A recombinant bacillus subtilis, a construction method thereof and application of the bacillus subtilis in producing tyrosol and salidroside

Abstract

The present application relates to the field of bioengineering technology, and particularly relates to a recombinant bacillus subtilis, a construction method thereof and application of the bacillus subtilis in producing tyrosol and salidroside, comprising the following steps: S1, extracting parsley and / or rose leaves, and a whole genome of the bacillus subtilis; S2, designing primers for the tyrosine decarboxylase of the parsley, the benzaldehyde synthase of the rose and the bacillus subtilis YjiA respectively as target genes, and performing PCR amplification on the target gene fragments; S3, connecting the target gene fragments with an expression vector to construct a recombinant vector; S4, transforming the recombinant vector into the bacillus subtilis, and screening the transformants by using a resistance gene to obtain a recombinant bacillus subtilis strain. The present application successfully constructs the bacillus subtilis engineering bacteria for heterologous synthesis of tyrosol and salidroside, provides a new idea for industrial fermentation production of tyrosol and salidroside, and lays a foundation for environment-friendly production of tyrosol and salidroside.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of bioengineering technology, and particularly relates to a recombinant bacillus subtilis, a construction method thereof and application of the recombinant bacillus subtilis in production of tyrosol and salidroside. BACKGROUND

[0002] Tyrosol belongs to phenylethanol derivatives and is one of main active ingredients of olive oil. In addition, tyrosol is also a direct precursor of salidroside. Tyrosol has biological activities such as antioxidant and anti-inflammatory, can be used as a precursor of natural product oleocanthal and a raw material of cardiovascular drugs metoprolol and betaxolol, and has potential value in research and development of anti-fungal drugs.

[0003] Salidroside is a product of hydroxyglucosylation at C8 of tyrosol and is one of main active ingredients of rhodiola plants. Salidroside has pharmacological effects such as anti-fatigue, anti-hypoxia, anti-aging, anti-inflammatory and protection of cardiovascular system and central nervous system. Salidroside has been applied to food and health products, skin care products such as whitening and sun protection and pharmaceutical industry, and has very wide application prospect, and has been concerned in recent years. However, supply of salidroside from natural plants is almost unable to meet growing commercial demand.

[0004] Chemical synthesis method has high raw material cost and is not environmentally friendly, which makes microbial synthesis method become a research hotspot for green production of tyrosol and salidroside. However, endotoxin produced by Escherichia coli expression strain can be toxic to human body, and fermentation cycle of yeast expression strain is long. Bacillus subtilis is widely used in food and pharmaceutical fields as a beneficial bacteria, and has effects and functions such as improving consumption function, enhancing immunity and promoting intestinal microbial balance. However, at present, no biological synthesis technology for producing tyrosol and salidroside by using bacillus subtilis has been searched. SUMMARY

[0005] In view of the above, the present application aims to provide a recombinant bacillus subtilis, a construction method thereof and application of the recombinant bacillus subtilis in production of tyrosol and salidroside, and provides a new method for production of tyrosol and salidroside.

[0006] In order to achieve the above purpose, the present application provides a construction method of a recombinant bacillus subtilis, comprising the following steps:

[0007] S1, extracting a whole genome of parsley and / or rose leaf, and extracting a whole genome of bacillus subtilis;

[0008] S2, a first primer group is designed with parsley tyrosine decarboxylase and Bacillus subtilis YjiA as the target genes, and / or a second primer group is designed with rose phenylacetaldehyde synthase and Bacillus subtilis YjiA as the target genes, and the target gene fragments are amplified by PCR with the whole genome of parsley and rose leaves and the whole genome of Bacillus subtilis as templates, respectively;

[0009] S3, the target gene fragments are connected with an expression vector to construct a recombinant vector for expressing the tyrosine decarboxylase and YjiA and / or the phenylacetaldehyde synthase and YjiA activities;

[0010] S4, the recombinant vector is transformed into Bacillus subtilis, and the transformants are screened by using a resistance gene, so that a recombinant Bacillus subtilis strain is obtained.

