GhMYB306 gene for regulating and controlling cotton long fiber development and application of GhMYB306 gene

Abstract

The invention discloses a GhMYB306 gene for regulating and controlling cotton long fiber development and application of the GhMYB306 gene. Belongs to the technical field of gene engineering. The nucleotide sequence of the GhMYB306 gene is as shown in SEQ ID NO. 1. The fiber length of a transgenic cotton plant obtained by knocking out the GhMYB306 gene by using a CRISPR / Cas9 technology is obviously shortened, which indicates that the GhMYB306 gene (the gene is in the field of Zhejiang University reference genome gene ID: GhiD13G09836; the gene ID: GHD13G1832 of a reference genome in Wuhan University plays a key role in elongation of cotton fiber development. The invention provides a favorable gene resource for cultivating high-quality cotton.

Description

Technical Field

[0001] The present invention relates to the field of technical gene engineering, and more specifically to a GhMYB306 gene for regulating the development of cotton long fibers and an application thereof. Background Art

[0002] Cotton (Gossypium spp.) is an important cash crop and a major natural fiber source for the textile industry worldwide. Among the four Gossypium species (G. hirsutum, G. barbadense, G. arboreum, and G. raimondii), upland cotton (G. hirsutum) is widely cultivated for its high yield and adaptability.

[0003] The fiber of upland cotton is a single-cell structure that originates from the differentiation and development of epidermal cells in the outer integument of the ovule. The fiber development process of upland cotton can generally be divided into four independent and overlapping stages: fiber initiation, elongation, secondary cell wall synthesis, and maturity. The initial differentiation of cotton fiber is an important factor affecting cotton yield and quality. The amount of initial differentiation of ovule epidermal cells determines the amount of fiber development on the final cottonseed, that is, the lint index; the fiber elongation period determines the length of fiber development, etc. The initiation of fiber cells usually occurs around the day of flowering (0DPA), characterized by the protrusion and expansion of epidermal cells on the surface of the ovule. In upland cotton, long-staple fibers, also known as "long lint", develop before or on the day of flowering (0DPA) and are the main fiber part used by the textile industry; ovule epidermal cells begin to produce shorter fibers after 3DPA of flowering, called "short lint", which are fibers coated in the seed epidermis and very short in length, and have low utilization value. All epidermal cells have the potential to develop into mature fibers, but only about 15-25% of them can differentiate into usable fibers. How to enable more ovule epidermal cells to differentiate into fibers through molecular design is an important topic in cotton fiber initiation research. Therefore, genetic design of cotton fiber initiation regulatory pathways at the molecular level to promote more ovule cells to differentiate into fiber cells is the future development direction of cotton high-yield breeding.

[0004] Previous researchers have explored the mechanism of cotton fiber initiation from the perspectives of cytology, morphology, physiology, biochemistry, and genetics. At present, many key genes related to the initiation and development of cotton fibers have been discovered, but cotton fiber development is a complex and orderly process. The protrusion of cotton fibers is not determined by a single factor or a single gene, but by a relatively complex multi-factor and multi-gene interaction. Based on this, further exploring the key genes for the initiation and development of cotton fibers is an urgent problem to be solved by those skilled in the art. Summary of the invention

[0005] In view of this, the present invention provides a GhMYB306 gene for regulating the development of long fibers in cotton and applications thereof.

[0006] Exploring the regulatory mechanism of long fibers is crucial to improving the quality of cotton fibers. In order to solve this problem, the present invention uses the wild type of upland cotton Xuzhou 142 with long and short fibers as the test group (142-WT), and the cotton variety Xuzhou 142 without long fibers and short fibers is used as the control group (142-fl). Using RNA-Seq sequencing technology, GO enrichment analysis, KEGG enrichment analysis, WGCNA analysis and other means, the transcription factor GhMYB306 gene of the core gene-MYB family was screened out, and through subcellular localization, it was found that the gene was located in the nucleus; it was highly expressed in cotton fibers and ovules, and lowly expressed or not expressed in tissues such as roots, stems, and leaves; through CRISPER / Case9 gene editing technology, the phenotype of the positive plants of the offspring was identified, and it was found that the deletion of the gene had different degrees of influence on fiber length, lint, and flocculent force, so it can be determined that the gene plays an important role in the fiber development process. The method of the present invention lays the foundation for revealing the molecular mechanism of the early stage of fiber development.

[0007] In order to achieve the above object, the present invention adopts the following technical solution:

[0008] A GhMYB306 gene for regulating the development of long cotton fibers, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0009] Application of GhMYB306 gene in regulating cotton long fiber development.

[0010] Furthermore, overexpression of the GhMYB306 gene promoted the development of long fibers in cotton.

