Heterologous expression of recombinant human lactoferrin in yeast and preparation method of recombinant human lactoferrin

Abstract

The invention discloses heterologous expression of recombinant human lactoferrin in yeast and a preparation method of the recombinant human lactoferrin, and relates to the technical field of biology. According to the invention, an HLF gene is taken as a template, codon optimization is carried out according to codon preference of pichia pastoris, the optimized gene is cloned to a pPICZ alpha A vector, a hybrid signal peptide coding sequence OST-pro-alpha factor or SUC-pro-alpha factor is adopted to replace a coding sequence of alpha-factor signal peptide, a recombinant expression vector is constructed, the recombinant expression vector is transformed into pichia pastoris X-33 through electric shock, and the recombinant pichia pastoris X-33 is obtained. The recombinant yeast engineering bacteria are obtained. The BLF protein expression condition is analyzed by combining chromatographic column purification with SDS-PAGE (sodium dodecyl sulfate polyacrylamide gel electrophoresis), the result shows that soluble high-efficiency expression of HLF in recombinant yeast engineering bacteria is realized, the fermentation yield reaches 1200mg / L, the molecular weight is about 80kDa, and the molecular weight is consistent with the theoretical molecular weight.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to heterologous expression of recombinant human lactoferrin in yeast and a preparation method thereof. Background Art

[0002] Human lactoferrin (HLF) is an iron-binding protein with a molecular weight of about 80 kDa, belonging to the transferrin family. HLF is present in high levels in human milk, with the content of HIF in human colostrum reaching 7 mg / mL, and the concentration in human normal milk also reaching 1 mg / mL. HLF contains 691 amino acids, and each lactoferrin molecule contains two homologous domains, one at the N-terminus and the other at the C-terminus. Each domain contains two subdomains, which form a gap, and the Fe 3+ The ion is bound to two carboxyl groups, and these subdomains are called N1, N2, C1, and C2. In its natural state, bovine lactoferrin has only 15-20% iron saturation and is pink in color. The depth of color depends on the iron saturation state. Lactoferrin with less than 5% iron saturation is usually called apolactoferrin, while iron-saturated lactoferrin is usually called hololactoferrin. Lactoferrin in human milk is mainly apolactoferrin.

[0003] Lactoferrin is mainly found in organs with dense exocrine glands, such as the digestive tract, respiratory tract, and reproductive system. It also exists in the blood. Lactoferrin is also found in neutrophils. In the inflamed area, the synthesis and release of stored lactoferrin will be accelerated. Lactoferrin is a multifunctional protein that can not only promote the absorption of iron ions, but also has antibacterial, antiviral, antioxidant, and anti-tumor functions, and has the function of regulating the body's immunity. Therefore, lactoferrin has broad application prospects in the food, feed additives, cosmetics, and pharmaceutical industries.

[0004] For decades, researchers have been looking for the most convenient method to produce lactoferrin. Currently, lactoferrin is mainly obtained by purification from milk or colostrum. However, the content of lactoferrin in milk is extremely low, resulting in low lactoferrin production and high prices. Therefore, more and more researchers have begun to pay attention to heterologous expression of human lactoferrin in bacterial, fungal and animal expression systems. The Escherichia coli expression system lacks a glycosylation modification mechanism, resulting in the inability to produce biologically active lactoferrin. Although mammalian cells and plant cells can undergo appropriate glycosylation modification, it is difficult to achieve large-scale production due to the long cell growth cycle and complex culture.

[0005] The Pichia pastoris expression system has certain advantages over other expression systems in heterologous expression of some difficult-to-express proteins. First of all, the methanol metabolism strong promoter AOX1 commonly used in Pichia pastoris is one of the most effective promoters among the known promoters. Under methanol induction conditions, the expression of many proteins can reach the g / L level. Secondly, Pichia pastoris not only has the advantages of easy operation, low cost, and low requirements for culture conditions of the prokaryotic expression system, but also has post-translational folding modification, processing, glycosylation and other functions that the prokaryotic expression system does not have, which is more conducive to the functional expression of foreign proteins. Moreover, when the Pichia pastoris expression system expresses foreign proteins, the genes of foreign proteins are integrated into the yeast genome, and the stability is much higher than that of the prokaryotic expression system. When Pichia pastoris is well ventilated, the dry weight of the bacteria can reach 100g / L, and the growth rate is very fast. It is suitable for high-density culture and can be used for large-scale industrial production to generate higher economic benefits at low cost. Human lactoferrin is a product encoded by eukaryotic genes and requires folding modification and glycosylation after translation, so the Pichia pastoris expression system is our ideal choice for heterologous expression of human lactoferrin. The present invention intends to develop a recombinant engineered bacterium to achieve heterologous soluble and efficient expression of human lactoferrin in Pichia pastoris. Summary of the invention

