Method for efficiently synthesizing neomycin sulfate by utilizing streptomyces fradiae

Abstract

The invention discloses a method for efficiently synthesizing neomycin sulfate by utilizing streptomyces fradiae, and belongs to the technical field of microorganism application. Specifically, kan E gene and btr H gene of streptomyces fradiae are knocked out, the conversion of neomycin A into kanamycin in a metabolic pathway is reduced, the btr H gene of streptomyces fradiae is knocked out, the conversion of ribostamycin into butyrylglycoside in the metabolic pathway is reduced, metabolic flux is redistributed, and the yield of neomycin sulfate synthesized by streptomyces fradiae is increased. And the fermentation of the neomycin sulfate reaches 29000 U / mL.

Description

Technical Field

[0001] The invention belongs to the technical field of microbial application, and particularly relates to a method for efficiently synthesizing neomycin sulfate by utilizing Streptomyces freundii. Background Art

[0002] Neomycin sulfate is an aminoglycoside antibiotic purified from the product of Streptomyces freundii. Its main mode of action is to bind to the bacterial ribosome 16S rRNA, inhibit protein synthesis by inducing codon misreading and interfering with initiation and translocation, thereby causing bacterial death. Neomycin has a good antibacterial effect on some Gram-positive and Gram-negative bacteria, and can interfere with protein synthesis. It is mainly used in the treatment of respiratory and gastrointestinal bacterial infections in clinical practice. Neomycin can inhibit two factors involved in the initiation of vascular growth, VEGF and FGF, and may be further developed into an anticancer drug. Neomycin also has the effect of fighting AIDS and treating human genetic diseases, and can effectively prevent diseases such as urinary catheter-related urinary tract infections.

[0003] At present, the main problem of synthesizing neomycin sulfate by fermentation of Streptomyces freundii is that the growth is relatively slow and the activity of the bacteria is not high, which has become a problem that needs to be solved. Summary of the invention

[0004] The technical problem to be solved by the present invention is how to provide a method for efficiently synthesizing neomycin sulfate by using Streptomyces freundii, thereby increasing the yield of neomycin sulfate synthesized by Streptomyces freundii.

[0005] The present invention solves the above technical problems through the following technical means:

[0006] The present invention provides a method for efficiently synthesizing neomycin sulfate using Streptomyces freundii, comprising the following steps:

[0007] (1) knocking out the kan E gene and the btr H gene of Streptomyces freundii to obtain a modified Streptomyces freundii;

[0008] (2) Cultivating and fermenting the modified Streptomyces freundii, and purifying the resulting fermentation product to obtain neomycin sulfate.

[0009] (Knock out the kan E gene, reduce the conversion of neomycin A to kanamycin in the metabolic pathway, knock out the btr H gene, reduce the conversion of ribosomycin to butyryl bacteriocin in the metabolic pathway, redistribute the metabolic flow, and thus increase the production of neomycin sulfate synthesized by Streptomyces freundii.)

[0010] Preferably, the Streptomyces flexneri is Streptomyces flexneri CGMCC 4.7387.

[0011] Preferably, the nucleotide sequence of the kan E gene is as shown in SEQ ID NO.1.

[0012] Preferably, the nucleotide sequence of the btr H gene is shown as SEQ ID NO.2.

[0013] Preferably, in step (1), the knockout gene plasmid is transferred into Escherichia coli competent cells, and then transferred into Streptomyces flexneri by a conjugative transfer method, and the transformed Streptomyces flexneri strain is screened out by corresponding antibiotics.

[0014] Preferably, the antibiotics are chloramphenicol and ampicillin.

[0015] Preferably, the components of the culture medium used in the culture include: soy peptone, yeast powder, corn steep liquor and ammonium molybdate.

[0016] Preferably, the fermentation liquid used in the fermentation comprises glucose, peptone and ammonium sulfate.

[0017] Preferably, the specific steps of the purification are: filtering the fermentation product with a microfiltration membrane, concentrating with a nanofiltration membrane, crystallizing in an acetone solvent, filtering to obtain a crude neomycin product, dissolving the crude product with water, salifying with sulfuric acid, decolorizing with activated carbon, fine filtering, and spray drying to obtain a finished neomycin sulfate product.