[0011] In the process of forming the recombinant vector, a restriction enzyme cutting site and a protection base sequence are added to both sides of the fusion fragment.

[0012] The base sequence of the rose phenylacetaldehyde synthase gene is shown in SEQ ID No: 1.

[0013] The base sequence of the parsley tyrosine decarboxylase gene is shown in SEQ ID No: 2.

[0014] The YjiA gene is shown in the base sequence of SEQ ID No: 3.

[0015] Optionally, the first primer group comprises the nucleotide sequences shown in SEQ ID No: 4-7; and the second primer group comprises the nucleotide sequences shown in SEQ ID No: 8-11.

[0016] Preferably, the expression vector is PHY-P43.

[0017] Optionally, the transformation method in S4 is electric excitation transformation or Sipizizen transformation.

[0018] The application further provides a recombinant Bacillus subtilis obtained by using the construction method of the recombinant Bacillus subtilis.

[0019] The application further provides application of the recombinant Bacillus subtilis in fermentation production of tyramine and salidroside.

[0020] The method for fermentatively producing tyrosol and salidroside is to first carry out slant culture on the recombinant Bacillus subtilis, then seed culture, and finally fermentation culture to obtain tyrosol and salidroside. The specific method is as follows: the transformant selected is transferred to a slant culture medium for detection; the colonies are picked from the slant culture medium and cultured on a seed culture medium; the Bacillus subtilis and the modified bacteria are respectively inoculated into a fermentation culture medium to detect the growth of each strain, and the fermentation liquid is centrifuged after being cultured in the culture medium for 72 hours to determine the content of tyrosol and salidroside in the fermentation liquid.

[0021] The temperature of the slant culture is 37℃.

[0022] In the fermentation culture, the seed liquid after seed culture is inoculated into the fermentation culture medium at an inoculation amount of 2-3%.

[0023] The beneficial effects of the present application are as follows:

[0024] The present application introduces a high-efficiency tyrosol production pathway into the original or modified Bacillus subtilis, introduces tyrosine decarboxylase gene from Petroselinum crispum, phenylacetaldehyde synthase gene from Rosa rugosa and YjiA gene from Bacillus subtilis, successfully constructs the heterologous synthesis of tyrosol and salidroside Bacillus subtilis engineering bacteria; compared with Escherichia coli, Bacillus subtilis has the advantages of good safety and strong resistance to bacteria; compared with yeast, Bacillus subtilis has the advantage of short growth cycle;

[0025] The present application provides a new idea for industrial fermentation production of tyrosol and salidroside, lays a foundation for environment-friendly production of tyrosol and salidroside, and has great practical application value and broad application prospect in the fields of food, cosmetics and biopharmaceuticals. BRIEF DESCRIPTION OF DRAWINGS

[0026] In order to more clearly illustrate the technical solutions in the present application or prior art, the following will briefly introduce the drawings needed to be used in the embodiments or prior art description. Obviously, the drawings in the following description are only a part of the present application, and other drawings can also be obtained by those skilled in the art without any creative effort.

[0027] Figure 1 The figure is the centrifuged bacteria of fermentation liquid of original strain and recombinant strain; wherein, a is the centrifuged bacteria of fermentation liquid of original strain, b is the centrifuged bacteria of fermentation liquid of recombinant strain 1, and c is the centrifuged bacteria of fermentation liquid of recombinant strain 2;

[0028] Figure 2 The figure is the fermentation liquid of original strain and recombinant strain; wherein, a is the fermentation liquid of recombinant strain 1, b is the fermentation liquid of recombinant strain 2, and c is the fermentation liquid of original strain;

[0029] Figure 3The standard and fermentation liquor HPLC chart of tyrosol and salidroside; wherein, Fig. A is the HPLC result of fermentation liquor 1, Fig. B is the HPLC result of fermentation liquor 2, and Fig. C is the HPLC result of salidroside and tyrosol standard;