[0011] Furthermore, the cotton content, fiber length and lint content can be adjusted.

[0012] Application of GhMYB306 gene knockout in constructing a cotton model with shortened fiber length.

[0013] It can be seen from the above technical scheme that compared with the prior art, the beneficial effects achieved by the present invention are as follows: the nucleotide sequence of the GhMYB306 gene is shown in SEQ ID NO.1. The transgenic cotton plant obtained by knocking out the GhMYB306 gene using CRISPR / Cas9 technology has significantly shortened fiber length and reduced lint percentage and floc content, indicating that the GhMYB306 gene plays a key role in the elongation of cotton fiber development. The present invention provides a favorable gene resource for cultivating high-quality cotton. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying creative work.

[0015] Figure 1 The images are microscopic observation images of ovules of 142-WT and 142-fl at the fiber initiation stage by scanning electron microscopy (SEM) in Example 1 of the present invention; all ovules are from the same position of cotton bolls with similar positions on each plant, and the scale bar chart shows the magnification of 300 microns and 80 microns;

[0016] Figure 2 The differentially expressed genes (DEGs) between 142-WT and 142-fl and between the three stages of 142-WT in Example 1 of the present invention, wherein A is the number of up-regulated and down-regulated DEGs determined by the difference comparison; B is a Venn diagram showing the DEGs during W1; C is a Venn diagram showing the DEGs during W2; D is the total number of non-redundant DEGs in W0, W1 and W2 stages;

[0017] Figure 3 The results of RNA-seq analysis (A) and qRT-PCR (B) in Example 1 of the present invention;

[0018] Figure 4 The results of gene ontology analysis of DEGs in Example 1 of the present invention are shown in Figure 1, where A is a Venn diagram; B is a GO term enriched in the three fiber initiation cycles of the wild type;

[0019] Figure 5 GO enrichment analysis of DEGs at the initial 0DPA, 1DPA, and 2DPA stages of 142-WT fibers in Example 1 of the present invention; WT_0, WT_1, and WT_2 represent the top 15 GO terms of 142-WT fibers at the initial 0DPA, 1DPA, and 2DPA stages, respectively;

[0020] Figure 6 The co-expression network analysis in Example 1 of the present invention identifies differentially expressed genes related to fiber initiation, wherein A is a hierarchical clustering tree showing the co-expression modules identified by WGCNA, each leaf on the tree represents a gene, each main branch represents a module, and there are 13 modules in total, which are marked with different colors; B is the module-sample association relationship, each row corresponds to a module, and each row corresponds to a module. Figure 6 The same color markings as in A, each column corresponds to a specific tissue, and the intersection of rows and columns shows the correlation coefficient and P value between the module and the sample or tissue;

[0021] Figure 7 This is the key gene screening in Example 1 of the present invention, where A is the gene expression trend of the sky blue module; B is the KEGG enrichment analysis of the sky blue module; C is the co-expression network analysis of the sky blue module, the red and orange circles represent hub genes and transcription factors, and the light blue circles represent hub genes;

[0022] Figure 8 This is a subcellular localization picture in Example 2 of the present invention;

[0023] Fig. 9 The results of the study on the expression pattern of the GhMYB306 gene in different tissues in Example 3 of the present invention are shown in Figure 3, wherein calycle represents the stipule outside the calyx; leaf represents the leaf; petal represents the petal; pistil represents the pistil; root represents the root; stamen represents the stamen; stem represents the stem; torus represents the receptacle; ovule represents the ovule; fiber represents the fiber;

[0024] Fig.10 This is the plasmid map of WMC028 in Example 4 of the present invention;

[0025] Fig.11 This is the fiber phenotype diagram of strain 1 in Example 4 of the present invention;

[0026] Fig.12 This is the fiber phenotype diagram of strain 2 in Example 4 of the present invention;

[0027] Fig.13 This is the fiber phenotype diagram of strain 3 in Example 4 of the present invention;

[0028] Fig.14 This is the fiber phenotype diagram of strain 4 in Example 4 of the present invention;

[0029] Fig.15 This is a fiber morphology diagram of strain 5 in Example 4 of the present invention. DETAILED DESCRIPTION

[0030] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0031] The drugs required for the present invention are conventional experimental drugs, which are purchased from commercial channels; the experimental methods not mentioned are conventional experimental methods and will not be described in detail here.

