Wheat stripe rust resistance regulation gene TaWAK2 as well as encoding protein and application thereof

Abstract

The invention discloses a wheat stripe rust resistance regulation gene TaWAK2 as well as an encoding protein and application thereof, and belongs to the technical field of molecular biology. The wheat stripe rust resistance regulation gene TaWAK2 disclosed by the invention is as shown in a sequence table SEQ ID NO: 1, and the length of the wheat stripe rust resistance regulation gene TaWAK2 is 7042bp; the amino acid sequence of the protein coded by the gene is shown as SEQ ID NO: 4 in a sequence table, and the length of the amino acid sequence is 693. Through a VIGS silencing technology and gene sequencing analysis, it is proved that the gene TaWAK2 plays an important role in wheat stripe rust resistance regulation and control, and the wheat stripe rust resistance is negatively regulated and controlled. The gene TaWAK2 disclosed by the invention can be applied to wheat stripe rust resistance breeding; research on the gene is beneficial to revealing a molecular genetic basis of wheat stripe rust resistance, and an important gene target is provided for wheat breeding for disease resistance.

Description

Technical Field

[0001] The invention relates to the field of molecular biotechnology, and in particular to a wheat stripe rust resistance regulatory gene TaWAK2 and a coded protein and application thereof. Background Art

[0002] Wheat cultivation has a long history. Today, more than 35% of the world's population relies on wheat as their staple food. As one of the world's three major food crops, wheat provides 20% of the world's population with protein and energy. Therefore, increasing wheat production is of great significance to stabilizing global food security (Li Chao, Limiting factors and regulatory measures for increasing yield, quality and efficiency of dryland wheat in the Loess Plateau. Doctoral dissertation, Yangling, Shaanxi, 2023). However, in recent years, severe spring temperature fluctuations, warm winters, and the promotion of simplified farming techniques, coupled with the low disease resistance of winter wheat varieties in most wheat-growing areas across the country, have led to increasingly serious wheat disease problems. Wheat stripe rust caused by Puccinia striiformis f.sp.tritici (Pst) is one of the world's major wheat epidemic pests, which has a devastating impact on wheat production. In epidemic years, it can lead to a wheat yield reduction of more than 40%, or even a total crop failure (Chen Wanquan, Kang Zhensheng, Ma Zhanhong, et al. Theory and practice of comprehensive control of wheat stripe rust in China. Chinese Agricultural Science, 4254-4262, 2013; Gao Xinpei, Zhao Yun, Liu Bofan, et al. Genetic analysis of wheat stripe rust populations in major winter breeding areas based on toxic phenotypes and genotypes. Chinese Agricultural Science, 2629-2642, 2023). Although the promotion of the national one-spray three-prevention technology in recent years has effectively reduced the yield losses caused by the stripe rust pandemic, for example, the two stripe rust pandemics in 2017 and 2020 caused an actual reduction in wheat production of 428 million kg and 249 million kg, respectively (Liu Wancai, Wang Baotong, Zhao Zhonghua, et al., Historical Review and Countermeasures of Past Pandemics of Wheat Stripe Rust in my country. China Plant Protection Guide, 42(6):21-27+41, 2022). However, the cost of using chemical agents is too high and there are potential environmental risks. In the long run, cultivating high-yield and disease-resistant wheat varieties is the most economical and environmentally friendly solution to ensure the national food strategic security. Therefore, continuously exploring new stripe rust regulatory genes and in-depth research on the molecular mechanism of gene regulation of stripe rust are of great scientific significance for crop breeding and improvement.