[0006] The purpose of the present invention is to provide heterologous expression of recombinant human lactoferrin in yeast and a preparation method thereof, so as to solve the problems existing in the above-mentioned prior art. The present invention realizes soluble and efficient expression of recombinant human lactoferrin by constructing a recombinant yeast engineering bacterium, and the fermentation yield reaches 1200 mg / L.

[0007] To achieve the above object, the present invention provides the following solutions:

[0008] The present invention provides a method for constructing a recombinant yeast engineering bacterium OH that soluble expresses recombinant human lactoferrin, comprising the steps of transforming a recombinant expression vector OST-pro-αf-pPICZαA-HLF into a yeast host cell to prepare the recombinant yeast engineering bacterium OH;

[0009] The construction method of the recombinant expression vector OST-pro-αf-pPICZαA-HLF comprises: cloning the HLF gene into the expression vector pPICZαA to obtain the recombinant expression vector pPICZαA-HLF;

[0010] Replacing the coding gene of the α-factor signal peptide in the recombinant expression vector pPICZαA-HLF with the coding gene of OST-pro-αfactor to obtain the recombinant expression vector OST-pro-αf-pPICZαA-HLF;

[0011] The nucleotide sequence of the HLF gene is shown in SEQ ID NO.1;

[0012] The nucleotide sequence of the gene encoding the α-factor signal peptide is shown in SEQ ID NO.2;

[0013] The nucleotide sequence of the gene encoding the OST-pro-αfactor is shown in SEQ ID NO.7;

[0014] Furthermore, the yeast host cell is Pichia pastoris X-33.

[0015] The present invention also provides a recombinant yeast engineering bacterium OH for soluble expression of recombinant human lactoferrin, which is constructed according to the above construction method.

[0016] Furthermore, the recombinant yeast engineered bacteria OH is Pichia pastoris (Komagataellaphaffii) OH10, which was deposited in the General Microbiology Center of China Microorganism Culture Collection Administration on November 7, 2024, with the deposit address at No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, and the deposit number is CGMCC No.32533.

[0017] The present invention also provides a method for constructing a recombinant yeast engineering bacterium SH that solublely expresses recombinant human lactoferrin, comprising the steps of transforming the recombinant expression vector SUC-pro-αf-pPICZαA-HLF into a yeast host cell to prepare the recombinant yeast engineering bacterium SH;

[0018] The construction method of the recombinant expression vector SUC-pro-αf-pPICZαA-HLF comprises: cloning the HLF gene into the expression vector pPICZαA to obtain the recombinant expression vector pPICZαA-HLF;

[0019] The coding gene of the α-factor signal peptide in the recombinant expression vector pPICZαA-HLF is replaced with the coding gene of SUC-pro-αfactor to obtain the recombinant expression vector SUC-pro-αf-pPICZαA-HLF;

[0020] The nucleotide sequence of the HLF gene is shown in SEQ ID NO.1;

[0021] The nucleotide sequence of the gene encoding the α-factor signal peptide is shown in SEQ ID NO.2;

[0022] The nucleotide sequence of the gene encoding the OST-pro-αfactor is shown in SEQ ID NO.8.

[0023] Furthermore, the yeast host cell is Pichia pastoris X-33.

[0024] The present invention also provides a recombinant yeast engineering bacterium SH for soluble expression of recombinant human lactoferrin, which is constructed according to the above construction method.

[0025] The present invention also provides the use of the above-mentioned recombinant yeast engineering bacteria OH or recombinant yeast engineering bacteria SH in soluble expression of recombinant human lactoferrin.

[0026] The present invention also provides a method for preparing recombinant human lactoferrin by soluble expression, comprising the steps of fermenting and culturing the above-mentioned recombinant yeast engineered bacteria OH or recombinant yeast engineered bacteria SH to obtain bacterial cells, and lysing and purifying the bacterial cells to obtain the recombinant human lactoferrin.

[0027] The present invention also provides recombinant human lactoferrin prepared according to the above method.

