Method for improving drought tolerance of rice

Abstract

The invention relates to the technical field of biological breeding, in particular to application of an OsPrx114 gene and / or an OsWRKY50 gene, a method for enhancing tolerance of rice to drought stress, a rice strain and application. Comprising the following steps: cloning and expressing OsPrx114 and / or OsWRKY50 genes, so that the OsPrx114 and / or OsWRKY50 genes are expressed at a high level in rice plants, and are regulated and controlled through a CaMV35S promoter. Through the synergistic effect of the OsPrx114 and the OsWRKY50, the drought tolerance of the rice can be enhanced. The rice strain obtained by the method disclosed by the invention shows excellent drought tolerance under a natural drought condition. The rice yield and quality are expected to be improved, the adverse effect of climate change on grain production is relieved, and a sustainable solution is provided for global grain safety.

Description

Technical Field

[0001] The present invention relates to the technical field of biological breeding, and in particular to the application of OsPrx114 gene and / or OsWRKY50 gene, a method for improving the tolerance of rice to drought stress, and a rice strain and application. Background Art

[0002] As one of the world's major food crops, improving rice yield and quality is crucial to meeting global food demand. However, in recent years, global climate change has led to the frequent occurrence of extreme environmental conditions, including high temperature, drought, and water scarcity, which threaten the growth and development of rice (Li et al., 2017).

[0003] Plants need to maintain a certain level of reactive oxidative species (ROS) under normal growth conditions to support normal physiological functions. However, under drought stress, plant cells usually produce excessive ROS, which can cause cell damage, including damage to lipids and nucleic acids, and even cell death (Tripathy, 2014). To combat this phenomenon, plants have evolved a complex antioxidant system, including antioxidant enzymes and antioxidant molecules. Antioxidant enzymes include superoxide dismutase (SOD), peroxidase (CAT), ascorbate peroxidase (APX), peroxidase (POD), monodehydroascorbate reductase (MDHAR), didehydroascorbate reductase (DHAR), and glutathione reductase (GR), while antioxidant molecules include ascorbic acid (AsA), reduced glutathione (GSH), carotenoids, and flavonoid compounds (Yang et al., 2021). Among them, peroxidases (Prxs) play a key role in scavenging excess ROS, protecting cells from oxidative damage, and alleviating H2O2 toxicity. Prxs are divided into heme Prxs (hemo Prxs) and non-heme Prxs (non-hemo Prxs) according to their protein structure. Plant-specific class III Prxs are encoded by a large number of genes, including 138 genes in rice (Passardi et al., 2004), 119 genes in maize (Wang et al., 2015), and 73 genes in Arabidopsis (Welinder et al., 2002). Class III Prxs play multifunctional roles in multiple aspects of plant growth and development and enhance defense mechanisms against biotic and abiotic stresses by scavenging ROS (Laura D G., 2004; Cosio, 2009; Gabaldon, 2010). For example, in rubber trees, HbPRX24 is involved in responses to biotic (powdery mildew) and abiotic (drought, light, and mechanical damage) stresses (Wang et al., 2016). In milk thistle, two genes (PrxQ and 1-cys-prx) were significantly increased under mild and severe drought stress conditions and were involved in antioxidant defense and redox signaling (ElSayed et al., 2019). CsPRX3, CsPRX27, and CsPRX43 in tea plants were involved in the response to drought stress after hormone (ABA and MeJA) pretreatment (Li et al., 2020). In wheat, TaPRX-2A was upregulated in response to drought, salt, H2O2, and ABA treatments, and overexpression of TaPRX-2A enhanced salt tolerance (Su et al., 2020). In sweet potato, overexpression of IbPRX17 enhanced salt and drought tolerance by positively regulating antioxidant enzyme genes, which was positively regulated by IbBBX24 and IbTOE3 (Zhang et al., 2022).