[0018] Preferably, the obtained neomycin sulfate has an enzyme activity of 29000 U / mL.

[0019] The beneficial effects of the present invention are:

[0020] The present invention provides a method for efficiently synthesizing neomycin sulfate by using Streptomyces freundii. The kan E gene and the btr H gene of Streptomyces freundii CGMCC 4.7387 are knocked out, the kan E gene of Streptomyces freundii is knocked out, the conversion of neomycin A to kanamycin is reduced in the metabolic pathway, the btr H gene of Streptomyces freundii is knocked out, the conversion of ribosomycin to butyryl succinate is reduced in the metabolic pathway, the metabolic flow is redistributed, the yield of neomycin sulfate synthesized by Streptomyces freundii is increased, and the fermentation of neomycin sulfate reaches 29000U / mL, which is suitable for industrial cultivation and production. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 This is a physical picture of the culture of Streptomyces freundii in Example 1 of the present invention. DETAILED DESCRIPTION

[0022] In order to make the purpose, technical solution and advantages of the embodiments of the present invention clearer, the technical solution in the embodiments of the present invention will be clearly and completely described in combination with the embodiments of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0023] Unless otherwise specified, the test materials and reagents used in the following examples can be obtained from commercial sources.

[0024] If no specific techniques or conditions are specified in the examples, they can be carried out according to the techniques or conditions described in the literature in the art or according to the product instructions.

[0025] Streptomyces freundii: CGMCC 4.7387, provided by Xinyu Pharmaceutical Co., Ltd.

[0026] Embodiment 1:

[0027] A method for efficiently synthesizing neomycin sulfate using Streptomyces freundii comprises the following steps:

[0028] (1) Knockout of the kan E gene and btr H gene of Streptomyces freundii:

[0029] The gene mutant strain was constructed by using the strategy of homologous double exchange on the Streptomyces flexneri genome. The upstream and downstream homologous arms of the knockout gene were amplified using the Streptomyces flexneri genome as a template. To ensure the recombination efficiency, the homologous arm length was 1.5-2.0kb. The homologous arms were connected to the restriction sites by cloning methods, and the upstream and downstream homologous arm sequences were sequenced to verify the knockout plasmid. The knockout plasmid was transferred to Escherichia coli competent cells, and then transferred to Streptomyces flexneri by the combination transfer method. The gene mutant strain was screened out by the corresponding antibiotics, and the genome was extracted. The verification primers were designed and verified in the upstream and downstream homologous arms of the knockout gene for PCR verification.

[0030] According to the sequences of kan E gene and btr H gene of Streptomyces freundii, primers were designed and PCR was performed to amplify the long fragment containing the knockout gene and homologous arms on both sides. The Super cos I plasmid was extracted and digested with Eco RI, and then dephosphorylated to prevent the vector from self-ligation, which was convenient for subsequent screening. The purified long fragments of each homologous arm were digested with Eco RI, purified and recovered. A 10 μL connection system of the long fragment and the vector cosmid was established, and the competent Escherichia coli was transformed. After overnight culture, a single colony was picked and inoculated in liquid LB medium, cultured overnight, and the plasmid was extracted to screen and identify the correct Cosmid containing the long fragment. The RED homologous recombination method was used, and the apramycin resistance fragment of p IJ773 was used as the resistance marker of the knockout strain to construct a knockout vector containing the apr resistance gene and homologous arms. According to the sequence of the neomycin biosynthesis gene cluster and p IJ773, long primers were designed, and p IJ773 was used as a template to PCR clone the apr fragment and ori T, which was convenient for the combination transfer method. Transform BW25113 / p IJ790 competent cells with the cosmid containing the long fragment, spread on LB solid plates containing 25μg / mL chloramphenicol and 50μg / mL ampicillin, and culture at 30℃ for 16-20. Pick a single colony and inoculate it into liquid LB medium containing the same antibiotics, culture overnight at 30℃, 220r / min. Transfer it to liquid LB medium containing the same antibiotics and 20mM arabinose at a ratio of 1:100, continue to culture until OD600 is 0.6, and store at -20℃ for use.