[0003] Wheat stripe rust resistance genes are divided into seedling resistance (SR) genes and adult-plant resistance (APR) genes. SR genes can be expressed throughout the growth stage of wheat and are usually species-specific (Chen Yuyu, Zhang Pingping, Zhang Baolong, et al. Development of linkage markers for wheat stripe rust resistance gene Yr52 based on BSE-seq sequencing. Plant Protection, 1-10, 2024). As of 2024, there are 87 officially named stripe rust resistance genes internationally, namely Yr1-Yr87, but most genes belong to SR genes (58), and resistance is often not persistent (Sharma D, Avni R, Gonzalez GJ, et al. A single NLR gene confers resistance to leaf and stripe rust in wheat. Nature communications, 2024, 15(1): 9925.).In the past 50 years, due to the continuous emergence and spread of new virulent subspecies of wheat stripe rust, several stripe rust epidemics have occurred in my country. For example, the emergence of CYR17 and CYR18 in 1975 caused the loss of resistance of Ab and its derivatives, the prevalence of CYR29 in 1985 caused the loss of resistance of Yr9 in the lo class antigen, the emergence of CYR32 in 1991 caused the loss of resistance of Yr3 and Yr4 genes in Fan 6 and its derivatives, and the emergence and prevalence of CYR34 in 2008 led to the loss of resistance in recent years. The Yr24 / Yr26 / YrCH42 genes in the 92R line, Guinong line and Sichuan wheat line, which are widely used in breeding, have lost resistance (Hu Xiaoping, Wang Baotong, Kang Zhensheng. Research progress on virulence variation of wheat stripe rust in China. Journal of Wheat Crops, 34(05):709-716, 2014; Yao Qiang, Wang Jierong, Meng Yan, et al. Toxicity and genotypic diversity of CYR32 and CYR33 of wheat stripe rust in China. Acta Phytophylacica Sinica. 46-52, 2018; Wan et al., Wheat stripe rust resistance and virulence of Puccinia striiformis f.sp tritici in China in 2002. Plant Diease, 896-904, 2004; Wang et al., Stripe rust resistance to a burgeoning Puccinia striiformis f.sp.tritici race CYR34 in current Chinese wheat cultivars for breeding and research. EUPHHYTICA, 215, 2019), posing a serious threat to national food security. Therefore, it is of great significance to continuously explore new wheat stripe rust resistance regulatory genes and broaden and enrich the wheat stripe rust gene resource library for wheat stripe rust resistance breeding.

[0004] With the rapid development of genome sequencing technology, a variety of wheat SNP chips have been widely used in the mining of genetic loci related to wheat yield and disease resistance (Sun et al., The Wheat 660K SNP array demonstrates great potential for marker-assisted selection in polyploid wheat. Plant Biontechnology Journal. 1354-1360, 2020; Ma et al., Identification of major QTLs for yield-related traits with improved genetic map in wheat. FRONTIERS IN PLANTSCIENCE, 2023; Liu et al., A 55K SNP array-based genetic map and its utilization in QTL mapping for productive tiller number in common wheat. THE ORETICALAND APPLIED GENETICS, 2439-2450, 2018), significantly improving the speed of fine positioning and cloning of wheat disease resistance genes. The applicant previously conducted genome-wide association analysis and linkage analysis using a wheat association population and a RIL population, and discovered a new wheat stripe rust resistance QTL locus QYr.hau-3BS on chromosome 3BS of Zhou 8425B, which is between molecular markers M328 and M311. On this basis, this study used the remaining heterozygous lines to construct a secondary segregation large population, further fine-positioned the QTL locus, and combined with the information of the Chinese Spring transcriptome database and bacterial-induced transcriptome analysis, discovered important candidate genes TaWAK1 and TaWAK2 that regulate stripe rust resistance, and then used virus-induced gene silencing technology to confirm that the TaWAK2 gene negatively regulates wheat stripe rust resistance, which can be used as a new gene target for wheat stripe rust resistance breeding.

[0005] In summary, discovering wheat stripe rust resistance-related genes with breeding application value and making effective use of them is the most economical, effective and environmentally friendly way to prevent and control wheat stripe rust. Therefore, discovering wheat stripe rust resistance-related genes through genetic means and then exploring their functions will provide an important theoretical basis and new gene targets for molecular breeding of wheat stripe rust. Summary of the invention

[0006] The purpose of the present invention is to provide a wheat stripe rust resistance regulatory gene TaWAK2 and its encoding protein and application, so as to solve the problems existing in the above-mentioned prior art.

[0007] To achieve the above object, the present invention provides the following solutions:

[0008] One of the technical solutions of the present invention is the use of the TaWAK2 gene or the protein encoded by it in regulating wheat stripe rust resistance, and the CDS nucleotide sequence of the TaWAK2 gene is shown in SEQ ID NO:3.

[0009] The second technical solution of the present invention is the use of a recombinant vector, an expression cassette, a transgenic cell line or a recombinant bacterium containing the TaWAK2 gene in regulating wheat stripe rust resistance.