[0004] The WRKY transcription factor (TF) family plays important roles in plants, especially in responding to biotic and abiotic stresses (Jiang et al., 2017). WRKY TFs exert their biological functions by specifically binding to W-box in the promoters of target genes to regulate the expression of downstream target genes (Rushton et al., 2010). Increasing evidence suggests that WRKY TFs play an important role in plant resistance to drought stress. For example, ZmWRKY40 enhances drought tolerance in Arabidopsis plants by regulating genes related to drought stress and maintaining ROS balance (Wang et al., 2018). OsWRKY97 enhances rice tolerance to drought and osmotic stress by increasing ABA accumulation, reducing water loss, and maintaining ROS balance (Lv et al., 2020). In contrast, overexpression of OsWRKY55 reduces rice drought tolerance because it increases ROS content and positively regulates OsAP2-39, which negatively affects plant growth and drought tolerance (Huang et al., 2021). In Arabidopsis, overexpression of ZmWRKY79 enhances drought tolerance by promoting ABA synthesis and ROS scavenging (Gulzar et al., 2021). In addition, overexpression of TaWRKY1-2D positively regulates antioxidant enzyme genes and interacts with TaDH3 protein, thereby synergistically enhancing drought tolerance in Arabidopsis through the ABA pathway (Yu et al., 2023).

[0005] However, the effects of other members of the WRKY transcription factor family on rice have not been fully studied. Although some members of the WRKY transcription factor family, such as OsWRKY55 and ZmWRKY79, have been studied and their roles in rice drought resistance have been understood, the effects of other members of the WRKY family on rice drought resistance have not been fully studied. Therefore, more comprehensive studies are needed to reveal the functions and relationships of these members. Moreover, there are some contradictory results in previous studies. For example, overexpression of OsWRKY55 increases ROS content and has a negative impact on rice drought resistance, while overexpression of ZmWRKY79 enhances drought resistance. This contradiction shows that the specific role and regulatory mechanism of the WRKY transcription factor family in rice drought resistance have not been fully understood in current research.

[0006] In view of this, the present invention is proposed. Summary of the invention

[0007] The invention proposes the application of OsPrx114 gene and OsWRKY50 gene, and also proposes a method for enhancing the tolerance of rice (Oryza sativa) to drought stress.

[0008] The present invention proposes the use of OsPrx114 gene in regulating rice drought resistance. The sequence of OsPrx114 gene is selected from: the DNA sequence shown in SEQ ID NO: 1; or a DNA sequence at least 90% homologous to SEQ ID NO: 1; or a subfragment functionally equivalent to the sequence shown in SEQ ID NO: 1.

[0009] Optionally, the application of the present invention includes: obtaining a rice mutant with enhanced drought resistance by overexpressing the rice OsPrx114 gene.

[0010] The present invention proposes the use of OsWRKY50 gene in regulating rice drought resistance. The sequence of OsWRKY50 gene is selected from: the DNA sequence shown in SEQ ID NO: 2; or a DNA sequence at least 90% homologous to SEQ ID NO: 2; or a subfragment functionally equivalent to the sequence shown in SEQ ID NO: 2.

[0011] Optionally, the application of the present invention includes: overexpressing the rice OsWRKY50 gene to obtain a rice mutant with enhanced drought resistance.

[0012] Alternatively, the OsWRKY50 gene activates the expression of OsPrx114 by binding to the W-box element in the promoter of the OsPrx114 gene.

[0013] The present invention provides a method for enhancing the tolerance of rice to drought stress, comprising the following steps: cloning and expressing the OsPrx114 gene to achieve a high level of OsPrx114 gene expression in rice plants, wherein the nucleotide sequence of the OsPrx114 gene is as shown above.

[0014] The present invention provides a method for enhancing the tolerance of rice to drought stress, comprising the following steps: cloning and expressing the OsWRKY50 gene to achieve a high level of OsWRKY50 gene expression in rice plants, wherein the nucleotide sequence of the OsWRKY50 gene is as shown above.

[0015] The present invention provides a method for enhancing the tolerance of rice to drought stress, comprising the following steps: cloning and expressing the OsPrx114 gene to achieve a high level of OsPrx114 gene expression in rice plants, cloning and expressing the OsWRKY50 gene to achieve a high level of OsWRKY50 gene expression in rice plants, and simultaneously expressing OsPrx114 and OsWRKY50 in rice plants to enhance the tolerance of rice to drought stress.

[0016] Optionally, the expression of the OsPrx114 gene and the OsWRKY50 gene is regulated by the CaMV35S promoter.

[0017] Optionally, the expression sequence of the OsPrx114 gene is attached with a 3xFLAG tag so as to detect the expression of OsPrx114 at the protein level.

[0018] Alternatively, OsPrx114 and OsWRKY50 act synergistically to reduce ROS accumulation and enhance antioxidant enzyme activities, including peroxidase and catalase, in rice plants under drought stress.

[0019] The present invention also proposes to obtain rice strains by adopting the above method.

[0020] The present invention also proposes the application of the method in improving rice yield and quality, or improving drought resistance.