[0031] (2) culturing the modified Streptomyces freundii, wherein the components of the culture medium mainly include soy peptone, yeast powder, corn steep liquor and ammonium molybdate (mass ratio 6:3:2:0.1), and then transferring the culture medium to fermentation broth, wherein the components of the fermentation broth include glucose, peptone, ammonium sulfate and water (mass ratio 10:7:0.5:18), and achieving fermentation of Streptomyces freundii by means of sugar supplementation, air dosage control and fermentation broth volume control;

[0032] The fermentation broth is pretreated, filtered with a microfiltration membrane, concentrated with a nanofiltration membrane, crystallized in an acetone solvent, and filtered to obtain a crude neomycin product. The crude product is dissolved in water, salified with sulfuric acid, decolorized with activated carbon, finely filtered, and spray-dried to obtain a finished neomycin sulfate product.

[0033] The enzyme activity of the prepared neomycin sulfate was measured:

[0034] Weigh 0.1544g of the fermentation sample accurately into a 1000mL volumetric flask, dilute to the mark with filtered purified water, and shake well. Accurately measure 1mL into a 25mL brown volumetric flask, add 1mL acetonitrile, add 1mL buffer (0.05mol / L borax solution: 0.2mol / L boric acid solution = 3:7), add 2mL derivatization reagent (8mmol / L 9-chloroformic acid fluorenylmethyl ester), vortex and react for 15min, add 0.2mL glycine (0.1mol / L), vortex for 30s, and terminate the reaction. Take an appropriate amount of this liquid and filter it through a 0.45μm organic membrane, then take 20μL into the HPLC system for determination. The enzyme activity of neomycin sulfate reaches 29000U / mL.

[0035] Embodiment 2:

[0036] The steps of this example are exactly the same as those of Example 1, and the obtained neomycin sulfate enzyme activity reaches 28500 U / mL.

[0037] Embodiment 3:

[0038] The steps of this example are exactly the same as those of Example 1, and the obtained neomycin sulfate enzyme activity reaches 28800 U / mL.

[0039] Embodiment 4:

[0040] The steps of this example are exactly the same as those of Example 1, and the obtained neomycin sulfate enzyme activity reaches 28600 U / mL.

[0041] Comparative Example 1:

[0042] The difference between this comparative example and Example 1 is that the two genes, kan E gene and btr H gene, were not knocked out.

[0043] The yield of neomycin sulfate synthesized by Streptomyces freundii in this comparative example is 10600 U / mL.

[0044] Comparative Example 2:

[0045] The difference between this comparative example and Example 1 is that only the kan E gene is knocked out, but the btr H gene is not knocked out.

[0046] The yield of neomycin sulfate synthesized by Streptomyces freundii in this comparative example was 11550 U / mL.

[0047] Comparative Example 3:

[0048] The difference between this comparative example and Example 1 is that only the btr H gene is knocked out, but the kan E gene is not knocked out.

[0049] The yield of neomycin sulfate synthesized by Streptomyces freundii in this comparative example was 12417 U / mL.

[0050] The sequence of the Streptomyces freundii kan E gene is as follows: (SEQ ID NO.1)

[0051]

[0052] The btrH gene sequence of Streptomyces fradiae is as follows: (SEQ ID NO.2)