[0010] The third technical solution of the present invention is a method for regulating wheat stripe rust resistance, silencing or knocking out the TaWAK2 gene to improve wheat resistance to stripe rust.

[0011] A fourth technical solution of the present invention is an InDel molecular marker combination associated with wheat stripe rust resistance, wherein the molecular marker combination is located on wheat chromosome 3BS and includes InDel 1 and InDel 2;

[0012] The InDel1 is a nucleotide sequence shown in SEQ ID NO.9, in which two bases at positions 8 and 9 are inserted or deleted;

[0013] The InDel2 is the nucleotide sequence shown in SEQ ID NO.9, in which 8 bases from the 124th to the 131st position of the nucleotide sequence are inserted or deleted.

[0014] A fifth technical solution of the present invention is a primer set for amplifying the InDel molecular marker combination, comprising an upstream primer as shown in SEQ ID NO:7 and a downstream primer as shown in SEQ ID NO:8.

[0015] The sixth technical solution of the present invention is a method for identifying wheat stripe rust resistance, which uses the wheat gene to be tested as a template and uses the primer set for amplification. If the size of the amplified product is 173bp, it is a disease-resistant plant, and if the size of the amplified product is 163bp, it is a disease-susceptible plant.

[0016] The seventh technical solution of the present invention is the application of the InDel molecular marker combination in the breeding of wheat stripe rust resistance related traits.

[0017] An eighth technical solution of the present invention is the use of the InDel molecular marker combination in identifying or assisting in identifying traits related to wheat stripe rust resistance.

[0018] Based on the above technical solution, the present invention has the following technical effects:

[0019] The present invention discloses a novel wheat stripe rust resistance regulating gene TaWAK2, which is located on the short arm of wheat chromosome 3B, and the protein expressed by the gene can negatively regulate wheat stripe rust resistance; using virus-induced gene silencing technology (VIGS), it is proved that silencing TaWAK2 in wheat plants significantly improves the stripe rust resistance of the plants, indicating that TaWAK2 is an important gene for regulating wheat stripe rust resistance. The TaWAK2 gene of the present invention helps to reveal the molecular genetic basis of wheat stripe rust resistance, can provide an important gene target for wheat stripe rust molecular breeding, and provide a new way for breeding new high-yield disease-resistant wheat varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0021] Figure 1 This is the fine positioning of the QTL locus QYr.hau-3BS for wheat stripe rust resistance. Among them, XHM818 represents Xinhua wheat 818; YM1 represents Yumai No. 1; R1-S5 represent 11 exchange types; n represents the number of exchanged plants of different exchange types; M328-M311 represent the names of different molecular markers; different colors of arrows at the bottom represent different annotated genes in the segment, and the length represents the length and position of different annotated genes.

[0022] Figure 2 This is a bar graph of the leaf expression levels of the differentially expressed genes induced by bacteria in the QTL fine-mapping segment. Among them, a represents the expression levels of the three candidate genes in different tissues in the segment; b represents the gene expression levels of the three candidate genes in the segment at different time points after inoculation, and 0, 24, 36, 48, and 72 represent 0 hours, 24 hours, 36 hours, 48 ​​hours, and 72 hours after inoculation, respectively.

[0023] Figure 3 The expression patterns of TaWAK1 / 2 at different time and space after CYR34 inoculation.

[0024] Figure 4The bar graphs of the relative expression of two candidate genes in the VIGS silencing experiment (the receptor material is the susceptible parent Yunong No. 1) and the photos of their resistance to wheat stripe rust. Among them, a is the seedling phenotype photo of wheat stripe rust in TaWAK1 and TaWAK12 gene-silenced plants and control plants, b is the relative expression of TaWAK1 and TaWAK12 genes in gene-silenced plants and control plants, c is the relative quantification of stripe rust hyphae in TaWAK1 and TaWAK12 gene-silenced plants and control plants, and d is the severity of wheat stripe rust in TaWAK1 and TaWAK12 gene-silenced plants and control plants.

[0025] Figure 5 This is the electrophoresis diagram of the M306 marker developed based on two InDels. M stands for DNA Marker, R lines represent disease-resistant materials, and S lines represent disease-susceptible materials. DETAILED DESCRIPTION

[0026] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0027] It should be understood that the terms described in the present invention are only for describing special embodiments and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. Each smaller range between the intermediate value in any stated value or stated range and any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0028] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0029] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present application description and examples are exemplary only.