[0028] The present invention discloses the following technical effects:

[0029] The present invention uses the HLF gene as a template, performs codon optimization according to the codon preference of Pichia pastoris, clones the optimized gene into the pPICZαA vector, replaces the N region presequence of the α-factor signal peptide with the OST signal peptide or the SUC signal peptide, constructs a recombinant expression vector pPICZαA-HLF, and transforms it into Komagataellaphaffii X-33 by electroporation to obtain a recombinant yeast engineering bacterium. The expression of the BLF protein is analyzed by chromatographic column purification combined with SDS-PAGE, and the results show that HLF achieves soluble and efficient expression in the recombinant yeast engineering bacterium, and the fermentation yield reaches 1200 mg / L, and the molecular weight is about 80 kDa, which is consistent with its theoretical molecular weight. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0031] Figure 1 The results of SDS-PAGE detection of secretory protein expression in supernatants of different fermentation broths after 96 hours of fermentation;

[0032] Figure 2 This is the result of SDS-PAGE detection of intracellular protein expression in yeast cells after 96 hours of fermentation;

[0033] Figure 3 This is the result of SDS-PAGE detection of purified protein. DETAILED DESCRIPTION

[0034] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0035] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0036] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0037] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to the skilled artisan. The present invention description and examples are exemplary only.

[0038] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0039] The sequence information and culture medium formula involved in the present invention are as follows:

[0040] SEQ ID NO.1:

[0041]

[0042] α-factor signal peptide sequence (SEQ ID NO.2):

[0043] ATGAGATTTCCTTCAATTTTTACTGCTGTTTTATTCGCAGCATCCTCCGCATTAGCTGCTCCAGTCAACACTACAACAGAAGATGAAACGGCACAAATTCCGGCTGAAGCTGTCATCGGTTACTCAGATTTAGA AGGGGATTTCGATGTTGCTGTTTTGCCATTTTCCAACAGCACAAATAACGGGTTATTGTTTATAAATACTACTATTGCCAGCATTGCTGCTAAAGAAGAAGGGGTATCTCTCGAGAAAAGAGAGGCTGAAGCT.

[0044] α-factor signal peptide sequence N-region, i.e., the sequence of the presequence (SEQ ID NO.3):

[0045] ATGAGATTTCCTTCAATTTTTACTGCTGTTTTATTCGCAGCATCCTCCGCATTAGCT.

[0046] The C-region of the α-factor signal peptide sequence, i.e., the sequence of the pro region (SEQ ID NO.4):

[0047] GCTCCAGTCAACACTACAACAGAAGATGAAACGGCACAAATTCCGGCTGAAGCTGTCATCGGTTACTCAGATTTAGAAGGGGATTTCGATGTTGCTGTTTTGCCATTTTCCAACAGCACAAATAACGGGTTATTGTTTATAAATACTACTATTGCCAGCATTGCTGCTAAAGAAGAAGGGGTATCTCTCGAGAAAAGAGAGGCTGAAGCT.

[0048] The coding sequence of OST signal peptide (SEQ ID NO.5) is:

[0049] ATGAGGCAGGTTTGGTTCTCTTGGATTGTGGGATTGTTCCTATGTTTTTTCAACGTGT CTTCTGCT.

[0050] The coding sequence of the SUC signal peptide (SEQ ID NO.6) is:

[0051] ATGCTTTTGCAAGCTTTCCTTTTCCTTTGGCTGGTTTTGCAGCCAAAATATCTGCA.

[0052] The sequence of OST-pro-αfactor (SEQ ID NO.7) is:

[0053] ATGAGGCAGGTTTGGTTCTCTTGGATTGTGGGATTGTTCCTATGTTTTTTCAACGTGTCTTTCTGCT GC TCCAGTCAACACTACAACAGAAGATGAAACGGCACAAATTCCGGCTGAAGCTGTCATCGGTTACTCAGATTTAGAA GGGGATTTCGATGTTGCTGTTTTGCCATTTTCCAACAGCACAAATAACGGGTTATTGTTTATAAATACTACTATTG CCAGCATTGCTGCTAAAGAAGAAGGGGTATCTCTCGAGAAAAGAGAGGCTGAAGCT , where the underlined sequence is the proregion sequence.

