 gene sequence in the common wheat Fielder is obtained by designing gene-specific primers based on the CDS sequences of TraesFLD3A01G330300, TraesFLD3B01G384600 and TraesFLD3D01G334000 of Fielder in the wheat database, amplifying the cDNA samples of Fielder leaves, and obtaining the full-length sequence of NPR3. The specific operation process is as follows: under room temperature, Fielder is planted in a seedling pot, grown to 10-day-old seedlings, leaves are taken, RNA is extracted using Trizol reagent, and reverse transcription is performed using First-strand cDNA SynthesisMix. Then, FP: 5'-ATGGAGCCGTCGTCGTCC-3' (SEQ ID NO.5) and RF: 5'-TCACTTCATCGCCGAGGA-3' (SEQ ID NO.6) were used as primers, Fielder leaf cDNA was used as a template, and KOD-FX high-fidelity enzyme was used for PCR amplification (amplification program was 94°C pre-denaturation for 5 min; 98°C denaturation for 20 s, 58°C annealing for 15 s, 68°C extension for 2 min, 35 cycles; 68°C extension for 10 min. The reaction system was 50 μL, and its components were 2 μL cDNA, 1.5 μL 10 μM primer FP, 1.5 μL 10 μM primer RF, 10 μL 2 mM dNTPs, 1 μL KOD-FX Taq (Toyobo), 25 μL 2×KOD-FX PCRBuffer and 9 μL The full-length CDS sequence of TaNPR3 was obtained by adding ddH2O) and ligated into the pEASY-Blunter vector. The full-length sequence of TaNPR3 in the ABD subgenome of common wheat was obtained by sequencing. The specific sequences are shown in SEQ ID NO.7, SEQ ID NO.8 and SEQ ID NO.9, and the amino acid sequences encoded by them are shown in SEQ ID NO.10, SEQ ID NO.11 and SEQ ID NO.12.

[0040] SEQ ID NO.7:

[0041]

[0042] SEQ ID NO.8:

[0043]

[0044] SEQ ID NO.9:

[0045]

[0046] SEQ ID NO.10:

[0047] MEPSSSITFASSSSYLSNGSSPCSGALAPLPAADGWGGGGGGGGGGSSSSVEAVSLNRLSSNLERLLLDSELDCSDADVDVADGGPPIPVHRCILAVRSSFFHDLFRARGSRSDGAVTASASATGGGAGGDVNGRPQYKMEDLVPGGRVGREAFLAFMGYLYTGRLRPAPLDVVSCADLVCPHDSCPPAIRFAVELMYAAWTFRIPELMSLFQLQARNVRLMRRLMNFVDKTLAEDVLPILQVAFHSELTQVREKCVQRIARSDLDIMSLDKELPPEIADEIKKIRQKSPPIDGDTIISDPVHEKRVRRIHRALDSDDVELVKLLLNESEITLDDANALHYAAAYCDSKVLTELLGLELANLNLKNSRGYTALHLAAMRREPAIIMCLLSKGAVASQLTDDGRLASNICRRLTRLKDYNAKMEQGQESNKDRMCIDILEREMMRNPMTAEDSVTSPLLADDLHMKLSYLENRVAFARLFFPAEAKVAMQIAQADVTPEVGGFSAASTSGKLREVDLNETPVTKNKRLRSRVDALAKTVELGRRYFPNCSQVLDKFLEDGLPDGLDAFQQQSGTPDEQQVKKMRFCEVKEDVRKAYSKDTADNSMFSALSSNSSSSAMK;

[0048] SEQ ID NO.11:

[0049] ;

[0050] SEQ ID NO.12:

[0051] *.

[0052] Example 2 Functional verification of salicylic acid receptor NPR3 gene in wheat stripe rust resistance

[0053] The function of the NPR3 gene was verified by VIGS experiment. First, a 135bp sequence (SEQ ID NO.15) was reversely constructed into the barley mosaic virus RNAγ chain using primers NPR3-VIGS (SEQ ID NO.13 and SEQ ID NO.14) to form the recombinant plasmid BSMV:NPR3, and then the NPR3 fragment was introduced into wheat leaves through barley stripe mosaic virus.