[0030] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0031] The technical solutions described in the present invention, unless otherwise specified, are all conventional solutions in the art, and the reagents or raw materials used, unless otherwise specified, are purchased from commercial channels or have been disclosed.

[0032] The quantitative tests in the following examples were repeated three times, and the results were averaged. Primer synthesis and sequencing were completed by Sangon Biotech (Shanghai) Co., Ltd.

[0033] The embodiment of the present invention provides the use of the TaWAK2 gene or the protein encoded by the TaWAK2 gene in regulating wheat stripe rust resistance. The CDS nucleotide sequence of the TaWAK2 gene is shown in SEQ ID NO:3.

[0034] In some specific embodiments, silencing or knocking out the TaWAK2 gene improves wheat resistance to stripe rust.

[0035] The embodiments of the present invention also provide the use of a recombinant vector, an expression cassette, a transgenic cell line or a recombinant bacterium containing the TaWAK2 gene in regulating wheat stripe rust resistance.

[0036] In some specific embodiments, silencing or knocking out the TaWAK2 gene improves wheat resistance to stripe rust.

[0037] The embodiment of the present invention also provides a method for regulating wheat stripe rust resistance, silencing or knocking out the TaWAK2 gene, and improving wheat resistance to stripe rust.

[0038] The embodiment of the present invention also provides an InDel molecular marker combination related to wheat stripe rust resistance, wherein the molecular marker combination is located on wheat chromosome 3BS, including InDel 1 and InDel 2;

[0039] The InDel1 is a nucleotide sequence shown in SEQ ID NO.9, in which two bases at positions 8 and 9 are inserted or deleted;

[0040] The InDel2 is the nucleotide sequence shown in SEQ ID NO.9, in which 8 bases from the 124th to the 131st position of the nucleotide sequence are inserted or deleted.

[0041] The embodiment of the present invention also provides a primer set for amplifying the InDel molecular marker combination, including an upstream primer as shown in SEQ ID NO:7 and a downstream primer as shown in SEQ ID NO:8.

[0042] The embodiment of the present invention also provides a method for identifying wheat stripe rust resistance, using the wheat gene to be tested as a template and using the primer set for amplification. If the amplified product size is 173 bp, it is a disease-resistant plant, and if the amplified product size is 163 bp, it is a disease-susceptible plant.

[0043] The embodiment of the present invention also provides the application of the InDel molecular marker combination in the breeding of wheat stripe rust resistance related traits.

[0044] The embodiment of the present invention also provides the use of the InDel molecular marker combination in identifying or assisting in identifying wheat stripe rust resistance-related traits.

[0045] Wheat materials involved in the embodiments:

[0046] Parent materials: disease-resistant parent Xinhuamai 818, disease-susceptible parent Yumai No. 1;

[0047] Secondary segregating population: using the hybrid F of Xinhuamai 818 / Yumai No. 1 4 1021 F isolates constructed from single strains within the colony system 2 Isolate individual plants;

[0048] Receptor material: Yumai No. 1.

[0049] Example 1

[0050] Fine positioning of wheat stripe rust resistance QTLs and candidate gene mining were carried out using secondary segregation populations, as follows:

[0051] 1 Parents and group planting

[0052] 1021 F for fine positioning 2 Single plants were planted at the scientific research base of Sichuan Academy of Agricultural Sciences during the growing season of 2023-2024. A completely randomized block design was adopted, with single-row planting and 15 seeds per row. The experimental fields were sown in accordance with the standards. There was no drought and pests and diseases during the entire growing period. After maturity, the seeds were threshed, dried and stored uniformly.

[0053] Inoculation and investigation of rust in the field

[0054] When wheat was in the 3-4 leaf stage, the susceptible plant Mingxian 169, which had been inoculated with a mixed species of stripe rust in the greenhouse, was transplanted in sections at a density of 2 seedlings per meter in the field, and then inoculated with them to induce the row. It should be noted that if the climate is dry, water must be irrigated in time to ensure the successful onset of stripe rust. The mixed species of stripe rust used for inoculation were provided by the local plant protection institute and represented the local stripe rust composition, including CYR32, CYR33, CYR34, Shui4, Shui6, Hy6 and Hy7. When the stripe rust disease was most serious (i.e., the leaves of the susceptible control Mingxian 169 were almost covered with stripe rust summer spores), the test population and its parents were investigated for field diseases. The survey index is the maximum severity (MDS), that is, the percentage of the stripe rust spore area on the leaves to the total leaf area. The time for the disease investigation in this embodiment at the test site in Chengdu, Sichuan is March 31, 2024.

