Creation method and application of Xa5 excellent allele for improving bacterial blight resistance of rice

Abstract

The invention belongs to the technical field of modernized agriculture, and particularly relates to a creation method and application of an Xa5 excellent allele capable of improving resistance to bacterial blight of rice. According to the invention, four Xa5 alleles capable of improving the bacterial blight resistance of rice are discovered for the first time, and a biological material for creating a rice variety with high bacterial blight resistance is provided. Experimental results show that by utilizing the four alleles, the scab length of leaves infected by xanthomonas oryzae can be reduced by 59.4%-81.6%, gene resources and technical ways are provided for rice disease-resistant breeding, and the four alleles have important breeding utilization value.

Description

Technical Field

[0001] The invention belongs to the technical field of modern agriculture, and specifically relates to a method for creating and applying a Xa5 superior allele for improving resistance to rice bacterial blight. Background Art

[0002] Rice (Oryza sativia) is the main source of food for people's survival and one of the main food crops in my country. Bacterial blight (BB) is caused by bacterial blight fungi of the genus Xanthomonas ( Xanthomonas oryzae pv.oryzae , Xoo), which can cause rice death or even grain loss in severe cases. Therefore, rice bacterial blight is an important disease that seriously hinders the improvement of rice yield and quality.

[0003] There are many TAL effectors (Transcription activator-like effectors, TALE) in the bacterial blight pathogen, which can enter rice through the type III secretion system and induce the expression of target genes in rice. Some TALEs need the participation of XA5 protein to activate the expression of target genes. Among the bacterial blight resistance genes discovered so far, the rice recessive gene xa5 is a disease resistance gene with broad-spectrum resistance to bacterial blight.

[0004] CRISPR / Cas9 is one of the most popular gene editing tools. It uses guide RNA (gRNA) to guide the Cas9 enzyme to the target DNA sequence. The Cas9 enzyme cuts the DNA double strands and then achieves gene editing through the cell's own DNA repair mechanism (such as non-homologous end joining NHEJ or homologous recombination repair HDR). Prime Editing (PE) is a new gene editing tool developed based on the CRISPR / Cas9 system. PE technology fuses Cas9 nickase with reverse transcriptase and uses a special guide editing guide RNA (pegRNA) to achieve precise editing of the target DNA sequence. Compared with traditional editing technologies such as zinc finger nucleases (ZFN) and transcription activator-like effector nucleases (TALEN), it has the advantages of higher efficiency, stronger specificity, simpler operation and richer editing types. Summary of the invention

[0005] In view of the above technical problems, the present invention provides Xa5 superior alleles capable of improving resistance to rice bacterial blight and corresponding creation methods.

[0006] The first aspect of the present invention aims to provide a rice bacterial blight resistance Xa5 allele.

[0007] The purpose of the second aspect of the present invention is to provide a sgRNA for preparing the Xa5 allele of rice resistance to bacterial blight.

[0008] The third aspect of the present invention is to provide a pegRNA for preparing the Xa5 allele of rice resistance to bacterial blight.

[0009] The fourth aspect of the present invention aims to provide an editing vector for creating rice resistant to bacterial blight.

[0010] The fifth aspect of the present invention aims to provide a kit for producing rice resistant to bacterial blight.

[0011] The purpose of the sixth aspect of the present invention is to provide the use of the allele of the first aspect of the present invention, the sgRNA of the second aspect of the present invention, the pegRNA of the third aspect of the present invention, and / or the editing vector of the fourth aspect of the present invention in the preparation of products for breeding rice resistant to bacterial blight or improving rice germplasm resources with bacterial blight resistance.

[0012] The seventh aspect of the present invention aims to provide a method for cultivating rice resistant to bacterial blight.

[0013] In order to achieve the above-mentioned purpose of the present invention, the technical solution adopted by the present invention is: The first aspect of the present invention provides a rice bacterial blight resistance Xa5 (sequence of the first exon of the Xa5 gene) allele , the Xa5 allele is shown in any one of SEQ ID NOs: 20, 22, 25, and 26.

[0014] In some embodiments of the present invention, the sequence is an allele as shown in SEQ ID NO: 20, in which a T base is inserted at position 123 of the original sequence of Xa5 (SEQ ID NO 19).

[0015] In some embodiments of the present invention, the sequence is an allele as shown in SEQ ID NO: 22, in which a G base is inserted at position 123 of the original sequence of Xa5 (SEQ ID NO: 19).