[0021] The present invention has at least the following technical advantages:

[0022] The present invention explores the WRKY transcription factor family members that have not been studied in detail, and achieves better drought resistance by combining different gene expressions while avoiding negative effects. It can be used to develop more effective drought resistance strategies, thereby improving rice yield and quality and reducing the adverse effects of climate change on food production. It is also expected to improve rice production efficiency and thus have a positive impact on global food security.

[0023] The present invention reveals the close relationship between OsPrx114 and OsWRKY50. By discovering that OsWRKY50, as a transcription factor of OsPrx114, directly regulates the expression of the OsPrx114 gene, the resistance of rice to drought stress is enhanced. The revelation of this association provides important clues for the development of more effective drought resistance strategies, and takes an important step towards improving plant drought resistance at the molecular level.

[0024] The present invention reveals that OsPrx114 and OsWRKY50 overexpressing plants exhibit better antioxidant enzyme activity and lower ROS accumulation in response to drought-induced oxidative stress. This suggests that OsPrx114 and OsWRKY50 are not only regulatory factors that enhance drought resistance, but also provide important assistance for plant survival under drought conditions by optimizing redox balance. This discovery provides new ideas for improving drought resistance strategies for other crops. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 Schematic diagram of OsPrx114 overexpression vector;

[0026] Figure 2Expression analysis results of OsPrx114 overexpressing transgenic lines: a: RT-qPCR analysis; b: Western blot detection; Nip is Nipponbare, #21 and #30 are two 35S-OsPrx114-3xFlag transgenic lines, CBB is Coomassie brilliant blue staining of protein;

[0027] Figure 3 Results of drought resistance experiments of OsPrx114 overexpressing transgenic lines: a: Phenotypes of Nipponbare wild type (Nip) and OsPrx114 overexpressing transgenic lines at different stages of drought treatment; b: Survival rate of each material after rehydration; c: Water loss rate statistics;

[0028] Figure 4 Results of physiological and biochemical determination of OsPrx114 overexpressing transgenic lines: a: DAB staining; b: hydrogen peroxide (H2O2) content; c: peroxidase (POD) activity; d: catalase (CAT) activity; e: proline (Pro) content; f: malondialdehyde (MDA) content;

[0029] Figure 5 Results of OsWRKY50 binding to OsPrx114 promoter: a: Schematic diagram of OsPrx114 promoter, F1 and F2 are two probe sequences containing TTGACC elements, mF1 and mF2 are probe sequences containing TACACC mutation elements; b: Electrophoresis assay (EMSA);

[0030] Figure 6 Results of drought resistance experiments on OsWRKY50 overexpressing transgenic lines: a: phenotypes of wild type (WT) and OsWRKY50 overexpressing transgenic lines at different stages of drought treatment; b: survival rate of each material after rehydration; c: water loss rate statistics. DETAILED DESCRIPTION

[0031] In order to more clearly understand the above-mentioned purposes, features and advantages of the present invention, the scheme of the present invention will be further described below. It should be noted that the embodiments of the present invention and the features in the embodiments can be combined with each other without conflict. In the following description, many specific details are set forth to facilitate a full understanding of the present invention, but the present invention can also be implemented in other ways different from those described herein; obviously, the embodiments in the specification are only part of the embodiments of the present invention, not all of the embodiments.

[0032] The embodiment of the present invention identifies and verifies the drought-induced gene OsPrx114, and proposes the application of the OsPrx114 gene in regulating rice drought resistance. The sequence of the OsPrx114 gene is selected from: a DNA sequence as shown in SEQ ID NO: 1; or a DNA sequence at least 90% homologous to SEQ ID NO: 1; or a subfragment functionally equivalent to the sequence shown in SEQ ID NO: 1. The sequence of the OsPrx114 gene can be further selected from a DNA sequence at least 95% homologous to SEQ ID NO: 1, and can be further selected from a DNA sequence at least 99% homologous to SEQ ID NO: 1. In the embodiment of the present invention, the accumulation of reactive oxygen species (ROS) is reduced by overexpressing the OsPrx114 gene, which is achieved by upregulating the activities of enzymes such as peroxidase (POD) and catalyze (CAT). The present invention demonstrates that the transcription factor OsWRKY50 binds to the W-box (TTGACC) in the OsPrx114 promoter through a series of verifications such as yeast single hybridization and electrophoresis gel retardation assay (EMSA), thereby activating its transcription.