[0055] 3. Plant genomic DNA extraction

[0056] Plant genomic DNA was extracted using the SLS extraction method, and the specific steps are as follows:

[0057] The leaf samples retrieved from Sichuan were taken out of the minus 20℃ refrigerator, added to 2mL centrifuge tubes, and steel balls were added and placed in liquid nitrogen. After all the parts were filled, use a sampler to break them all into powder. Add 800μL of the pre-prepared SLS solution, then place it on a 37℃ shaker and shake for 10min; then add 800μL of DNA extraction reagent (three-in-one), also place it on a 37℃ shaker and shake for 10min. Then put it in a centrifuge to balance, 12000rpm, 10min. After centrifugation, draw 650μL of the supernatant into a 1.5mL centrifuge tube, add the same volume of isopropanol as the supernatant, slowly turn it upside down to mix it, and put it in a minus 20℃ refrigerator for at least 30min. After taking out the mixture from the minus 20℃ refrigerator, put it in a centrifuge at 12000rpm for 10min. Pour out the supernatant and keep the white precipitate at the bottom. Add 1 mL of 75% alcohol to the centrifuge tube and centrifuge at 12,000 rpm for 10 min. Discard the supernatant, add 1 mL of anhydrous ethanol, centrifuge at 12,000 rpm for 10 min. Discard the supernatant again and let it dry at room temperature. Then add 100 μL of ddH 2 O, measure the concentration after dissolution.

[0058] 4InDel marker development

[0059] According to the Chinese Spring V1.0 reference genome information published by IWGSC (https: / / urgi.versailles.inra.fr / blast_iwgsc / ) and the Zhou 8425B genome information (internal communication) completed by the College of Agriculture of Henan Agricultural University, the physical interval corresponding to the QYr.hau-3BS initial positioning flanking markers is 13.25-14.16Mb (Chinese Spring) or 18.60-20.33Mb (Zhou 8425B). Based on the genome sequence information of Chinese Spring and Zhou 8425B in the positioning segment, the two genome sequences were compared to find the insertion and deletion (Indel) sites with differences between the two genomes, and the sequences of 300bp upstream and downstream of the Indel site were intercepted respectively. Primers were designed using NCBI and the physical positions of the primers in Chinese Spring and Zhou 8425b were recorded. The developed primers were used to detect the parents to verify whether the primers were effective, and primers with polymorphism between the parents were selected for detection of the separation population, and the genotypes were recorded. Based on the above method, a total of 7 polymorphic markers were finally developed in the above positioning segment for QTL fine positioning, among which M306 (ie, the primer pair consisting of SEQ ID NO: 5 and SEQ ID NO: 6) was co-segregated with the stripe rust phenotype.

[0060] SEQ ID NO:5: 5'-TGCTCTAGTGGTCTGAGTGT-3';

[0061] SEQ ID NO:6: 5'-GGGGGCAGAACATGATGAAA-3'.

[0062] 5. Screening of exchange plants and mining of candidate genes

[0063] Seven InDel markers (M298-1, M298-3, M13, M344, M305, M306, and M352) spanning the initial mapping region of QYr.hau-3BS were used to detect the secondary segregating population F 2 The genotype of the individual plants was combined with the maximum severity (MDS) of stripe rust in the field to screen the exchange plants. A total of 18 exchange plants were screened, including 12 heterozygous exchanges and 6 homozygous exchanges. These exchange plants were divided into 11 exchange types ( Figure 1 ). The results of the exchange single plant screening showed that QYr.hau-3BS was further located between markers 13,963,083bp and 14,000,266bp, corresponding to a physical segment of about 37.18Kb (13.96-14.00Mb) of the Chinese Spring reference genome (http: / / 202.194.139.32 / ) ( Figure 1). According to the annotation information of the Chinese reference genome, there are three high-confidence annotated genes in this segment, which are named TaWAK1, TaWAK2, and TaE3B according to the annotation information of the Chinese Spring genome.