[0016] In some embodiments of the present invention, the allele sequenced as shown in SEQ ID NO: 25 has a mutation of TC to AG at positions 116 to 117 of the original sequence of Xa5 (SEQ ID NO 19). In some embodiments of the present invention, the allele sequence is as shown in SEQ ID NO: 26, in which T at position 116 of the original sequence of Xa5 (SEQ ID NO 19) is mutated to A.

[0017] In a second aspect of the present invention, a sgRNA for preparing a rice bacterial blight resistance Xa5 allele is provided, wherein the nucleotide sequence of the sgRNA is shown in SEQ ID NOs: 2-4.

[0018] In some embodiments of the present invention, the sgRNA having a sequence as shown in SEQ ID NO: 2 is used for single-site gene editing.

[0019] In some embodiments of the present invention, sgRNAs with sequences as shown in SEQ ID NOs: 3 and 4 are used for dual-site gene editing.

[0020] The third aspect of the present invention provides a pegRNA for preparing the rice bacterial blight resistance Xa5 allele, the nucleotide sequence of the pegRNA is shown in SEQ ID NO:8.

[0021] The fourth aspect of the present invention provides an editing vector for creating rice resistant to bacterial blight; the vector comprises the sgRNA described in the second aspect of the present invention and the pegRNA described in the third aspect of the present invention.

[0022] In some embodiments of the present invention, the vector includes a single-site editing vector, a double-site editing vector, and a PE editing vector.

[0023] In some embodiments of the present invention, the plant expression vector for single-site editing includes but is not limited to pYLCRISPR / Cas9, pRGEB301, pRGEB302 and pUbi-HyCas9 vectors.

[0024] In some embodiments of the present invention, plant expression vectors suitable for dual-site editing include but are not limited to pCAMBIA type vectors, pX458M, pX459M, pHH-hU6-A-gRNA, pHH-hU6-B-gRNA and plentiCrispr-e vectors, etc.

[0025] In some embodiments of the present invention, plant expression vectors suitable for PE editing include: pPE2, pPE3 and MS2PE system vectors, etc. In a fifth aspect of the present invention, a kit for creating rice resistant to bacterial blight is provided, the kit comprising the sgRNA described in the second aspect of the present invention, the pegRNA described in the third aspect of the present invention, and / or the editing vector described in the fourth aspect of the present invention.

[0026] In some embodiments of the present invention, the kit further comprises at least one of Agrobacterium, a buffer, and a Cas protein.

[0027] The sixth aspect of the present invention provides the use of the allele of the first aspect of the present invention, the sgRNA of the second aspect of the present invention, the pegRNA of the third aspect of the present invention, and / or the editing vector of the fourth aspect of the present invention in the preparation of products for breeding rice resistant to bacterial blight or improving rice germplasm resources with bacterial blight resistance.

[0028] A seventh aspect of the present invention provides a method for cultivating rice resistant to bacterial blight, comprising the following steps: The kit described in the fifth aspect of the present invention is used to edit the Xa5 gene of rice, and rice having the Xa5 allele described in the first aspect of the present invention is screened.

[0029] In some embodiments of the present invention, the rice having the Xa5 allele according to the first aspect of the present invention has improved resistance to bacterial blight compared to a reference level; the reference level is wild-type rice.

[0030] In some embodiments of the present invention, the editing system is at least one of the CRISPR / Cas9 system and the PE editing system (Prime Editor, PE).

[0031] In some embodiments of the present invention, further, homozygous mutant plants are selected from rice having the Xa5 allele described in the first aspect of the present invention to cultivate T1 generation strains.

[0032] The beneficial effects of the present invention are: The present invention has discovered for the first time four Xa5 alleles that can improve rice bacterial blight resistance, and provides biological materials for creating rice varieties with high bacterial blight resistance. Experimental results show that the four alleles of the present invention can reduce the length of leaf spots infected by bacterial blight by 59.4% to 81.6%, providing gene resources and technical approaches for rice disease resistance breeding, and having important breeding utilization value. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] The present invention will be further described below with reference to the accompanying drawings and embodiments, wherein: Figure 1 yes Xa5 Gene sequence and sgRNA information. A: Target site information based on the dual-target system; B: Target site information based on the single-target system; Box: Target sequence; Blue underline: PAM; C: Comparison of TP309 Xa5 gene target sequence with the designed target sequence.