[0032] Example 1

[0033] 1 Materials and methods

[0034] 1.1 Plant materials and treatments

[0035] The experimental materials were the wild type of Xuzhou 142, a cotton variety with long fibers and short lint, as the test group (142-WT), and the lint-free mutant of Xuzhou 142, a cotton variety without long fibers and short lint, as the control group (142-fl), which was planted at the experimental base of Xinjiang Academy of Agricultural Sciences, with three replicates. On the day of flowering, the cotton bolls were repeatedly marked (0DPA). The bolls of the two genotypes were harvested at 0, 1, and 2DPA, and the ovules were removed and immediately placed in liquid nitrogen. They were then stored in an ultra-low temperature freezer at -80°C.

[0036] 1.2 SEM analysis

[0037] The samples of 142-WT and 142-fl at 0, 1, and 2 DPA were observed using a SEM Phenom electron microscope. The obtained ovule samples were placed in a 2.5% glutaraldehyde fixative at 4°C for 3 hours, and then placed in 0.5-1.0% OsO4 for 1 hour. After that, the samples were further dehydrated by alcohol gradient dehydration. The samples stayed in different concentrations of alcohol for 30 minutes and then freeze-dried. After that, the samples were placed on a conductive rubber sample stage, and the metal coating method was used to place the sample stage in an ion sputtering instrument for low vacuum ion sputtering to form a conductive film on the sample surface. Finally, it was inserted into the SEM Phenom electron microscope sample cup, placed in the electron microscope cabin, and observed.

[0038] 1.3 RNA extraction and RNA sequencing

[0039] Total RNA was extracted from fiber samples using the Tiangen RNA extraction kit and was completed by Beijing Novogene Technology Co., Ltd. (novogene, China). Residual genomic DNA was degraded using DNase I. The degree of RNA degradation and whether there was contamination were analyzed using agarose gel electrophoresis. The purity of RNA (OD260 / OD280 ratio) and accurate RNA concentration were detected using a Nanodrop 2000 micro-spectrophotometer. The integrity of RNA was accurately detected using an Agilent 2100. After passing the quality check, RNA sequencing was performed on the Illumina Hiseq 4000 platform. The complete set of annotated genes can be found in the National Center for Biotechnology Information (NCBI) SRA database (BioProject access number: PRJNA1033041). The raw data (FASTq format) was processed using Perl scripts to obtain Q20, Q30, and GC content values. The raw data were filtered to remove low-quality reads with adapters and obtain clean data for downstream analysis. Paired-end clean reads were aligned to the TM-1 reference genome using Hisat2 software. The number of reads mapped to each gene was calculated using FeatureCounts v1.5.0-p3. Based on the gene length and the number of reads mapped to the gene, the fragments per kilobase of transcript per million mapped reads (FPKM) were calculated for each gene.

[0040] 1.4 Real-time quantitative polymerase chain reaction (RT-qPCR)

[0041] The same RNA samples as those used for RNA-seq were used in RT-qPCR. Three microliters of total RNA was used to synthesize cDNA using oligo(dT) and M-MLV reverse transcriptase (Takara, Dalian, China) according to the manufacturer's instructions. The cDNA was then loaded into a 96-well plate and PCR was performed using Light qRT-PCR analysis was performed using the 480II system (Roche, Switzerland) and Power SYBR Green PCR Master Mixture (Roche, Switzerland). A 10-μl reaction system contained: 1 μl cDNA, 2 μl 100 nmol / L upstream primer, 2 μl 100 nmol / L downstream primer, and 5 μl SYBR Green PCR Master Mix. PCR conditions were as follows: 95°C for 5 min, 40 cycles of 94°C for 10 s, 60°C for 10 s, and 72°C for 10 s. Relative gene expression levels were analyzed according to the 2ΔΔCt method. The internal normalization gene was GhHistone 3. Primers were designed using the National Center for Biotechnology Information Primer BLAST tool (available online: http: / / www.ncbi.nlm.nih.gov / tools / primer-blast / , accessed on March 27, 2018). The product specificity and reaction efficiency of each primer pair were verified.

[0042] 1.5 Gene differential expression, gene function annotation, and enrichment analysis

[0043] Differential expression analysis was performed using the DESeq R software package (1.20.0). The p-values ​​obtained were adjusted according to Benjamini and Hochberg to control the false discovery rate. Adjusted p-values ​​< 0.05 and |log2(fold change)| ≥ 2 were used as criteria for identifying DEGs. Gene ontology (GO) enrichment analysis of DEGs was performed using the clusterProfiler R software package, in which gene length bias was corrected. GO terms with corrected p-values ​​less than 0.05 were considered significantly enriched. The clusterProfiler R software package was used to test the statistical enrichment of DEGs in the KEGG pathway.