[0053] ATGTGCCTCACTCGTTATGACGAGAAATTTTTCGATTGCAGAAAATCGCAGATAATCGCTTATTTGGACTCACAACAGGTCCCCGTCATTCCTCTATTTTATAACAGTTATCAAAGCACAGCGGAAATTTACCGCCAGATCTTTATCGAAAATAAGAGCAAATGGAAGTATTCAGAGCCTTCTTTTTCCGACGATGATTTACTAAGAAAAGGAATTAGGCCTGTTCGGGCTTCTTTTCCCGACTTCAGCCAGGCTTCGGATTGTTTAAAGGATCTGCTGGCCCGGCATAAACTCGTTTTCGTATGGGGGGACGAGTATTGTCTGCCTTACCGGAAGGAAGCCTTCCAGGCCATTCATTCCACTCATTCGCTTGTTGTCACGGGCTATGACGGTGAGAACAAGGCATACTACGTGGAAGATTGGGACGGGCTCTACGGATATTTGCCGGCTGTACATTTGGAAGCGGCTTTCGACAGTCTGTCCAGGCAGATGAGGACATTGTTGGTTCTGGAACTGAACGACGAGGAAATGCGGGAAAACAAACAAGAGGATACAGATTTGTTCCGGAAGTGGCTGCAAGCCTTCGAGGACGACTATATCTTCTACGACCGGGTGCTGCTGGATATGCGCGATTATGAGGAAAACCGGCTGATCTCGATGGATCACGGACTTCGTTTAATCGCCGCATCCCGGCATGTTTTCTCCAAGTTTCTTCATTATATAGATGACGCCCCGGAGGAGGTCGGCCTCCTTATCCGCAACCATCAACTCGCTAACCATATCGCGGCCATCGTCAGGCGGTACATTATCGCCAAACAGATTGATTGGGACGGGGCAGCTTGCAAGATTCGGCAATTAAGAGAGCAAGAGGATGACTTTATGCGGAAGCTAAAGAGCCGTTACGGCTAA

[0054] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that the technical solutions described in the aforementioned embodiments may still be modified, or some of the technical features may be replaced by equivalents. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A method for efficiently synthesizing neomycin sulfate using Streptomyces freundii, characterized in that: The following steps are involved: (1) knocking out the kan E gene and the btr H gene of Streptomyces freundii to obtain a modified Streptomyces freundii; (2) Cultivating and fermenting the modified Streptomyces freundii, and purifying the resulting fermentation product to obtain neomycin sulfate.

2. The method for efficiently synthesizing neomycin sulfate using Streptomyces freundii according to claim 1, characterized in that: The Streptomyces flexneri is Streptomyces flexneri CGMCC 4.7387.

3. The method for efficiently synthesizing neomycin sulfate using Streptomyces freundii according to claim 1, characterized in that: The nucleotide sequence of the kan E gene is shown in SEQ ID NO.

1.

4. The method for efficiently synthesizing neomycin sulfate using Streptomyces freundii according to claim 1, characterized in that: The nucleotide sequence of the btr H gene is shown in SEQ ID NO.

2.

5. The method for efficiently synthesizing neomycin sulfate using Streptomyces freundii according to claim 1, characterized in that: In step (1), the knockout gene plasmid is transferred into competent Escherichia coli cells, and then transferred into Streptomyces flexneri by a conjugative transfer method, and the transformed Streptomyces flexneri strain is selected by using corresponding antibiotics.

6. The method for efficiently synthesizing neomycin sulfate using Streptomyces freundii according to claim 5, characterized in that: The antibiotics are chloramphenicol and ampicillin.

7. The method for efficiently synthesizing neomycin sulfate using Streptomyces freundii according to claim 1, characterized in that: The culture medium used in the culture comprises: soybean peptone, yeast powder, corn steep liquor and ammonium molybdate.

8. The method for efficiently synthesizing neomycin sulfate using Streptomyces freundii according to claim 1, characterized in that: The fermentation liquid used in the fermentation comprises glucose, peptone and ammonium sulfate.

9. The method for efficiently synthesizing neomycin sulfate using Streptomyces freundii according to claim 1, characterized in that: The specific steps of the purification are: filtering the fermentation product with a microfiltration membrane, concentrating with a nanofiltration membrane, crystallizing in an acetone solvent, filtering to obtain a crude neomycin product, dissolving the crude product with water, salifying with sulfuric acid, decolorizing with activated carbon, fine filtering, and spray drying to obtain a finished neomycin sulfate product.

10. The method for efficiently synthesizing neomycin sulfate using Streptomyces freundii according to claim 1, characterized in that: The obtained neomycin sulfate enzyme activity reached 29000U / mL.

Images