[0034] Figure 2 is the pPE expression cassette and pegRNA information. A: Schematic diagram of the pPE expression cassette. The pPE fusion protein is expressed using the themize Ubiquitin 1 promoter and 35S terminator. NLS, nuclear localization signal. B: Genomic sequence of pegRNA; the expected mutation of the underlined start codon is marked in red; the regions corresponding to the protospacer, PBS, and RT template are indicated in brackets; the PAM is marked in an orange box. C: C: TP309 Xa5 Comparison of gene target sequence with designed pegRNA sequence.

[0035] Figure 3 Genetic transformation process of rice materials. A: callus induction; B: screening of callus-induced tissues; C: induction of tissue differentiation; D: rooting of seedlings.

[0036] Figure 4 PCR identification of T0 transgenic positive plants based on CRISPR / Cas9 technology. M: DL 2000 DNAMarker; H2O: negative control with sterile water as template; A: Hygromycin resistance marker primers HYG-YF / HYG-YR were used to identify the double-target system transformation seedlings; B: Cas9 vector detection primers Cas9-jc-F3 / Cas9-jc-R3 were used to identify the double-target system transformation seedlings; CD: The single-target system transformation seedlings were identified using primers Xa5T-F and Xa5TR, where C is the result of the single-target system transformation seedlings numbered 1 to 18, and D is the result of the single-target system transformation seedlings numbered 19 to 36.

[0037] Figure 5 PCR identification of T0 generation transgenic positive plants based on PE technology M: DL 2000 DNA Marker; H2O: negative control with sterile water as template; A: TC-AG transgenic seedlings were identified using hygromycin resistance marker primers OS35SHYG1-F3 / R3; B: TC-AG transgenic seedlings were identified using PE vector detection primers Cas9 H840A-hjc-F1 / R1; C: TA transgenic seedlings were identified using hygromycin resistance marker primers OS35SHYG1-F3 / R3; D: TA transgenic seedlings were identified using PE vector detection primers Cas9 H840A-hjc-F1 / R1.

[0038] Figure 6 Representative sequencing chromatograms for targeted genome editing. WT; wild type; Editing: edited sequence; edits are marked with red boxes.

[0039] Figure 7The target mutation types of homozygous mutant strains based on CRISPR / Cas9 technology. Red bold letters: insertion; blue dotted lines: deletion; A: target mutation types of homozygous mutant strains in single-target system; B: target mutation types of homozygous mutant strains in dual-target system.

[0040] Figure 8 This is a T-DNA-free test for editing transgenic plants based on CRISPR / Cas9 technology. M: DL 2000 DNAMarker; H2O: negative control with sterile water as template; WT: wild type; A: single target system + G mutation type T1 generation strain (Cas9- Xa5 -1) T-DNA-free detection; B: Single target system + T mutation type T1 generation strain (Cas9- Xa5 -2) T-DNA-free detection; CH: T-DNA-free detection of dual-target system T1 strain (Cas9-Xa5-3~8).

[0041] Fig. 9 T-DNA-free detection of transgenic plants edited based on PE technology. M: DL 2000 DNA Marker; H2O: negative control with sterile water as template; WT: wild type; A: TA mutant type T1 generation line (PE- Xa5 -1) T-DNA-free detection; B: TA mutation type T1 generation strain (PE- Xa5 -2) T-DNA-free detection; C: TC-AG mutation type T1 generation strain (PE- XA 5-3) T-DNA-free detection; D: TC-AG mutation type T1 generation strain (PE- Xa5 -4) T-DNA-free detection.

[0042] Fig.10 Identification of resistance to different editing types of T1 homozygous editing lines. WT: wild type; +T / +G: homozygous editing line based on single target system; TC-AG / TA: homozygous editing line based on PE editing system; -AAG / -AA / -AA+G: homozygous editing line based on dual target system; XOO4 / PXO86 / PXO99A: three physiological races of rice bacterial blight pathogen. DETAILED DESCRIPTION

[0043] The following will be combined with the embodiments to clearly and completely describe the concept of the present invention and the technical effects produced, so as to fully understand the purpose, characteristics and effects of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative work are all within the scope of protection of the present invention.

[0044] The instruments, reagents, materials, etc. involved in the following examples, unless otherwise specified, are all conventional instruments, reagents, materials, etc. in the prior art and can be obtained through conventional commercial channels. The experimental methods, detection methods, etc. involved in the following examples, unless otherwise specified, are all conventional experimental methods, detection methods, etc. in the prior art.

[0045] Experimental materials: Rice: TP309 line.