[0044] 1.6 Gene network construction and visualization

[0045] Co-expression networks were constructed using the WGCNA (v1.29, Department of Human Genetics, University of California, Los Angeles, CA, USA) package in R. Modules were obtained using the automatic block network construction method. Modules were identified according to the default settings, where power, minModuleSize, and merge CutHeight were set to 14, 30, and 0.25, respectively, and TOMType was selected. Gene values ​​for each module were calculated and used to test for association with each sample. Total and within-module connectivity (functional soft connectivity), KME (for module membership, also known as gene-based connectivity), and p_value were calculated. Networks were visualized using Cytoscape.

[0046] 2 Results

[0047] 2.1 Phenotypic characteristics of cotton fiber mutants

[0048] There were no differences in plant morphology between 142-WT and 142-fl plants during growth. During reproductive growth, there were no significant differences between 142-WT and 142-fl plants in flowering stage, petal color, and stamen size, but there were significant differences in anther appearance and development. To identify developmental differences between 142-WT and 142-fl fibers, we observed the ovaries under an electron microscope and compared the changes in the surface of the wild-type and mutant ovaries at 0, 1, and 2 DPA developmental stages. The results are shown in Figure 2. Figure 1 As shown. When 142-WT was at 0 DPA, a large number of raised spherical epidermal cells were formed; at 1 DPA, the raised cells gradually became larger and became oval; at 2 DPA, the raised epidermal cells began to elongate and may form fibers. In contrast, 142-fl did not produce fibers at 0, 1, and 2 DPA before flowering.

[0049] 2.2 Transcriptome quality control analysis during cotton fiber development

[0050] To explore the molecular mechanisms of fiber initiation and development in upland cotton, we compared the transcriptomes of ovules at the three stages mentioned above, sequenced 18 RNA libraries, and obtained a total of 39421086 to 47226244 high-quality clean reads. The obtained high-quality clean reads were compared with the upland cotton genome database TM-1. The proportion of Total_mapped was 89.12% to 96.51%, the proportion of Multiple Mapped was 3.82% to 4.85%, and the proportion of Uniquely Mapped was 85.03% to 92.32%. These results show that the RNA-seq data is of high quality and suitable for further analysis.

[0051] 2.3 Analysis of differential gene expression during cotton fiber elongation and development

[0052] Differentially expressed genes (DEGs) between 142-WT and 142-fl were analyzed and compared using |log2(fold change)|>2 and Padj<0.05. A total of 708 DEGs were found in W0 vs fl0, of which 360 genes were upregulated and 348 genes were downregulated; a total of 1327 DEGs were found in W1 vs fl1, of which 955 genes were upregulated and 372 genes were downregulated; a total of 2324 DEGs were found in W2 vs fl2, of which 1078 genes were upregulated and 1246 genes were downregulated ( Figure 2A) (W0 represents wild type 0DPA, fl0 represents mutant 0DPA, and the naming is based on this rule, the same below).

[0053] Meanwhile, a total of 758 DEGs were found in W1 vs W0, including 691 up-regulated genes and 67 down-regulated genes; a total of 1121 DEGs were found in W2 vs W0, including 853 up-regulated genes and 268 down-regulated genes; a total of 212 DEGs were found in W2 vs W1, including 29 up-regulated genes and 183 down-regulated genes ( Figure 2 A).

[0054] To better understand the differences in each stage of the initial development of 142-WT fibers, the results showed that there were 1707 DEGs in the W1 stage, including 1357 DEGs in W1 vs fl1 (949 of which were unique) and 758 DEGs in W1 vs W0 (350 of which were unique), and 408 DEGs were shared by W1 vs fl1 and W1 vs W0 ( Figure 2 B). There were 2840 DEGs during W2, including 2322 (1618 unique) in W2 vs fl2 and 1061 (370 unique) in W2 vs W0, 212 (120 unique) in W2 vs W1, 640 in W2 vs fl2 and W2 vs W0, 41 in W2 vs fl2 and W2 vs W1, 28 in W2 vs W1 and W2 vs W0, and 23 in all three comparison groups ( Figure 2 C). Overall, there were 3397 non-redundant DEGs in the three stages of 142-WT ( Figure 2 D) Among them, a total of 433 genes were differentially expressed in the three stages of 142-WT.

[0055] 2.4 Confirmation of DEGs by qRT-PCR analysis

[0056] To validate the RNA-seq results and identify DEGs, the expression levels and trends of 12 genes were analyzed by qRT-PCR, of which 4 genes were related to fatty acid biosynthesis ( Figure 3 ). The qRT-PCR results of the selected genes were highly consistent with the RNA-seq results, indicating that the RNA-seq results are very reliable ( Figure 3 ).