[0064] The expression levels of the above three genes in wheat roots, stems, leaves, ears and grains were analyzed, showing that TaWAK1 and TaWAK2 genes had higher expression levels in leaves ( Figure 2 To further identify the candidate genes, the transcriptome data induced by stripe rust were used to analyze the above three genes, and it was found that TaWAK1 and TaWAK2 strongly responded to stripe rust induction ( Figure 2 b); In addition, qRT-PCR results showed that 48 h after inoculation, the expression of TaWAK1 and TaWAK2 genes in the susceptible parent Yumai No. 1 and the susceptible pool material was induced by CYR34 and upregulated ( Figure 2 (b) Therefore, TaWAK1 and TaWAK2 are considered to be important candidate genes for wheat stripe rust resistance QTL QYr.hau-3BS.

[0065] Example 2

[0066] VIGS silencing of TaWAK1 and TaWAK2 genes and identification of their resistance to stripe rust

[0067] The susceptible parent Yumai No. 1 was selected as the receptor material, and the wheat genes TaWAK1 and TaWAK2 were silenced by VIGS technology, and the stripe rust fungus CYR34 was inoculated to verify the gene function. After VIGS silencing for 2 weeks, the relative expression of TaWAK1 and TaWAK2 genes in silenced plants (BSMVg) and virus-free plants (BSMV0) was detected by qRT-PCR technology. Figure 4 As shown in the figure, the relative expression levels of TaWAK1 and TaWAK2 genes in the receptor material plants were significantly downregulated, and the genes were effectively silenced in different receptor material plants. Further investigation of stripe rust resistance of silenced receptor material plants showed that compared with the control plants WT (control plants not inoculated with the virus) and BSMV-γ0 (plants inoculated with empty BSMV virus), the degree of stripe rust infection in TaWAK2 silenced plants was significantly reduced, while the stripe rust phenotype of TaWAK1 silenced plants did not change significantly ( Figure 4 ). In summary, TaWAK2 gene is an important negative regulatory gene in the response process of wheat stripe rust, which significantly affects the resistance to wheat stripe rust.

[0068] The specific method for constructing the VIGS vector of TaWAK1 and TaWAK2 genes is as follows:

[0069] Primers were designed according to the CDS sequence of the TaWAK1 gene, and restriction sites and protective bases were added to the 5' ends of the forward and reverse primers, respectively, to form an upstream primer shown in SEQ ID NO.11 and a downstream primer shown in SEQ ID NO.12.

[0070] SEQ ID NO.11: 5'-TCCTCCTGCTCTGTCTTCTG-3';

[0071] SEQ ID NO. 12: 5'-GGTCACTTTGCATGGTCCA-3'.

[0072] This primer pair was used to amplify the VIGS silenced fragment of the TaWAK1 gene and recovered for future use.

[0073] Primers were designed according to the CDS sequence of the TaWAK2 gene, and restriction sites and protective bases were added to the 5' ends of the forward and reverse primers, respectively, to form an upstream primer shown in SEQ ID NO.13 and a downstream primer shown in SEQ ID NO.14.

[0074] SEQ ID NO.13: 5'-ACCCTGCAAGCCTTATTAATCT-3';

[0075] SEQ ID NO. 14: 5'-GCTTGTTCTCGGTGCAAAC-3'.

[0076] This primer pair was used to amplify the VIGS silenced fragment of the TaWAK2 gene and recovered for future use.

[0077] The VIGS silencing fragments of TaWAK1 and TaWAK2 genes and the γ-PDS-as vector were further digested with Pac1 and Not1, the silencing fragments and the corresponding γ linearized vector fragments were recovered, and the recombinant vector construction (γ-WAK1 / 2) was completed using the homologous recombination method.

[0078] Subsequently, the viral vector (α, β, γ, γ-PDS) and TaWAK1 / 2 gene silencing recombinant vector (γ-WAK1 / 2) plasmids were linearized by enzyme digestion, and the linearized plasmids were further transcribed in vitro using the RiboMAXTM Large Scale RNA Production Systems-T7 kit to obtain different components of viral in vitro transcription products. Take 2.5 μL of each in vitro transcription product α, β, γ / γ-PDS / γ-WAK1 / 2, mix them in a ratio of 1:1:1 and dilute them with an equal volume of DEPC water, take 5 μL of the diluted mixture and add it to 90 μL FES buffer to mix thoroughly by pipetting. Four different treatments were set up for each experiment, namely: complete blank control group (WT), virus blank control group (α+β+γ), albino positive control group (α+β+γ-PDS) and gene silencing group (α+β+γ-WAK1 / 2).