[0046] Example 1 TP309 Xa5 gene sgRNA design and detection 1. Xa5 gene target site sequence and location In this example, the target site is designed by selecting the 30 bp region before and after the TC site that differs from xa5 in the open reading frame (ORF) of the Xa5 gene sequence (eg Figure 1 A, B), where two targets G1 and G2 were designed based on the dual-target system, and one target G3 was designed based on the single-target system, all of which were 20 bp in length, with PAMs of TGG, CGG, and TGG, respectively, and GC contents of 35%, 50%, and 30%. It was also found that none of the three target sequences had 4 or more consecutive T bases, and the target site sequence and the transcribed sgRNA sequence would not be paired continuously. Therefore, the sgRNA expression cassette constructed with this target site does not have the risk of premature transcription termination and the generation of RNA stem-loop structure.

[0047] Among them, the nucleotide sequence of the single-site editing sgRNA is: AAGTAGATACCTTATCAAACTGG (SEQ ID NO: 1).

[0048] The nucleotide sequence of the sgRNA for dual-site editing is: CCATTCAAGTTCTTGTCCAGTTT (SEQ ID NO:2); CCGGAGCTCGCCATTCAAGTTC (SEQ ID NO:3).

[0049] 2. Xa5 gene target site detection Using TP309 genomic DNA as a template, the upstream fragment of the Xa5 gene was amplified and sequenced using the target detection primers Xa-KZ-F2 / Xa-KZ-R2. Snapgene software was used to align the base sequence with the designed Xa5 target site. The results showed that the base sequence of the Xa5 gene target site of TP309 was consistent with the designed target sequence ( Figure 1 C). This indicates that the designed target and target adapter primers are suitable for TP309 and can be carried out to the next step.

[0050] The sequence of Xa-KZ-F2 is: 5'-CAAAAAGTTTAGGCGCACGC-3' (SEQ ID NO: 4).

[0051] The sequence of Xa-KZ-R2 is: 5'-CCGTCATAGACTAATCACAT-3' (SEQ ID NO: 5).

[0052] Example 2 TP309 Xa5 gene pegRNA design and detection 1. Xa5 gene pegRNA sequence and location Xa5 pegRNA was designed to replace TC-AG or TA at the TC position of the Xa5 gene open reading frame (ORF), thereby changing the 39th amino acid encoded by Xa5 from valine to glutamic acid or aspartic acid ( Figure 2 (A, B).

[0053] 2. Xa5 gene pegRNA sequence detection Using TP309 genomic DNA as a template, the upstream fragment of the Xa5 gene was amplified and sequenced using the target detection primers Xa-KZ-F4 / Xa-KZ-R2. Snapgene software was used to align the base sequence with the designed Xa5 pegRNA. The results showed that the base sequence of the Xa5 gene target site of TP309 was consistent with the designed pegRNA sequence ( Figure 2 C). This indicates that the designed pegRNA and target linker primers are suitable for TP309 and can be used for the next step of the experiment.

[0054] The sequence of Xa-KZ-F4 is: 5'-GCTCTTAATTTCAGAGCCTT-3' (SEQ ID NO: 6).

[0055] The sequence of Xa-KZ-R4 is: 5'-CCGTCATAGACTAATCACAT-3' (SEQ ID NO: 7).

[0056] The nucleic acid sequence of pegRNA is: TCAAGTTCTTGTCCAGTTTGATAAGGTATCTACTT (SEQ ID NO: 8).

[0057] Example 3 Genetic transformation of rice materials, positive detection of T0 transgenic plants and analysis of mutation types 1. Genetic transformation of rice materials pCAMBIA1300-Ubi-Cas9 was selected as the single-site editing vector backbone, pCAMBIA1300-OsU6-Cas9 as the dual-site editing vector backbone, and PE2-MCP3 as the PE editing vector backbone. The sgRNA and pegRNA were inserted into the corresponding vector backbones, respectively, and then introduced into the parent TP309 by Agrobacterium-mediated genetic transformation. The rice seeds were treated to induce callus tissue from mature embryos. The callus tissue reached more than 95%. The callus tissue was screened by Agrobacterium infection and co-cultivation, and the resistant callus tissue with good growth was induced to differentiate and root ( Figure 3 ). Through tissue culture and genetic transformation of the parent TP309 mature embryos, resistant transformed seedlings were obtained.