[0054] SEQ ID NO.13:

[0055] GATTCTTCTTCCGTTGCTAGCCCTTCCTAGCGTTCATGGGGTACCT;

[0056] SEQ ID NO.14:

[0057] TTTTTTTTTTTTAGCTAGCACATGAGCTCGACGGCGAACCTGAT;

[0058] SEQ ID NO.15:

[0059] CCTTCCTAGCGTTCATGGGGTACCTCTACACGGGCAGGCTCCGGCCGGCGCCGCTG GACGTGGTGTCATGTGCTGATCTTGTGTGCCCGCACGACTCGTGCCCGCCGGCTATCAG GTTCGCCGTCGAGCTCATGT.

[0060] When wheat had one leaf and one heart, the recombinant virus vector BSMV:NPR3 and the control virus vector BSMV:GFP were inoculated on the second leaf of 15 G1812 plants. On the 14th day after the virus inoculation, the fourth leaf was taken to extract RNA and detect the silencing efficiency of the NPR3 gene. The successfully silenced plants were inoculated with stripe rust fungus CYR34 (from the Laboratory of Crop Genomics and Molecular Breeding Center, College of Agriculture, Henan Agricultural University). The disease resistance phenotype was observed 14 days after inoculation, and the fungal biomass was determined. The specific method for determining the fungal biomass was to take the infected leaves 14 days after inoculation, extract DNA, and perform qRT-PCR (amplification primers: TaEF1a FP: 5'-TGGTGTCATCAAGCCTGGTATGGT-3' (SEQ ID NO.16), RP1: ACTCATGGTGCATCTCAACGGACT (SEQ ID NO.17); PsEF1 FP: 5'-TTCGCCGTCCGTGATATGAGACAA-3' (SEQ ID NO.18), RP2: 5'-ATGCGTATCATGGTGGTGGAGTGA-3' (SEQ ID NO.19). Amplification procedure: 95°C pre-denaturation for 30s; 95°C denaturation for 10s, 60°C annealing for 20s, 72°C extension for 20s, and 40 cycles. The reaction system was 10 μL, and its components were 1 μL genomic DNA, 10 μM primer TaEF1a FP, PsEF1 FP, RP1 and RP2 0.2 μL each, 5 μL Taq SYBR · @ Green qPCR premix (Lambolide) and 3.6 μL ddH2O), the stripe rust biomass was calculated based on the relative values ​​of stripe rust elongation factor (PsEF1) and wheat elongation factor (TaEF1a). The results showed that transient silencing of the NPR3 gene in G1812 enhanced the resistance of G1812 to stripe rust CYR34 ( Figure 1 ).

[0061] The present invention simultaneously knocks out three TaNPR3 homologous genes in Fielder wheat by gene editing technology. First, sgRNA is designed according to the full-length CDS sequence of TaNPR3, and primers SEQ ID NO.20 and SEQ ID NO.21 are synthesized and connected to the gene editing vector PLH3.

[0062] SEQ ID NO.20:

[0063] AGCACTCGTCCCAGGTGGCCGTGT;

[0064] SEQ ID NO.21:

[0065] AAACACACGGCCACCTGGGACGAG.

[0066] The pLH3 vector containing the sgRNA of the TaNPR3 gene was introduced into common wheat Fielder by Agrobacterium-mediated method, and transgenic plants with three TaNPR3 genes edited simultaneously were obtained. The editing sites of the TaNPR3 gene in the transgenic plants were verified by PCR sequencing. Three stable homozygous positive editing lines tanpr3 fld -a1b1d1-1,tanpr3 fld -a1b1d1-2 and tanpr3 fld -a1b1d1-3 and the control Fielder were planted in a greenhouse with 16h light and 8h dark, cultured at 22℃ for 10 days, and inoculated with stripe rust CYR34. After 14 days, the disease resistance phenotype and stripe rust biomass were observed. The results showed that knocking out the TaNPR3 gene enhanced Fielder's resistance to stripe rust CYR34 ( Figure 2 ).

[0067] To verify the function of salicylic acid receptor NPR3 gene in wheat resistance to multiple physiological races of stripe rust, the homozygous positive edited line tanpr3 was transformed into fld -a1b1d1-1,tanpr3 fld -a1b1d1-2 and control Fielder were planted in a greenhouse with 16h light and 8h dark, cultured at 22℃ for 10 days, and inoculated with stripe rust CYR17 (from the Stripe Rust Inoculation Room of the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences), CYR32 (from the Stripe Rust Inoculation Room of the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences) and CYR33 (from the Stripe Rust Inoculation Room of the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences). The disease resistance phenotype was observed after 14 days. The results showed that knocking out the TaNPR3 gene enhanced Fielder's resistance to stripe rust CYR17, CYR32 and CYR33 ( Figure 3 ).