[0030] Figure 4 The bacterial liquid PCR electrophoresis chart of constructing recombinant strain 1, M is 5000bp DNA marker, and lane 2 is PAAS-YjiA fragment;

[0031] Figure 5 The bacterial liquid PCR electrophoresis chart of constructing recombinant strain 2, M is 5000bp DNA marker, and lane 1 is TryDC2-YjiA fragment. DETAILED DESCRIPTION

[0032] In order to make the objects, technical solutions and advantages of the present application clearer and more apparent, the present application will be further described in detail below with specific examples.

[0033] It should be noted that, unless otherwise defined, the technical terms or scientific terms used in the present application should be understood as the common meanings understood by those skilled in the art to which the present application belongs. The terms "first", "second" and similar words used in the present application do not represent any order, number or importance, but are only used to distinguish different components. The terms "include" or "contain" and similar words mean that the elements or objects before the words cover the elements or objects listed after the words and their equivalents, and do not exclude other elements or objects.

[0034] Example 1

[0035] Construction of recombinant strain 1

[0036] The original strain is Bacillus subtilis 168, and the following steps are sequentially performed:

[0037] The whole genome of rose leaf is extracted by using Easy Extraction Plant Genomic DNA Rapid Extraction Kit, and the whole genome of Bacillus subtilis is extracted by using Tian Gen Bacterial Whole Genomic Extraction Kit, and is stored in a-4℃ refrigerator.

[0038] 2. The first primer set is designed with the phenylacetaldehyde synthase gene (shown in SEQ ID No: 1) of rose and the YjiC gene (shown in SEQ ID No: 3) of Bacillus subtilis as the target genes, and the first primer set is designed as follows:

[0039] Primer-F 5'-CGGGGTACCATGGGTAGCTTCCCATTCC 3'(SEQ ID No: 4)

[0040] Primer-R 5'-CCCCTCCTCAATACGTGCTGAGGATGG 3'(SEQ ID No: 5)

[0041] Primer-F 5'-GGAGGGGTGGCAGCACAGACTG 3'(SEQ ID No: 6)

[0042] Primer-R 5'-CGG GAATTC TTATAATGTAATGTGTTTTTCGTTGGC 3'(SEQ ID No: 7)

[0043] The genomic DNA of rose leaves and Bacillus subtilis was used as a template for PCR amplification with Taq DNA polymerase, and the target fragments were about 1527 bp and 279 bp, respectively. Then the obtained target fragments were fused by Taq DNA polymerase.

[0044] The E. coli was inoculated in liquid LB medium containing 50 μg / μL ampicillin and incubated in a 37 °C constant temperature incubator overnight (12-16 h). The plasmid PHY-P43 was extracted by a plasmid extraction kit and stored in a -20 °C refrigerator.

[0045] The expression vector PHY-P43 was digested with Kpnl and EcoRI, and then connected with the fusion fragment digested with primers with Kpnl and EcoRI sites under the action of T4 DNA ligase to form the recombinant vector PHY-PAAS-YjiA.

[0046] 5. The recombinant vector PHY-PAAS-YjiA was transformed into Bacillus subtilis by Sipizizen transformation method, and the transformants were screened by 25 μg / μL tetracycline resistance. After successful verification by bacterial liquid PCR, the recombinant strain 1 for producing tyrosol and salidroside was obtained.

[0047] Example 2

[0048] Construction of recombinant strain 2

[0049] The Bacillus subtilis was used as the original strain, and the following steps were performed in sequence:

[0050] The whole genome of parsley leaves was extracted by Easy Extraction Plant Genomic DNA Rapid Extraction Kit, and the whole genome of Bacillus subtilis was extracted by Tian Gen Bacterial Genomic DNA Extraction Kit, and stored in a -4 °C refrigerator.