[0054] The sequence of SUC-pro-αfactor (SEQ ID NO.8) is:

[0055] ATGCTTTTGCAAGCTTTCCTTTTCCTTTGGCTGGTTTTGCAGCCAAAATATCTGCA GCTCCAGTCAA CACTACAACAGAAGATGAAACGGCACAAATTCCGGCTGAAGCTGTCATCGGTTACTCAGATTTAGAAGGGGATTTC GATGTTGCTGTTTTGCCATTTTCCAACAGCACAAATAACGGGTTATTGTTTATAAATACTACTATTGCCAGCATTG CTGCTAAAGAAGAAGGGGTATCTCTCGAGAAAAGAGAGGCTGAAGCT , where the underlined sequence is the pro region.

[0056] BMGY medium: 1% yeast extract, 2% tryptone, 100 mM potassium phosphate buffer (pH 6.0), 1.34% YNB (Yeast Nitrogen Base without amino acids), 0.004% biotin and 1% glycerol.

[0057] BMMY medium: 1% yeast extract, 2% tryptone, 100 mM potassium phosphate buffer (pH 6.0), 1.34% YNB (Yeast Nitrogen Base without amino acids), 0.004% biotin and 0.5% methanol.

[0058] YPD liquid medium: 1% yeast extract, 2% tryptone and 2% glucose.

[0059] YPD-Zeocin solid medium: 1% yeast extract, 2% tryptone, 2% glucose, 100 μg / mL Zeocin and 2% agar powder.

[0060] Protein concentration was determined by A280.

[0061] Example 1 Construction of human lactoferrin HLF gene expression vector

[0062] According to the codon preference of Pichia pastoris, codon optimization was performed to obtain the coding gene HLF of human lactoferrin, the nucleotide sequence of which is shown in SEQ ID NO.1. The gene was fully synthesized by Bio-Pharmaceuticals. The synthesized HLF gene was cloned into the expression vector pPICZαA to obtain the recombinant expression vector pPICZαA-HLF.

[0063] Based on the successfully constructed recombinant expression vector pPICZαA-HLF, the α-factor signal peptide was replaced with the hybrid signal peptide coding sequences OST-pro-αfactor and SUC-pro-αfactor, respectively. The replacement process was entrusted to a biological company. The resulting recombinant vectors were named: OST-pro-αf-pPICZαA-HLF and SUC-pro-αf-pPICZαA-HLF.

[0064] Example 2 Construction of recombinant Pichia pastoris system

[0065] The specific steps are as follows:

[0066] (1) The recombinant expression vectors OST-pro-αf-pPICZαA-HLF and SUC-pro-αf-pPICZαA-HLF prepared in Example 1 were linearized using restriction endonuclease Pme I, and the linearized system was 200 μL (20 μg of recombinant vector, 20 μL of 10× buffer, 2 μL of Pme I, and the volume was made up to 200 μL with ultrapure water), and the enzyme was digested overnight at 37° C. DNA was precipitated with ethanol and sodium acetate, dissolved with 10 μL of ddH2O, and stored at -20° C. for later use.

[0067] (2) Prepare competent cells of Komagataella phaffii X-33 according to the Pichia Pastoris Expression Operation Manual of Invitrogen. The linearized recombinant expression vectors OST-pro-αf-pPICZαA-HLF and SUC-pro-αf-pPICZαA-HLF were electroporated into competent cells of Komagataella phaffii X-33, respectively.

[0068] The electroporation process is as follows: Take 80 μL of competent cells and 10 μL of linearized recombinant plasmid DNA, mix them evenly, and transfer them to a 0.2 cm electroporation cup that has been ice-bathed at -20°C, and ice-bath the electroporation cup containing the mixture for 5 minutes. Adjust the parameters of the electroporation instrument, set it to the Pichia yeast file, voltage 1.5 kV, capacitance 25 microfarads, resistance 200 ohms, and time is about 5 milliseconds. After the electric shock, quickly add 1 mL of ice-precooled 1M sorbitol solution to the transformation cup, gently pipette and mix, and transfer the mixture to a centrifuge tube. Incubate at 30°C for 1 hour, and centrifuge at 3000 rpm for 5 minutes. Discard 800 μL of supernatant, blow the remaining bacteria evenly, spread them on the YPD-Zeocin plate, and culture at 30°C for 2-4 days until larger colonies grow on the plate.

[0069] (3) Pick multiple single clones from the YPD-Zeocin plate and inoculate them into YPD liquid medium for overnight culture. Take 50 μL of the overnight culture, centrifuge, and discard the supernatant. Add 0.2% SDS to each tube, vortex for 15 seconds, and heat at 90°C for 4 minutes. Centrifuge at the maximum speed of a desktop centrifuge for 1 minute, and take the supernatant as yeast genomic DNA. Use AOX1 primers for PCR to identify whether OST-pro-αf-pPICZαA-HLF or SUC-pro-αf-pPICZαA-HLF has been integrated into the yeast genome.