[0079] When the virus is infected, spray a small amount of DEPC water on the surface of the plant to be infected, take 8-10μL FES mixed solution and apply it on clean gloves, rub the second leaf of the seedling from the base to the tip of the leaf 3 times, control the strength during rubbing, and spray a little DEPC water from top to bottom to maintain humidity after rubbing. Clean gloves need to be changed for each treatment. After the virus is inoculated, place it in a 23±2℃ incubator to keep warm, moisturize and avoid light for 24 hours, and then adjust it to a 16h / 8h light and dark cycle for cultivation, and observe and record phenotypic changes regularly.

[0080] After 2 weeks of VIGS silencing, the relative expression of TaWAK1 / 2 genes in silenced plants (BSMVg) and virus-free plants (BSMV0) was detected by qRT-PCR. Figure 4 As shown, the results showed that the relative expression level of TaWAK1 / 2 gene was significantly downregulated in the recipient material plants, and the gene was effectively silenced in different recipient material plants.

[0081] Further investigation of the stripe rust resistance of the silenced plants of the receptor material Yumai No. 1 showed that the number of stripe rust spores attached to the leaf surface of the TaWAK2 gene-silenced plants was significantly reduced, and the number of hyphae colonization in the silenced plants was significantly reduced, and the disease resistance was significantly enhanced; while the stripe rust resistance of the TaWAK1 gene-silenced plants did not change significantly compared with the control plants ( Figure 4 ).

[0082] In summary, the resistance changes were significant after TaWAK2 gene silencing, indicating that this gene is a negative regulatory gene in the response process of wheat stripe rust.

[0083] Example 3

[0084] Development and application of TaWAK2 allele markers

[0085] The nucleotide sequence of the TaWAK2 genome is shown in SEQ ID NO:1.

[0086]

[0087] The full-length cDNA nucleotide sequence of the TaWAK2 gene is shown in SEQ ID NO:2.

[0088]

[0089] The CDS nucleotide sequence of the TaWAK2 gene is shown in SEQ ID NO:3.

[0090]

[0091] The protein sequence encoded by the TaWAK2 gene is shown in SEQ ID NO:4.

[0092] SEQ ID NO:4: MAICSSLHLSTTLQALLIFVVLAVLLRDVHGRHHCDTFSCGHLH.

[0093] Based on the 10 bp InDel at two positions between the 108th and 109th bases before the translation start site and after the start of ATG in the sequence shown in SEQ ID NO:1, a specific molecular marker was developed to detect this differential site, and the specific primer pair for amplifying the mutation site included an upstream primer sequence shown in SEQ ID NO:7 and a downstream primer sequence shown in SEQ ID NO:8.

[0094] SEQ ID NO:7: 5'-GCAAGCCATGGCGATTTGTA-3';

[0095] SEQ ID NO:8: 5'-CCGGCGGAAAGGATGTGATA-3'.

[0096] The resistant parent (Xinhuamai 818), the susceptible parent (Yumai No. 1), the resistant pool and the susceptible pool strains were used as samples. The genomic DNA of each sample was used as a template and the marker M306 (i.e., SEQ ID NO: 5 and SEQ ID NO: 6) was used for PCR amplification. The PCR amplification products were recovered by 40% polyacrylamide gel to obtain bands of 173 bp (SEQ ID NO: 9, resistant genotype) or 163 bp (SEQ ID NO: 10, susceptible genotype).

[0097] SEQ ID NO:9: GCAAGCC AT ATGGCGATTTGTAGTTCACTTCATCTTTCTACTA CCCTGCAAGCCTTATTAATCTTTGTTGTGCTTGCAGTACTCTTACGTGATGTTCATG GGCGACACCACTGTGATACTTTC ACACTTT C TCCTGTGGACATCTCCATAATATAT CACATCCTTTCCGCCGG;

[0098] SEQ ID NO: 10: GCAAGCCATGGCGATTTGTAGTTCACTTCATCTTTCTACTAC CCTGCAAGCCTTATTAATCTTTGTTGTGCTTGCAGTACTCTTACGTGATGTTCATGG GCGACACCACTGTGATACTTTCTCCTGTGGACATCTCCATAATATATCACATCCTTT CCGCCGG.