[0058] 2. Positive detection and mutation type analysis of T0 transgenic plants edited by CRISPR / Cas9 technology Among the transformed seedlings obtained, there may be false positive transformed seedlings. In order to exclude this possibility, DNA of young leaves of transformed seedlings was extracted, and DNA of seedlings transformed by dual target system was amplified by PCR using hygromycin resistance marker primers HYG-YF (5'-ATGAAAAAGCCTGAACTCACC-3', SEQ ID NO:9) / HYG-YR (5'-CTATTTCTTTGCCCTCGGAC-3', SEQ ID NO:10) and Cas9 vector detection primers Cas9-jc-F3 (5'-CAGAAAGAGCGAGGAAACCA-3', SEQ ID NO:11) / Cas9-jc-R3 (5'-CCTCAAACAGTGTCAGGGTCA-3', SEQ ID NO:12) to screen exogenous genes. The results showed that 13 of the seedlings transformed with the dual-target system amplified the target fragments with lengths of 1026 bp and 485 bp, indicating that they were transgenic positive plants. The DNA of the seedlings transformed with the single-target system was amplified by PCR using primers Xa5T-F (5'-GCTCGCGTTCGTTCGTTAAC-3', SEQ ID NO:13) and Xa5T-R (5'-TGCTCTTGACTTGGTTCTCC-3', SEQ ID NO:14) to screen for exogenous genes. Among the transformed seedlings, 36 amplified the target fragment with lengths of 419 bp, indicating that they were transgenic positive plants (Figure 4).

[0059] The target site mutation analysis was performed on the successfully edited transgenic positive rice plants. The results showed that four types of mutations appeared in the T0 generation mutant plants, namely homozygous mutant, double allelic mutant, heterozygous mutant and wild-type mutant. All 13 positive transgenic plants in the T0 generation of the double-target system transformed seedlings mutated, with a total mutation rate of 100%, of which 6 plants had heterozygous mutations at the target site, with a mutation rate of 46.2%; 7 plants had double allelic mutations, with a mutation rate of 53.8%; 14 of the 36 positive transgenic plants in the T0 generation of the single-target system transformed seedlings mutated, with a total mutation rate of 38.9%, of which 4 plants had homozygous mutations at the target site, with a mutation rate of 11.1%; and 10 plants had heterozygous mutations, with a mutation rate of 27.8%.

[0060] Table 1 Analysis of target mutations in the T0 generation

[0061] 3. Positive detection and mutation type analysis of T0 transgenic plants edited by PE technology The DNA of young leaves of transformed seedlings was extracted, and the transgenic seedling DNA was amplified by PCR using hygromycin resistance marker primers OS35SHYG1-F3 (5'-CCCACTATCCTTCGCAAGACC-3', SEQ ID NO: 15) / R3 (5'-GATCGCATCCATAGCCTCCG-3', SEQ ID NO: 16) and PE vector detection primers Cas9 H840A-hjc-F1 (5'-cgacctcgacaatctcctcg-3', SEQ ID NO: 17) / R1 (5'-gtagtacgggatgcggaagg-3', SEQ ID NO: 18) to screen exogenous genes. The results showed that 3 of the TC-AG transgenic seedlings amplified target fragments with lengths of 500bp and 535bp, indicating that they were transgenic positive plants; 14 of the TA transgenic seedlings amplified target fragments with lengths of 500bp and 535bp, indicating that they were transgenic positive plants (Figure 5).

[0062] The target site mutation analysis was performed on the transgenic positive rice plants. The results showed that in the T0 generation mutant plants obtained, mutations in TA and TC-AG occurred ( Figure 6 Among the 13 positive transgenic plants of the T0 generation of TA transgenic positive seedlings, 7 were homozygous TA mutant plants, with a mutation rate of 53.8%; among the 3 positive transgenic plants of the T0 generation of TC-AG transgenic positive seedlings, all had homozygous TC-AG mutations, with a mutation rate of 100%.