[0051] 2. The second primer set was designed with the tyrosine decarboxylase gene of parsley (shown in SEQ ID No: 2) and the YjiA gene of Bacillus subtilis (shown in SEQ ID No: 3) as the target genes, and the second primer set was designed as follows:

[0052] Primer-F 5'-CGGGGTACCAAAATGGGGTCAATAGATAATCTGAC 3'(SEQ ID No: 8)

[0053] Primer-R 5'-CTGCCACCCCTCCCACACAATTAAAAAATCGATATATATAACAAT 3'(SEQ ID No: 9)

[0054] Primer-F 5'-GGAGGGGTGGCAGCACAGACTG 3'(SEQ ID No: 10)

[0055] Primer-R 5'-CGG GAATTC TTATAATGTAATGTGTTTTTCGTTGGCG 3'(SEQ ID No: 11)

[0056] The Taq DNA polymerase was used for PCR amplification with the parsley leaf and the whole genome DNA of Bacillus subtilis as the templates, and the target fragments were about 1671 bp and 279 bp. Then, the obtained target fragments were fused by Taq DNA polymerase.

[0057] 3. The E. coli was inoculated in the liquid LB medium containing 50 μg / μL ampicillin, and was placed in a 37°C constant temperature incubator for overnight (12-16 h) culture. The plasmid PHY-P43 was extracted by a plasmid extraction kit and was stored in a -20°C refrigerator.

[0058] 4. The expression vector PHY-P43 was cut by KpnI and EcoRI, and was connected to the fusion fragment cut by the primer with KpnI and EcoRI enzyme sites under the action of T4 DNA ligase to form the recombinant vector PHY-TryDC2-YjiA.

[0059] 5. The obtained recombinant vector PHY-TryDC2-YjiA was transformed into Bacillus subtilis by the Sipizizen transformation method, and the transformants were screened by 25 μg / μL tetracycline resistance. After the successful verification by the bacterial liquid PCR, the recombinant strain 2 was obtained.

[0060] Fermentation of recombinant strain 1 for synthesizing tyrosol and salidroside

[0061] The single colony of the recombinant strain 1 was picked from the slant medium and inoculated into 50 mL of LB seed medium for culture at 37°C with constant shaking at 220 r / min for 12 h. The seed liquid of the original strain and the recombinant strain 1 was inoculated into the fermentation medium at an inoculation amount of 2%-3%. The composition of the shake flask fermentation medium was as follows: glucose 25 g / L, NaCl 10 g / L, peptone 10 g / L, yeast extract 5 g / L, trace elements 2 mL / L, tetracycline 25 μg / μL, pH 7.0-7.2, 50 mL of liquid was filled in a 500 mL triangular flask, the rotation speed of the incubator was 200 r / min, and the culture was carried out at 37°C for 72 h. The fermentation broth 0 and 1 of the original strain and the recombinant strain 1 was obtained.

[0062] Fermentation of the recombinant strain 2 for synthesizing tyrosol and salidroside

[0063] The single colony of the recombinant strain 2 was picked from the slant medium and inoculated into 50 mL of LB seed medium for culture at 37°C with constant shaking at 220 r / min for 12 h. The seed liquid of the original strain and the recombinant strain 2 was inoculated into 50 mL of the fermentation medium in a 250 mL conical flask at an inoculation amount of 2%-3%. The composition of the shake flask fermentation medium was as follows: glucose 25 g / L, NaCl 10 g / L, peptone 10 g / L, yeast extract 5 g / L, trace elements 2 mL / L, tetracycline 25 μg / μL, pH 7.0-7.2, 50 mL of liquid was filled in a 250 mL triangular flask, the rotation speed of the incubator was 200 r / min, and the culture was carried out at 30°C for 72 h. The fermentation broth 0 and 2 of the original strain and the recombinant strain 2 was obtained.