[0057] 2.5 Gene ontology analysis of DEGs

[0058] To better understand the functional roles of differentially expressed genes (DEGs) during fiber initiation and development, gene ontology (GO) analysis was performed. Using a significance threshold of p-value ≤ 0.05, we identified 3397 DEGs enriched in 100 GO terms. We further determined that 31, 65, and 93 GO terms were enriched at 0DPA, 1DPA, and 2DPA in 142-WT fibers, respectively. Specifically, 11, 16, and 42 GO terms were uniquely enriched at 0DPA, 1DPA, and 2DPA, respectively, at each corresponding stage. Figure 4 A). In addition, 2 GO terms were enriched in both 0DPA and 1DPA, 4 GO terms were enriched in both 0DPA and 2DPA, and 33 GO terms were enriched in both 1DPA and 2DPA. Overall, a total of 14 GO terms were enriched in all three stages of 142-WT fibers. Biosynthesis and metabolism of fatty acids and biosynthesis and metabolism of monocarboxylic acids were significantly enriched in the BP category, and xyloglucanosyltransferase was significantly enriched in the MF category at the W0, W1, and W2 stages of 142-WT fiber development, suggesting that the fiber initiation process may be related to the fatty acid pathway ( Figure 4 B).

[0059] 2.6 KEGG pathway analysis of DEGs

[0060] We further performed Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis using 3397 non-redundant DEGs and found that these DEGs were associated with 107 pathways. Many significantly changed pathways were related to fatty acid elongation, phenol propane biosynthesis, unsaturated fatty acid biosynthesis, keratin, suberin and wax biosynthesis, cysteine ​​and methionine metabolism. 708 DEGs in W0 were enriched in KEGG pathways and mapped to 74 pathways, of which 9 were significantly enriched (P_Value≤0.05), including unsaturated fatty acid biosynthesis; fatty acid elongation; fatty acid metabolism; indole alkaloid biosynthesis; betalain biosynthesis; fructose and mannose metabolism; fatty acid biosynthesis; phenol propane biosynthesis and propionate metabolism. 1706 DEGs in the W1 period were enriched in the KEGG pathways and mapped to 97 pathways, of which 8 were significantly enriched (P_Value≤0.05), including fatty acid elongation; keratin, suberin, and wax biosynthesis; unsaturated fatty acid biosynthesis; phenolic propane biosynthesis; cysteine ​​and methionine metabolism; coenzyme Q and other terpenoid-quinone biosynthesis; flavonoid and flavonol biosynthesis; and isoflavone biosynthesis. The 2608 DEGs in the W2 period were enriched in the KEGG pathways and mapped to 105 pathways, of which 18 were significantly enriched (P_Value≤0.05), including fatty acid elongation; phenolic propane biosynthesis; keratin, suberin, and wax biosynthesis; unsaturated fatty acid biosynthesis; cysteine ​​and methionine metabolism; fructose and mannose metabolism; coenzyme Q and other terpenoid-quinone biosynthesis; β-alanine metabolism; monoterpene biosynthesis; starch and sucrose metabolism; leucine, isoleucine, and valine biosynthesis; sesquiterpene and triterpene biosynthesis; ABC transporters; nitrogen metabolism; leucine, isoleucine, and valine degradation; galactose metabolism; tyrosine metabolism; alanine, aspartate, and glutamate metabolism.

[0061] Comprehensive analysis showed that among the DEGs in 0DPA, 1DPA, and 2DPA fibers, the fatty acid elongation pathway, the unsaturated fatty acid biosynthesis pathway, and the phenolpropane biosynthesis pathway showed significant enrichment in the comparison groups at the three time points. According to previous studies, gene expression in pathways related to fatty acids may promote fiber development and be involved in the synthesis of wax in fibers. Gene expression related to energy metabolism (such as fructose and mannose metabolism, cysteine ​​and methionine metabolism, propionate metabolism, etc.) provides energy for the initial development of fibers. These results indicate that the initial development of cotton fibers is regulated by a complex gene network of multiple biosynthetic and metabolic pathways ( Figure 5 ).

[0062] 2.7 Co-expression network analysis to identify differentially expressed genes (DEGs) associated with fiber initiation

[0063] WGCNA is an algorithm for mining modules from large datasets, each module contains a cluster of highly interconnected genes. Genes in the same cluster have high correlation coefficients. In this study, we used WGCNA to classify 3397 DEGs into 13 modules, each marked with a different color. Modules are defined by the main branches of the cluster dendrogram ( Figure 6 A), the correlation coefficient between each module and the sample features is shown in the figure ( Figure 6 B). The red module has the highest correlation with fl0 (R=0.95, P=9e-10); the brown module has the highest correlation with fl1 (R=0.46, P=0.05); the pink module has the highest correlation with fl2 (R=0.85, P=8e-06); the yellow-green module has the highest correlation with W0 (R=0.96, P=6e-10); the green module has the highest correlation with W1 (R=0.81, P=4e-05); the sky-blue module has the highest correlation with W2 (R=0.8, P=7e-05) ( Figure 6 B).