[0070] The AOX1 primer sequences are as follows:

[0071] Upstream primer: GACTGGTTCCAATTGACAAGC (SEQ ID NO. 9);

[0072] Downstream primer: GCAAATGGCATTCTGACATCC (SEQ ID NO. 10).

[0073] The PCR reaction system is shown in Table 1:

[0074] Table 1 PCR reaction system

[0075] Reagents Addition amount Genomic DNA 1μL 2 × PhantaMaxMasterMix 12.5μL Upstream primer (10 μM) 1μL Downstream primer (10 μM) 1μL Sterile water 9.5μL

[0076] PCR reaction conditions: 94°C, 2 min; 94°C, 30 s, 55°C, 20 s, 72°C, 1 min, 30 cycles; 72°C, 1 min.

[0077] The clones with positive PCR identification results were OST-pro-αf-pPICZαA-HLF or SUC-pro-αf-pPICZαA-HLF positive transformants, that is, recombinant Pichia pastoris Pichia pastoris X-33 / OST-pro-αf-pPICZαA-HLF or Pichia pastoris X-33 / SUC-pro-αf-pPICZαA-HLF were obtained. Pichia pastoris X-33X-33 / OST-pro-αf-pPICZαA-HLF was abbreviated as OH, and the 7 selected positive transformants were named OH1-OH7. Pichia pastoris X-33 / SUC-pro-αf-pPICZαA-HLF was abbreviated as SH, and the 7 selected positive transformants were named SH1-SH7.

[0078] Strain preservation:

[0079] The positive transformant OH7 was renamed Pichia pastoris (Komagataellaphaffii) OH10 and deposited in the General Microbiology Center of China Microorganism Culture Collection (CGMCC) on November 7, 2024. The deposit address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, and the deposit number is CGMCC No.32533.

[0080] Example 3 Expression of recombinant Pichia yeast

[0081] (1) The positive transformants OH1-OH7 and SH1-SH7 identified in Example 2 were inoculated into 50 mL centrifuge tubes containing 3 mL YPD liquid culture medium, respectively, and cultured at 30° C., 220 rpm overnight.

[0082] (2) The next day, 1 mL of the bacterial solution from step (1) was transferred to a 250 mL conical flask containing 25 mL of BMGY medium and cultured at 30°C and 220 rpm until OD 600 is 5.0. Collect the bacteria by centrifugation at 3000rpm for 5 minutes, and wash them three times with sterile water to remove residual glycerol. This is the seed solution.

[0083] (3) The seed solution obtained in step (2) was resuspended in 25 mL of BMMY medium, transferred into a 250 mL conical flask, and cultured at 20° C. and 220 rpm for 96 h. 0.5% methanol was added every 24 h to allow the induction to continue.

[0084] (4) The fermentation supernatant and the cultured OH1-OH7 and SH1-SH7 cells were collected after the culture was completed, and the expression of proteins in the fermentation supernatant and the cells after 96 hours of fermentation were detected by SDS-PAGE. The results are as follows: Figure 1-2As shown, the target band of HLF is located at 80 kDa.

[0085] The results show:

[0086] like Figure 1 As shown, the fermentation supernatants of strains OH2, OH3, OH4, OH5 and OH6 had only a faint band at 80 kDa, while the fermentation supernatants of OH1 and OH7 had no band. The fermentation supernatants of strains SH1-SH7 had no band at 80 kDa.

[0087] like Figure 2 As shown, all strains, including OH1-OH7 and SH1-SH7, had clear bands at 80 kDa in the supernatant of their bacterial cells, indicating that HLF was solublely expressed in whole yeast cells.

[0088] Example 4 Purification of target protein

[0089] The target protein was purified by centrifugation, ion exchange and molecular sieve.

[0090] The specific implementation steps are as follows:

[0091] (1) The OH7 and SH7 fermentation broths prepared in Example 3 were centrifuged at 8000 rpm for 10 min and the supernatant was discarded.

[0092] (2) Resuspend the cells in buffer A (25 mM Tris pH 7.5, 100 mM NaCl) and lyse the cells. Centrifuge at 12,000 rpm for 30 min and collect the supernatant.