[0033] Specifically, the method for amplifying the OsPrx114 gene can be as follows: download the CDS sequence of the OsPrx114 (Os07g0677500) gene from the RAP-DB (http: / / rapdb.dna.affrc.go.jp / ) database, design PCR specific primers OsPrx114_CDS_F1 (SEQ ID NO: 3) and OsPrx114_CDS_R1 (SEQ ID NO: 4), and use rice Nipponbare leaf cDNA as a template to amplify the coding sequence of the OsPrx114 gene, with a total length of 936 bp.

[0034] The nucleotide sequence of SEQ ID NO: 1 is as follows:

[0035] atggccaaagcaacttgcatttccttgcttgtggtcgtggctctggccaccgcggcgtcggcgcagctgtcggcgacgttctacgacacgtc

[0036] gtgccccagagccatgtccatcatcaagagcgccgtgaccgccgccgtgaacagcgaaccccgcatgggcgcgtcgctgctcaggctgc

[0037] acttccatgactgttttgtccaaggttgtgacgcgtctgttctgttgtcgggaaacgagcaggatgctcctccaaacaaggattctcttagaggct

[0038] acggcgtcatcgacagcatcaaggcgcagatagaggccgtgtgcaatcagaccgtctcatgcgccgacatccttaccgtcgccgcccgtg

[0039] actccgtcgtcgctctgggagggccaacgtggactgtcccgctggggagaagggactctacaggtgcaagcgcggcgctcgcgatcagc

[0040] gacctccctccttttaccgctagcctccaagaactcgtagacgcattcgccaagaagggccttagcgtaaccgacatggttgctctctcaggc

[0041] gcgcacacgatcgggcaggcgcagtgctcaaccttcaggggcaggatctacaacgagaccaacatcgactcggccttcgcgacgcaacg

[0042] ccaggccaactgcccacggacatccggcgacatgaacctggcgccgctggacacgacgacggcgaacgcgttcgacaacgcctactac

[0043] accaacctgctgtcgaacaagggcctcctgcactcggaccaggtgctcttcaacaacggcagcacggacaacacggtgaggaacttcgcg

[0044] tccaacgcggcggagttcagcagcgccttcgcgacggccatggtgaacatggggaacatcgcgcccaagacgggaacaaacggccaga

[0045] tcaggctcagctgctccaaggtgaactcgtaa

[0046] The embodiment of the present invention proposes the use of OsWRKY50 gene in regulating rice drought resistance, and the sequence of OsWRKY50 gene is selected from: a DNA sequence as shown in SEQ ID NO: 2; or a DNA sequence at least 90% homologous to SEQ ID NO: 2; or a subfragment functionally equivalent to the sequence shown in SEQ ID NO: 2. The sequence of OsWRKY50 gene can be further selected from a DNA sequence at least 95% homologous to SEQ ID NO: 2, and further selected from a DNA sequence at least 99% homologous to SEQ ID NO: 2. OsWRKY50 gene plays an active role in regulating OsPrx114-mediated rice drought resistance and reduces the accumulation of ROS in rice.

[0047] Specifically, the method for amplifying the OsWRKY50 gene can be: based on the CDS sequence of OsWRKY50 (Os11g0117600) in the RAP-DB database, PCR specific primers OsWRKY50_CDS_F1 (SEQ ID NO: 5) and OsWRKY50_CDS_R1 (SEQ ID NO: 6) are designed, and the coding sequence of the OsWRKY50 gene is amplified using rice Nipponbare leaf cDNA as a template, with a total length of 990 bp.

[0048] The nucleotide sequence of SEQ ID NO:2 is as follows:

[0049] atggaggaggcctactgcatgatgatggtggggagggagaggggagctcgtggctgagctgcgtcacctcctcttcccttctccgtctcccac

[0050] tccgaccacccctgcgagccactctactacggcgctcgccggcgacggcgagtgctgcttgccgccagggctgacaacgacgacgacg

[0051] gtgtccggtggaggacggcggcgggggaggaagagagtcaaccgcgacaatgataatgtcaagctgcttctgcaggcagatgatgatca

[0052] ggaggccgtaatagctgatcatggcgatgcaaatgccaagcctcttcctaatttcaccaaaacaagaaggaggaagcagcaggcgacgac

[0053] atcaacgatggtaacgacggtgccagatttcgatgggtatcaatggaggaagtatggtcagaagcaaattgaaggtgccttgtaccccagga