[0064] According to scanning electron microscopy, cotton fibers begin to swell at about 1DPA, so we are most concerned about the sky blue module with the highest correlation with W2. There are 1181 genes in the sky blue module. The heat map analysis results show that the first category is the gene expression level that gradually increases with fiber development, which is significantly upregulated in W2 and expressed at a lower level in fl2. This type of gene accounts for the majority; the expression pattern of the second category of genes is opposite to that of the first category. The expression level of the gene gradually decreases with fiber development, is significantly downregulated in W2, but has a higher expression level in fl2 ( Figure 7 A). KEGG pathway enrichment analysis showed that the azure module was significantly enriched in the following 13 pathways: fatty acid elongation; biosynthesis of cuticle, suberin and wax; biosynthesis of unsaturated fatty acids; biosynthesis of coenzyme Q and other terpenoid quinones; ABC transport; fatty acid metabolism; β-alanine metabolism; cysteine ​​and methionine metabolism; starch and sucrose metabolism; phenolic propane biosynthesis; biosynthesis of stilbene, diphenylheptane and curcumin; galactose metabolism; limonene and pinene degradation ( Figure 7 B).

[0065] Key genes (hub genes) are genes that play a vital role in biological processes. In related pathways, the regulation of other genes is usually affected by this gene. According to the screening criteria KME (gene value connectivity) ≥ 0.98 and edge weight value ≥ 0.6, a total of 83 key genes were identified. The relationship between core genes was visualized using Cytoscape software, and the results showed that all genes have high connectivity ( Figure 7C). Studies have reported that the initial development of upland cotton fibers is mainly related to fatty acid elongation. In addition, transcription factors play a key role in the initial fiber development process. Therefore, key genes including MYB transcription factor GhMYB306 gene (Ghi_D13G09836), OFP gene (Ghi_A07G06336), fatty acid elongation very long chain 3-ketoacyl-CoA reductase 1 (Ghi_A03G08906), 3-ketoacyl-CoA synthetase 9 (Ghi_D01G00221), 3-ketoacyl-CoA synthetase 19 (Ghi_A10G13266), 3-ketoacyl-CoA synthetase 20 (Ghi_D09G03516) were selected as target core genes.

[0066] Through annotation, we only found one transcription factor, GhMYB306 gene. Transcription factors are generally located in the core region, so we will verify the GhMYB306 gene later. The nucleotide sequence of the GhMYB306 gene is as follows:

[0067]

[0068] Example 2

[0069] Subcellular localization

[0070] Subcellular localization primers GhMYB306-F and GhMYB306-R were designed, and the fragment containing the GhMYB306 gene was amplified by PCR. The pBWA(V)HS-ccdB-EGFP vector (constructed by Wuhan Boyuan Biotechnology Co., Ltd.) was linearized with BsaI. The gene was fused to the N-terminus of the subcellular localization vector pBWA(V)HS-ccdB-EGFP green fluorescent protein (GFP) using the homologous recombination kit 2×Seamless Cloning Mix (Biorun, Wuhan, China) to construct a 35S::GhMYB306-GFP fusion expression vector. The empty vector was used as a control and injected into tobacco epidermal cells using Agrobacterium-mediated transient expression. The nuclear marker (NLS-mKate) was also transferred and cultured at 25℃ in the dark for 48h. The cells were observed and photographed using a laser confocal microscope.

[0071] Table 1 Primer sequences

[0072]

[0073] The results are as follows Figure 8 As shown, GhMYB306 was found to be expressed in the cell nucleus, indicating that GhMYB306 is a nuclear localized protein.

[0074] Example 3

[0075] Expression profiles of GhMYB306 in different tissues of the genetic standard line TM-1

[0076] In order to determine the expression pattern of GhMYB306 gene in upland cotton during fiber development, we used RNA-Seq transcriptome sequencing data to analyze the expression of GhMYB306 in different tissues and developmental stages of cotton. Fig. 9 shown.

[0077] The results showed that GhMYB306 was expressed to varying degrees in roots, calyx stipules, receptacles, ovules, and fibers, but not in petals, stamens, leaves, stems, and other tissues; among them, the highest expression level was in fibers, followed by the expression level in ovules. The expression level in ovules was as follows: 1 day before flowering, it began to be lowly expressed, reached a peak at 3DPA after flowering, then began to decrease, and did not express at 20DPA. GhMYB306 was expressed more dominantly in fibers than in other tissues, and the highest expression level was at 5DPA, the expression level decreased at 10DPA, the expression level was extremely low at 20DPA, and then did not express. This indicates that GhMYB306 is expressed in the fiber initiation-elongation period, especially in the fiber elongation period, and this gene may be involved in regulating the initiation development and elongation of cotton fiber cells.