[0063] Example 4: T-DNA-free detection of T1 transgenic plants 1. T-DNA-free detection of transgenic plants edited based on CRISPR / Cas9 technology The target sequence mutation types of four homozygous mutants in the T0 generation of transformed seedlings of the single target system were analyzed, and it was found that the target of all mutant plants showed the form of base insertion, the number of base deletions was 1 bp, and the mutation form was single (+T, +G) (Figure 7A). Then, 30 representative T1 generation strains of the homozygous mutant plants were selected for T-DNA-free detection. The genomic DNA of mutant plants was extracted from young rice leaves. The Cas9 vector detection primers Cas9-jc-F3 (5'-CAGAAAGAGCGAGGAAACCA-3', SEQ ID NO:11) / Cas9-jc-R3 (5'-CCTCAAACAGTGTCAGGGTCA-3', SEQ ID NO:12) were used to PCR amplify the DNA of the seedlings transformed by the dual-target system. The primers Xa5T-F (5'-GCTCGCGTTCGTTCGTTAAC-3', SEQ ID NO:13) and Xa5T-R (5'-TGCTCTTGACTTGGTTCTCC-3', SEQ ID NO:14) were used to PCR amplify the DNA of the seedlings transformed by the single-target system. The obtained PCR products were detected by electrophoresis on 1.5% agarose gel. T-DNA-free plants had no vector-specific bands. The results are as follows: In the +G mutant type T1 generation line (Cas9- Xa5 -1), 14 strains did not amplify the corresponding fragments, which were T-DNA-free strains, accounting for 46.7% (A in Figure 8); Xa5 -2), 13 strains did not amplify the corresponding fragments, accounting for 43.3% ( Figure 8 At the same time, the sequencing results showed that all the plants without exogenous T-DNA were homozygous mutations. Two representative plants were selected from the T0 generation of heterozygous mutation type of the T0 generation of the dual-target system transformed seedlings, and four representative plants were selected from the T0 generation of biallelic mutation type to obtain their T1 generation strains (Cas9- Xa5 -3~8) 22 representative strains were selected for T-DNA-free detection. The results are as follows: among the T1 generation strains of biallelic mutation type, 15 did not amplify the corresponding fragments, which were T-DNA-free strains, accounting for 17%; among the T1 generation strains of heterozygous mutation type, 9 did not amplify the corresponding fragments, which were T-DNA-free strains, accounting for 20.5% ( Figure 8The target sequence mutation types of the T1 generation of the double-target system mutant plants were analyzed, and various mutation forms were found, including 2-3bp base deletion (-AA, -AAG) and double allelic mutations of deletion and insertion (-A+T, -AA+G) ( Figure 7 Middle B).

[0064] The specific mutation types are as follows: SEQ ID NO: 19 (original Xa5 sequence): ATGGCCACCTTCGAGCTCTACCGGAGGTCCACCATTGGCATGTGCCTCACTGAGACGCTCGACGAGATGGTCTCCAGCGGCACCCTCAGCCCGGAGCTCGCCATTCAAGTTCTTGTCCAGTTTGATAAGTCTATGACGGAAGCCTTGGAGAACCAAGTCAA GAGCAAGGTTTCTATCAAGGGCCACCTGCACACTTACAGGTTCTGTGACAATGTATGGACATTCATCTTGACTGAAGCATCATTCAAGAACGAGGAGACTACAGAACAAGTTGGCAAGGTGAAGATTGTGGCCTGTGATTCCAAACTACTCAGCCAATAA.

[0065] SEQ ID NO:20 (a T base is inserted at position 123): ATGGCCACCTTCGAGCTCTACCGGAGGTCCACCATTGGCATGTGCCTCACTGAGACGCTCGACGAGATGGTCTCCAGCGGCACCCTCAGCCCGGAGCTCGCCATTCAAGTTCTTGTCCAGTTTTGATAAGTCTATGACGGAAGCCTTGGAGAACCAAGTCA AGAGCAAGGTTTCTATCAAGGGCCACCTGCACACTTACAGGTTCTGTGACAATGTATGGACATTCATCTTGACTGAAGCATCATTCAAGAACGAGGAGACTACAGAACAAGTTGGCAAGGTGAAGATTGTGGCCTGTGATTCCAAACTACTCAGCCAATAA.

[0066] SEQ ID NO:21 (a G base is inserted at position 123): ATGGCCACCTTCGAGCTCTACCGGAGGTCCACCATTGGCATGTGCCTCACTGAGACGCTCGACGAGATGGTCTCCAGCGGCACCCTCAGCCCGGAGCTCGCCATTCAAGTTCTTGTCCAGTTGTGATAAGTCTATGACGGAAGCCTTGGAGAACCAAGTCAAGAGCAAGGTTTCTATCAAGGGCCACCTGCACACTTACAGGTTCTGTGACAATGTATGGACATTCATCTTGACTGAAGCATCATTCAAGAACGAGGAGACTACAGAACAAGTTGGCAAGGTGAAGATTGTGGCCTGTGATTCCAAACTACTCAGCCAATAA。