[0099] Primers were designed according to the CDS sequence of the TaWAK1 gene, and restriction sites and protective bases were added to the 5' ends of the forward and reverse primers, respectively, to form an upstream primer shown in SEQ ID NO.11 and a downstream primer shown in SEQ ID NO.12.

[0100] SEQ ID NO.11: 5'-TCCTCCTGCTCTGTCTTCTG-3';

[0101] SEQ ID NO. 12: 5'-GGTCACTTTGCATGGTCCA-3'.

[0102] Primers were designed according to the CDS sequence of the TaWAK2 gene, and restriction sites and protective bases were added to the 5' ends of the forward and reverse primers, respectively, to form an upstream primer shown in SEQ ID NO.13 and a downstream primer shown in SEQ ID NO.14.

[0103] SEQ ID NO.13: 5'-ACCCTGCAAGCCTTATTAATCT-3';

[0104] SEQ ID NO. 14: 5'-GCTTGTTCTCGGTGCAAAC-3'.

[0105] The amplification results of marker M306 on the resistant parent and the resistant pool are as follows Figure 5 As shown in the figure, M is a DNA molecular weight standard, R is a disease-resistant strain, and S is a susceptible strain. The black arrow in the figure is the fragment corresponding to the molecular marker M306-1.

[0106] The results showed that the molecular marker M306 located on chromosome 3BS had consistent polymorphism between the parents and the resistant and susceptible pools, that is, a 173bp DNA fragment could be amplified in Xinhuamai 818 and the resistant strains; and a 163bp DNA fragment could be amplified in Yumai No. 1 and the susceptible strains, proving that the molecular marker is closely linked to the stripe rust resistance gene.

[0107] Obviously, the above embodiments of the present invention are merely examples for clearly illustrating the present invention, and are not intended to limit the implementation methods of the present invention. For ordinary technical users in the relevant field, other different forms of changes or modifications can be made on the basis of the above description. It is not necessary and impossible to list all the implementation methods here. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the claims of the present invention.

Claims

1. Application of TaWAK2 gene or the protein encoded by it in regulating wheat stripe rust resistance, characterized in that: The CDS nucleotide sequence of the TaWAK2 gene is shown in SEQ ID NO:

3.

2. The use according to claim 1, characterized in that: Silencing or knocking out the TaWAK2 gene improves wheat resistance to stripe rust.

3. Application of recombinant vectors, expression cassettes, transgenic cell lines or recombinant bacteria containing the TaWAK2 gene in regulating wheat stripe rust resistance.

4. The use according to claim 3, characterized in that: Silencing or knocking out the TaWAK2 gene improves wheat resistance to stripe rust.

5. A method for regulating wheat stripe rust resistance, characterized in that: Silencing or knocking out the TaWAK2 gene improves wheat resistance to stripe rust.

6. An InDel molecular marker combination associated with wheat stripe rust resistance, characterized in that: The molecular marker combination is located on wheat chromosome 3BS, including InDel 1 and InDel 2; The InDel1 is the nucleotide sequence shown in SEQ ID NO.9, in which two bases from position 8 to position 9 are inserted or deleted; The InDel2 is the nucleotide sequence shown in SEQ ID NO.9, in which 8 bases from the 124th to the 131st position of the nucleotide sequence are inserted or deleted.

7. A primer set for amplifying the InDel molecular marker combination according to claim 6, characterized in that: It includes an upstream primer as shown in SEQ ID NO:7 and a downstream primer as shown in SEQ ID NO:

8.

8. A method for identifying wheat stripe rust resistance, characterized in that: The wheat gene to be tested is used as a template and amplified using the primer set of claim 7. If the size of the amplified product is 173 bp, it is a disease-resistant plant; if the size of the amplified product is 163 bp, it is a disease-susceptible plant.

9. Use of the InDel molecular marker combination according to claim 6 in breeding for wheat stripe rust resistance-related traits.

10. Use of the InDel molecular marker combination according to claim 6 in identifying or assisting in identifying traits related to wheat stripe rust resistance.

Images