[0078] Example 4

[0079] Gene editing transformation

[0080] (1) Construction of gene knockout vector

[0081] The CRISPR / Cas9 plant gene knockout vector in this experiment was modified based on pCAMBIA3101. The hygromycin selection marker on pCAMBIA3101 was replaced with the spectinomycin (aada, aada gene amplified on pCAMBIA3101 vector) selection marker. The modified vector was named WMC028 ( Fig.10 ).

[0082] (2) Design of primer sequences for MYB306 gene knockout target

[0083] To construct a CRISPR / Cas9 vector, the target sequence is designed first. In this experiment, two sgRNA sequences were designed and synthesized by the company on the backbone sequence. The two target sequences were fused to obtain a sequence using the recombinant PCR method. The restriction sites of the BsaI enzyme were added to the 5' and 3' ends of the sequence to facilitate the construction of the vector. The target designs of the relevant genes or non-coding proteins in this project are as follows:

[0084] Table 2 Target design

[0085]

[0086] (3) Construction of CRISPR / Cas9 gene editing vector

[0087] The sequence of step (2) and the expression vector WMC028 were digested with BsaI enzyme, and homologous recombination ligase was used to finally obtain the expression vector WMC028-GhMYB306. The constructed expression vector was transformed into Escherichia coli and identified by colony PCR. The screening primers were QC1: 5'-ggcgaaagggggatgtgctgcaa-3', SEQ ID NO.6 and QC10: 5'-TTCTGCAGACAAATGGC-3', SEQ ID NO.7. A band of about 1247 bp was amplified, i.e., a positive clone. The positive clone was sequenced and identified to obtain a completely consistent sequence, proving that the expression vector was successfully constructed and can be used for subsequent cotton transformation experiments.

[0088] (4) Genetic transformation

[0089] The vector was transferred into Agrobacterium EHA105 by electroporation and identified by PCR. The cotton embryo tips soaked for one day were used as materials and placed in a culture dish containing 50 ml of Agrobacterium suspension. About 300 explants were treated within 2 hours and placed at room temperature for 30 minutes for infection. After the infection, the Agrobacterium liquid was discarded, and the explants were placed in a co-culture medium and co-cultured in the dark at 23°C for 3 days. After co-culture, the embryos were transferred to a resting medium, cultured in light at 28°C for 7 days, and then placed on the corresponding resistance screening medium, screened and cultured for 6 weeks to induce resistant buds. Then they were transferred to an elongation medium for light culture for 3 to 6 weeks, 28°C, 5000lx, and light culture until rooting.

[0090] (5) Molecular identification

[0091] After transplanting the plug trays, the 13 T0 plants obtained were tested for plant resistance genes and target sites. The primer information is as follows:

[0092] Primers for detecting plant resistance genes:

[0093] AADA-F1:TCCGACATCGATCTCCTGGT, SEQ ID NO.8;

[0094] AADA-R1:CAGGGTGAGGACCACATTCC, SEQ ID NO.9.

[0095] The amplified size was 435 bp.

[0096] Detection target site primers:

[0097] GH_A13G1882_JGS4208-A1-F1:TCCATGTTGTGATAAAGTG, SEQ ID NO.10;

[0098] GH_A13G1882_JGS4208-A1-R1: CATGAGAGATCAAATCATT, SEQ ID NO.11;

[0099] GH_A13G1882_JGS4208-A2-F1:TCCATGTTGTGATAAAGTG, SEQ ID NO.12;

[0100] GH_A13G1882_JGS4208-A2-R1: CATGAGAGATCAAATCATT, SEQ ID NO.13;

[0101] GH_D13G1832_JGS4208-B1-F1: CTCCATGCTGTGATAAAGTA, SEQ ID NO.14;

[0102] GH_D13G1832_JGS4208-B1-R1:TCCATGAGAAATCAAATCACA, SEQ ID NO.15;

[0103] GH_D13G1832_JGS4208-B2-F1: CTCCATGCTGTGATAAAGTA, SEQ ID NO.16;

[0104] GH_D13G1832_JGS4208-B2-R1:TCCATGAGAAATCAAATCACA, SEQ ID NO. 17.