[0064] Detection method of tyrosol and salidroside:

[0065] The HPLC-UV system (Shimadzu) was used to detect the tyrosol and salidroside in the supernatant of the fermentation broth. After the fermentation was completed, the fermentation broth and the bacterial cells were separated by centrifugation, 2 mL of the fermentation supernatant was centrifuged at 12000 rpm for 10 min, the supernatant was filtered by a 0.22 μm organic membrane, and then detected by a C18 column (250x4.6 mm, 5 μm). The injection volume was 10 μL, the detection wavelength was 280 nm, the column temperature was 30°C, and the flow rate was 0.5 mL / min. The mobile phase A was 0.1% trifluoroacetic acid, and the mobile phase B was 100% methanol. The liquid phase elution program used gradient elution, as shown in Table 1:

[0066] Table 1: Liquid phase elution program

[0067]

[0068] The production of tyrosol and salidroside in the fermentation broth was detected by HPLC. The original strain fermentation broth 0 was not detected to contain tyrosol and salidroside. The fermentation broth 1 contained 23.07±0.42 mg / L of tyrosol and 36.91±0.29 mg / L of salidroside. The fermentation broth 2 contained 11.18±0.23 mg / L of tyrosol and 47.64±0.34 mg / L of salidroside.

[0069] It should be understood by those of ordinary skill in the art that the above discussion of any of the embodiments is merely exemplary in nature and is not intended to suggest the scope of the application, which is by the appended claims; the technical features between the above embodiments or different embodiments can also be combined, the steps can be implemented in any order, and there are many other changes of the different aspects of the application as described above, which are not provided in details for the sake of brevity. Any omissions, modifications, equivalent replacements, improvements, etc. made within the spirit and principles of the application shall be included in the protection scope of the application.

Claims

1. A method for constructing recombinant Bacillus subtilis, characterized in that, Includes the following steps: S1. Extract the whole genome of parsley and / or rose leaves, and extract the whole genome of Bacillus subtilis; S2. Design the first primer set with parsley tyrosine decarboxylase and Bacillus subtilis YjiA as the target gene, and / or design the second primer set with rose phenylacetaldehyde synthase and Bacillus subtilis YjiA as the target gene, and perform PCR amplification of the target gene fragment using the whole genome of parsley and rose leaves and the whole genome of Bacillus subtilis as templates, respectively. S3. The target gene fragment is ligated to an expression vector to construct a recombinant vector for expressing the activities of tyrosine decarboxylase and YjiA and / or phenylacetaldehyde synthase and YjiA. S4. The recombinant vector was transformed into Bacillus subtilis, and the transformants were screened using the resistance gene to obtain the recombinant Bacillus subtilis strain. The rose phenylacetaldehyde synthase gene has the base sequence shown in SEQ ID No: 1, the parsley tyrosine decarboxylase gene has the base sequence shown in SEQ ID No: 2, the YjiA gene has the base sequence shown in SEQ ID No: 3, the first primer set includes nucleotide sequences shown in SEQ ID No: 4-7, and the second primer set includes nucleotide sequences shown in SEQ ID No: 8-11.

2. The method for constructing recombinant Bacillus subtilis according to claim 1, characterized in that, The expression vector is PHY-P43.

3. The method for constructing recombinant Bacillus subtilis according to claim 1, characterized in that, The conversion method described in S4 is either electro-induced conversion or Sipizizen conversion.

4. A recombinant Bacillus subtilis, characterized in that, It was obtained by the method for constructing recombinant Bacillus subtilis according to any one of claims 1-3.

5. The application of the recombinant Bacillus subtilis according to claim 4 in the fermentation production of tyrosol and rhodioloside.

6. The application according to claim 5, characterized in that, The method for producing tyrosol and rhodioloside by fermentation is to first culture recombinant Bacillus subtilis on an agar slant, then carry out seed culture, and finally carry out fermentation culture to obtain tyrosol and rhodioloside.

7. The application according to claim 6, characterized in that, The temperature for the slant culture was 37°C.

8. The application according to claim 6, characterized in that, In the fermentation culture, the seed liquid after seed culture is inoculated into the fermentation medium at an inoculation rate of 2-3%.

Images