[0067] SEQ ID NO:22 (missing three bases AAG at positions 107 - 109 of the original sequence): ATGGCCACCTTCGAGCTCTACCGGAGGTCCACCATTGGCATGTGCCTCACTGAGACGCTCGACGAGATGGTCTCCAGCGGCACCCTCAGCCCGGAGCTCGCCATTCTTCTTGTCCAGTTTGATAAGTCTATGACGGAAGCCTTGGAGAACCAAGTCAAGAGCAAGGTTTCTATCAAGGGCCACCTGCACACTTACAGGTTCTGTGACAATGTATGGACATTCATCTTGACTGAAGCATCATTCAAGAACGAGGAGACTACAGAACAAGTTGGCAAGGTGAAGATTGTGGCCTGTGATTCCAAACTACTCAGCCAATAA。

[0068] SEQ ID NO:23 (missing two bases AA at positions 107 - 108 of the original sequence): ATGGCCACCTTCGAGCTCTACCGGAGGTCCACCATTGGCATGTGCCTCACTGAGACGCTCGACGAGATGGTCTCCAGCGGCACCCTCAGCCCGGAGCTCGCCATTCGTTCTTGTCCAGTTTGATAAGTCTATGACGGAAGCCTTGGAGAACCAAGTCAAGAGCAAGGTTTCTATCAAGGGCCACCTGCACACTTACAGGTTCTGTGACAATGTATGGACATTCATCTTGACTGAAGCATCATTCAAGAACGAGGAGACTACAGAACAAGTTGGCAAGGTGAAGATTGTGGCCTGTGATTCCAAACTACTCAGCCAATAA。

[0069] SEQ ID NO:24 (Insert a G base at the 96th position and delete two AA bases at the 107th and 108th positions of the original sequence): ATGGCCACCTTCGAGCTCTACCGGAGGTCCACCATTGGCATGTGCCTCACTGAGACGCTCGACGAGATGGTCTCCAGCGGCACCCTCAGCCCGGAGGCTCGCCATTCGTTCTTGTCCAGTTTGATAAGTCTATGACGGAAGCCTTGGAGAACCAAGTCAAGAGCAAGGTTTCTATCAAGGGCCACCTGCACACTTACAGGTTCTGTGACAATGTATGGACATTCATCTTGACTGAAGCATCATTCAAGAACGAGGAGACTACAGAACAAGTTGGCAAGGTGAAGATTGTGGCCTGTGATTCCAAACTACTCAGCCAATAA。

[0070] SEQ ID NO:25 (The TC at positions 116 - 117 of the original sequence is mutated to AG): ATGGCCACCTTCGAGCTCTACCGGAGGTCCACCATTGGCATGTGCCTCACTGAGACGCTCGACGAGATGGTCTCCAGCGGCACCCTCAGCCCGGAGCTCGCCATTCAAGTTCTTGAGCAGTTTGATAAGTCTATGACGGAAGCCTTGGAGAACCAAGTCAAGAGCAAGGTTTCTATCAAGGGCCACCTGCACACTTACAGGTTCTGTGACAATGTATGGACATTCATCTTGACTGAAGCATCATTCAAGAACGAGGAGACTACAGAACAAGTTGGCAAGGTGAAGATTGTGGCCTGTGATTCCAAACTACTCAGCCAATAA。

[0071] SEQ ID NO:26 (T at position 116 of the original sequence is mutated to A): ATGGCCACCTTCGAGCTCTACCGGAGGTCCACCATTGGCATGTGCCTCACTGAGACGCTCGACGAGATGGTCTCCAGCGGCACCCTCAGCCCGGAGCTCGCCATTCAAGTTCTTGACCAGTTTGATAAGTCTATGACGGAAGCCTTGGAGAACCAAGTCAAGAGCAAGGTTTCTATCAAGGGCCACCTGCACACTTACAGGTTCTGTGACAATGTATGGACATTCATCTTGACTGAAGCATCATTCAAGAACGAGGAGACTACAGAACAAGTTGGCAAGGTGAAGATTGTGGCCTGTGATTCCAAACTACTCAGCCAATAA。