[0105] The reaction system (20 μl) is as follows:

[0106] 10μl 2*PCR buffer,

[0107] 7 μl H2O,

[0108] 1 μl upstream primer (10 μM),

[0109] 1 μl downstream primer (10 μM),

[0110] 1μl DNA.

[0111] The reaction procedure is as follows:

[0112]

[0113] The identification results are as follows:

[0114] Table 3 Identification results

[0115]

[0116]

[0117] (6) Using CRISPR / Cas9 gene editing technology, gene editing genetic transformation was performed to obtain 13 editing-positive T0 generation plants and harvest 5 T1 generation seeds.

[0118] Table 4 Test results

[0119]

[0120] Comparison of fiber phenotypes of strain 1, strain 2, strain 3, strain 4, and strain 5 Figure 11 to Figure 15 As shown, the fiber quality comparison table is shown in Table 5.

[0121] Table 5 Comparison of fiber quality of gene-edited T1 seed cotton and wild type

[0122]

[0123] From the five strains, it can be seen that after the gene was knocked out, the fiber length of mutant strain 1 became longer than that of the wild type; the fiber length of mutant strain 2 was significantly lower than that of the wild type; the fiber length of mutant strain 3 was lower than that of the wild type; the fiber flocculent capacity of mutant strain 4 was affected by gene knockout, and the flocculent was not smooth and stiff; the lint percentage of mutant strain 5 was significantly lower than that of the wild type. It can be seen that this gene has a certain function in the development of ovule epidermal cells and the elongation of fiber cells.

[0124] The various embodiments in this specification are described in a progressive manner, and each embodiment focuses on the differences from other embodiments. The same or similar parts between the various embodiments can be referenced to each other.

[0125] The above description of the disclosed embodiments enables one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A GhMYB306 gene that regulates the development of cotton long fibers, It is characterized in that The nucleotide sequence is as follows: ATGGGAAGACCTCCATGCTGTGATAAAGTAGGTATCAAGAAAGGTCCATGGACTCCTGAAGAAGATATCATCCTCGTCTCTTACATTCAAGAACATGGGTCCTGGAAACTGGAGATCAGTCCCTACCAATACTGGTATTTT ACCTTATCCCTTTTACAATTTGATATCGATCAATTCAATCAATCAAGAAGATAAAATGAATTTCATGCGTTCTTTTGGCTGATTCAGAATATGTTTTTGCTTGTATTCAAAAGGGTTAATGAGATGCAAAAGTTGCAGACTT AGATGGACTAATTATCTCAGACCAGGAATCAAAAGAGGCAACTTCACTGCTCATGAAGAAGGGATGATTATTCACTTGCAAGCCTTACTGGGTAACAAGTAATCCTCAAATCTTTTTCTTATTATATCAGATTTCGAGATCAT CTTCGCTGTTTTATCTTTGTTTGCTTTGAATACTATGCAATGATTTTGTTTGTTTTTGGTTACAGATGGGCAGCCATAGCATCGTATTTACCACAAGAACAGATAATGACATAAAGAACTACTGGAACCCATCTGAAG AAGAAGCTAAGGAAGTTCAGTCAGCTATGGAGCCTCCTTCAATGGCGGTGATGAGAAGAGCTTAGATTTCGCAGAAAGTGAGACTGGAGCTGGTTCAAGTAATCTTAAGCTAAACCAAACCTCCCTCTTCATATGCTTCA AGCACCGAGAATATATCTCGTCTTCTTCAAGGTTGGATGAGATCGTCACCCAAGATTAACAACAACAACAACAACAACAACAACAACAACAACAACAACAGCGACAGCATTGGGAGTTGTTCAGCTGCAAACTGTGATTTGATTTCTCATGGAGATGAT CAGTTGGAATCGATACTATCGTTTGAGAACATGAAGGATGTTGCATTAATGGAGAAATCTACTTCAAAGGCTACTTTTCAAGATTCTGGTGAAAAGATTATTAACCCCAGAAAGGAAGCAAAAAGCTGATAACAATACAAT AATATTGATGATAATAATAATAATAACAACAGTAATCCTCATTATCGTTTCTTGAGAAGTGGCTTTTGGATGAGAGTTCTTCTGCAGCTCAAGTCGAAGAAATTGATCAGATGATGGAATTGCCTTCAATTTTCTAA, SEQ IDNO.

1.

2. Application of GhMYB306 gene in regulating the development of cotton long fibers.

3. The application of claim 2, It is characterized in that Overexpression of GhMYB306 gene promotes the development of cotton long fibers.

4. The application of claim 2, It is characterized in that Regulate the length of cotton clothes, and the strength of flocculation.

5. Application of knocking out the GhMYB306 gene in constructing cotton models with shortened fiber length.

Images