[0093] (3) Purification was performed using an FPLC protein chromatography system. The specific process was as follows: The Q FF anion exchange column was rinsed with 5CV ultrapure water, 5CV buffer B (25mM Tris pH7.5, 1M NaCl), and buffer A (25mM Tris pH7.5, 100mM NaCl) at a flow rate of 5mL / min. The peristaltic pump loaded the sample (diluted fermentation broth) onto the equilibrated Q FF column at a flow rate of 1.6mL / min, and the flow-through was collected. The Q FF column was connected to the FPLC system, and the protein was linearly eluted (0-1M NaCl in25mM Tris pH7.5). The protein was detected by SDS-PAGE, and the elution peak was collected. Dialysis (25mM Tris pH7.5, 100mM NaCl).

[0094] The purification results are as follows Figure 3 As shown, there is a target band at 80 kDa corresponding to the theoretical molecular weight of HLF, and the purified target protein HLF is prepared.

[0095] According to the purification results, the fermentation yields of OH7 and SH7 were 1200 mg / L and 1210 mg / L, respectively.

[0096] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A method for constructing a recombinant yeast engineering bacterium OH that soluble expresses recombinant human lactoferrin, characterized in that: It includes the steps of transforming the recombinant expression vector OST-pro-αf-pPICZαA-HLF into a yeast host cell to prepare the recombinant yeast engineering bacteria OH; The construction method of the recombinant expression vector OST-pro-αf-pPICZαA-HLF comprises: cloning the HLF gene into the expression vector pPICZαA to obtain the recombinant expression vector pPICZαA-HLF; Replacing the coding gene of the α-factor signal peptide in the recombinant expression vector pPICZαA-HLF with the coding gene of OST-pro-αfactor to obtain the recombinant expression vector OST-pro-αf-pPICZαA-HLF; The nucleotide sequence of the HLF gene is shown in SEQ ID NO.1; The nucleotide sequence of the gene encoding the α-factor signal peptide is shown in SEQ ID NO.2; The nucleotide sequence of the gene encoding the OST-pro-αfactor is shown in SEQ ID NO.

7.

2. The construction method according to claim 1, characterized in that: The yeast host cell is Pichia pastoris X-33.

3. A recombinant yeast engineering bacterium OH expressing soluble recombinant human lactoferrin constructed according to the construction method of claim 1 or 2.

4. The recombinant yeast engineering bacterium OH according to claim 3, characterized in that: The recombinant yeast engineered bacteria OH is Pichia pastoris (Komagataellaphaffii) OH10, which was deposited in the General Microbiology Center of China Microorganism Culture Collection Administration on November 7, 2024. The deposit address is No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, and the deposit number is CGMCC No. 32533.

5. A method for constructing a recombinant yeast engineering bacterium SH that soluble expresses recombinant human lactoferrin, characterized in that: It includes the steps of transforming the recombinant expression vector SUC-pro-αf-pPICZαA-HLF into a yeast host cell to prepare the recombinant yeast engineering bacteria SH; The construction method of the recombinant expression vector SUC-pro-αf-pPICZαA-HLF comprises: cloning the HLF gene into the expression vector pPICZαA to obtain the recombinant expression vector pPICZαA-HLF; The coding gene of the α-factor signal peptide in the recombinant expression vector pPICZαA-HLF is replaced with the coding gene of SUC-pro-αfactor to obtain the recombinant expression vector SUC-pro-αf-pPICZαA-HLF; The nucleotide sequence of the HLF gene is shown in SEQ ID NO.1; The nucleotide sequence of the gene encoding the α-factor signal peptide is shown in SEQ ID NO.2; The nucleotide sequence of the gene encoding the OST-pro-αfactor is shown in SEQ ID NO.

8.

6. The construction method according to claim 5, characterized in that: The yeast host cell is Pichia pastoris X-33.

7. A recombinant yeast engineering bacterium SH expressing soluble recombinant human lactoferrin constructed according to the construction method of claim 5 or 6.

8. Use of the recombinant yeast engineering bacterium OH according to claim 3 or 4 or the recombinant yeast engineering bacterium SH according to claim 7 in soluble expression of recombinant human lactoferrin.

9. A method for preparing recombinant human lactoferrin by soluble expression, characterized in that: The method comprises the steps of fermenting the recombinant yeast engineered bacteria OH according to claim 3 or 4 or the recombinant yeast engineered bacteria SH according to claim 7 to obtain bacterial cells, and lysing and purifying the bacterial cells to obtain the recombinant human lactoferrin.

10. A recombinant human lactoferrin prepared according to the method according to claim 9.

Images