[0068] Example 3 Role of salicylic acid receptor NPR3 gene in broad-spectrum disease resistance in wheat

[0069] In order to verify the role of the salicylic acid receptor NPR3 gene in the broad-spectrum disease resistance of wheat, the TaNPR3 edited strain was inoculated with powdery mildew E09 (from the Laboratory of Crop Genomics and Molecular Breeding Center, College of Agriculture, Henan Agricultural University) and leaf rust Pt23a (from Zheng Wenming Laboratory, College of Life Sciences, Henan Agricultural University) for disease resistance phenotype identification.

[0070] To verify the role of the salicylic acid receptor NPR3 gene in wheat resistance to powdery mildew, the homozygous positive edited line tanpr3 fld -a1b1d1-1,tanpr3 fld -a1b1d1-2,tanpr3 fld -a1b1d1-3 and the control Fielder were planted in a greenhouse with 16h light and 8h dark, cultured at 22℃ for 10 days, inoculated with powdery mildew E09, and samples were taken 48 hours after inoculation. The mycelial growth and development were observed using Coomassie brilliant blue staining, cell death was observed using trypan blue staining, and hydrogen peroxide accumulation was observed using DAB staining. The results showed that compared with the wild-type Fielder, the edited strain tanpr3 fld -a1b1d1-1,tanpr3 fld -a1b1d1-2,tanpr3 fld -a1b1d1-3 had slower mycelial growth in the infected leaves, showed more cell death and more hydrogen peroxide accumulation. Phenotypic observations were conducted 7 days after inoculation, and the results showed that the TaNPR3 gene knockout strain had fewer spores on the leaf surface and was more resistant to disease ( Figure 4 ).

[0071] To verify the role of the salicylic acid receptor NPR3 gene in wheat resistance to leaf rust, the homozygous positive editing line tanpr3 fld -a1b1d1-1,tanpr3 fld -a1b1d1-2,tanpr3 fld -a1b1d1-3 and the control Fielder were planted in a greenhouse with 16h light and 8h dark, cultured at 22℃ for 10 days, inoculated with leaf rust Pt23a, and the leaf rust biomass and phenotypic observation were performed 14 days later. The results showed that knocking out the TaNPR3 gene enhanced the resistance of Fielder to leaf rust Pt23a ( Figure 5 ).

[0072] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. Application of wheat salicylic acid receptor NPR3 gene or its related biological materials, characterized in that: An application that is any of the following: A1. Improve wheat's resistance to stripe rust; A2. Improve wheat's resistance to powdery mildew; A3. Improve wheat's resistance to leaf rust; The nucleotide sequence of the wheat salicylic acid receptor NPR3 gene is shown in SEQ ID NO.

3.

2. The use according to claim 1, characterized in that: The related biological materials include the protein encoded by the wheat salicylic acid receptor NPR3 gene and the transgenic material containing the wheat salicylic acid receptor NPR3 gene.

3. The use according to claim 2, characterized in that: The amino acid sequence of the protein encoded by the wheat salicylic acid receptor NPR3 gene is shown in SEQ ID NO.

4.

4. A knockout material for editing the wheat salicylic acid receptor NPR3 gene, characterized in that: The nucleotide sequence of the wheat salicylic acid receptor NPR3 gene is shown in SEQ ID NO.

3.

5. Use of the knockout material according to claim 4 in improving the resistance of wheat to stripe rust, powdery mildew and leaf rust.

6. A method for improving wheat resistance to stripe rust, powdery mildew and leaf rust, characterized in that: The method comprises the step of blocking or inhibiting the expression of NPR3 gene in wheat, wherein the nucleotide sequence of the wheat salicylic acid receptor NPR3 gene is shown as SEQ ID NO.

3.

7. A method for breeding wheat strains resistant to stripe rust, powdery mildew and leaf rust, characterized in that: The method comprises the step of knocking out the wheat salicylic acid receptor NPR3 gene to cultivate wheat strains resistant to stripe rust, powdery mildew and leaf rust, wherein the nucleotide sequence of the wheat salicylic acid receptor NPR3 gene is shown in SEQ ID NO.3.

Images