[0072] 2. Detection of T-DNA-free in transgenic plants based on the PE system From the T0 generation of homozygous plants of different mutation types (TA, TC-AG) generated by the PE system, two lines were selected from each T1 generation to plant the T1 generation, and 30 representative lines were selected from each T1 generation line for T-DNA-free detection. The genomic DNA of the mutant plants was extracted from the young leaves of rice, and PCR amplification was performed using the PE vector detection primers Cas9 H840A-hjc-F1 (5'-cgacctcgacaatctcctcg-3', SEQ ID NO:17) / R1 (5'-gtagtacgggatgcggaagg-3', SEQ IDNO:18). The obtained PCR products were detected by electrophoresis using 1.5% agarose gel. T-DNA-free plants had no vector-specific bands. The results are as follows: In the T1 generation lines of TA mutation type (PE- Xa5 -1) 11 strains did not amplify the corresponding fragments, accounting for 36.7% ( Fig. 9 Middle A); TA mutation type T1 generation strain (PE- Xa5 -2) 9 strains did not amplify the corresponding fragments, accounting for 30% ( Fig. 9 In the T1 generation of TC-AG mutant strain (PE- Xa5 -3), 8 strains did not amplify the corresponding fragments, accounting for 26.7% ( Fig. 9 In the T1 generation strain of TC-AG mutation type (PE-Xa5-4), 10 strains were not amplified with the corresponding fragments, which were T-DNA-free strains, accounting for 33.3% ( Fig. 9 At the same time, sequencing results showed that all homozygous mutants screened were plants without exogenous T-DNA, including 9 strains of PE-Xa5-1, 7 strains of PE-Xa5-2, 3 strains of PE-Xa5-3, and 10 strains of PE-Xa5-4.

[0073] Example 5: Analysis of resistance to bacterial blight in T1 transgenic plants The homozygous lines of different editing types in the T1 generation were identified for resistance to bacterial blight. Three representative transgenic lines were selected for each editing type, and 9 plants were planted in each line. The parent TP309 with the same genetic background was selected as the wild-type control and sown at the same time. At the tillering stage of rice, the leaf clipping method (PXO99A, PXO86, Xoo4) was used to inoculate the fungi (PXO99A, PXO86, Xoo4) and their disease status was counted 14 days later.

[0074] The results of resistance identification showed that among the 7 different mutation types of strains, the +T and +G homozygous strains produced based on the single-target system and the TC-AG and TA homozygous strains produced based on the PE system had significantly improved resistance to bacterial blight compared with the wild type.

[0075] Among them, the lesion length of the +T mutant strains after inoculation with Xoo4 and PXO99A was significantly reduced by 71.6% and 74.9% compared with the wild type, respectively; the lesion length of the +G mutant strains after inoculation with Xoo4 and PXO99A was significantly reduced by 69.8% and 75.9% compared with the wild type, respectively; in addition, the TC-AG and TA mutant types can significantly improve the disease resistance to XOO4 and PXO86. After inoculation with XOO4, the lesion length of the TC-AG and TA mutant plants was reduced by 81.6% and 73.2% compared with the wild type, respectively; after inoculation with PXO86, the lesion length of the TC-AG and TA mutant plants was reduced by 74.9% and 59.4% compared with the wild type, respectively ( Fig.10 ). This indicates that the edited rice is resistant to bacterial blight.

Claims

1. A rice bacterial blight resistance Xa5 allele, characterized in that: The Xa5 allele is shown in any one of SEQ ID NOs: 20, 22, and 26.

2. A method for preparing a sgRNA for the rice bacterial blight resistance Xa5 allele, characterized in that: The nucleotide sequence of the sgRNA is shown in SEQ ID NO: 2-4.

3. A method for preparing a pegRNA for the rice bacterial blight resistance Xa5 allele, characterized in that: The nucleotide sequence of the pegRNA is shown in SEQ ID NO:

8.

4. An editing vector for producing rice resistant to bacterial blight, characterized in that: The vector comprises the sgRNA of claim 2 and the pegRNA of claim 3.

5. A kit for producing rice resistant to bacterial blight, characterized in that: The kit comprises the sgRNA of claim 2, the pegRNA of claim 3, and / or the editing vector of claim 4.

6. The kit according to claim 5, characterized in that: The kit further comprises at least one of Agrobacterium, a buffer and a Cas protein.

7. Use of the allele according to claim 1, the sgRNA according to claim 2, the pegRNA according to claim 3, the editing vector according to claim 4, and the kit according to any one of claims 5 to 6 in breeding rice resistant to bacterial blight or improving rice germplasm resources with bacterial blight resistance.

8. A method for cultivating rice resistant to bacterial blight, comprising the following steps: Editing the Xa5 gene of rice using the kit according to any one of claims 5 or 6, and screening to obtain rice having the Xa5 allele according to claim 1; The rice plant having the Xa5 allele according to claim 1 has improved resistance to bacterial blight compared to a reference level.

9. The method according to claim 8, characterized in that: The editing system is at least one of a CRISPR / Cas9 system and a PE editing system.

10. The method according to claim 8 or 9, characterized in that: Homozygous mutant plants are selected from rice having the Xa5 allele according to claim 1 to cultivate T1 generation strains.

Images