[0054] gctactaccggtgcaccaacagcacaaaccagggctgcctcgccaagaagacggtgcagcgcaatggcggcggcggagcagcagggt

[0055] acacggtggcctacatctcagagcatacttgcaagtccatcgaaccatccctgcctccagtcatcctcgacaccaccgtccgtactaccaaca

[0056] accaccagcagcctgcagctgctgaatcaccggcggcgacatcgtcgtcgtcgtcgaatatggtcatgacgagtagcgagactggtaattg

[0057] gagcggtcagcacggcgcctacgcatgccgacagatgatcgccgccgatgaagagtactgctgctgggacactccggcgacgacgacg

[0058] accacctctggctctaatggtggtaacagtacttgtgctgaggatatagaattattgagcaggccgatcaggtcgccgatgcacatcgcggcg

[0059] gaagggaattggatggacgatttgctccttgttatgacggccttatcgttatatccaactccagcatcacccatttcctcacttaa

[0060] The present invention relates to a method and system for enhancing the tolerance of rice (Oryza sativa) to drought stress. The relationship between OsWRKY50 and OsPrx114 was found:

[0061] The present invention provides a method for enhancing the tolerance of rice to drought stress, comprising the following steps: cloning and expressing the OsWRKY50 gene to achieve a high level of OsWRKY50 gene expression in rice plants, i.e., overexpression of the OsWRKY50 gene, wherein the nucleotide sequence of the OsWRKY50 gene is as shown above.

[0062] Specifically, the overexpression of OsWRKY50 includes: enhancing the drought tolerance of rice by overexpressing the OsWRKY50 gene. OsWRKY50 is a transcription factor that enhances drought resistance by activating the transcription of the OsPrx114 gene. Overexpression of OsWRKY50 enables rice to better cope with drought stress and improves its drought tolerance.

[0063] The embodiment of the present invention provides a method for enhancing the tolerance of rice to drought stress, comprising the following steps: cloning and expressing the OsPrx114 gene to achieve a high level of OsPrx114 gene expression in rice plants, cloning and expressing the OsWRKY50 gene to achieve a high level of OsWRKY50 gene expression in rice plants, and simultaneously expressing OsPrx114 and OsWRKY50 in rice plants, wherein the nucleotide sequences of the OsPrx114 gene and the OsWRKY50 gene are as shown above. The embodiment of the present invention provides that there is a direct regulatory relationship between OsWRKY50 and OsPrx114. OsWRKY50 activates the expression of OsPrx114 by binding to the W-box element in the promoter of the OsPrx114 gene. This interaction further enhances the tolerance of rice to drought.

[0064] OsPrx114 and OsWRKY50 fight oxidative stress: OsPrx114 and OsWRKY50 overexpressing plants had lower oxidative stress levels under drought stress. This was determined by measuring the accumulation level of H2O2 and the activities of antioxidant enzymes (POD and CAT). OsPrx114 and OsWRKY50 overexpressing plants showed better antioxidant enzyme activities and lower ROS accumulation in response to drought-induced oxidative stress.

[0065] The embodiments of the present invention provide a method for enhancing the tolerance of rice to drought stress, which is achieved through the regulatory relationship between OsPrx114 and OsWRKY50 and the related anti-oxidative stress mechanism. The application of these technologies is expected to improve the production efficiency of rice, thereby having a positive impact on global food security. The expression of the OsPrx114 gene and the OsWRKY50 gene is regulated by the CaMV35S promoter. The expression sequence of the OsPrx114 gene is attached with a 3xFLAG tag to detect the expression at the protein level. OsPrx114 and OsWRKY50 work synergistically to reduce ROS accumulation in rice plants under drought stress and increase the activity of antioxidant enzymes, including peroxidases and catalytic enzymes.

[0066] The present invention also relates to rice lines obtained by the above method, including cloning and expressing OsPrx114 and / or OsWRKY50 genes, expressing them at high levels in rice plants, and regulating them through CaMV35S promoter to obtain rice lines, which show excellent drought tolerance under natural drought conditions. OsPrx114 and OsWRKY50 can enhance the tolerance of rice to drought by synergistic action.

[0067] The embodiments of the present invention also relate to the application of the above method in improving rice yield and quality, or improving drought resistance.

[0068] Embodiment 1:

[0069] 1. Gene cloning and construction of expression vector

[0070] 1.1 OsPrx114 gene cloning:

[0071] The full-length coding sequence of the OsPrx114 gene was cloned from the cDNA template of rice leaves. This can be achieved by PCR amplification or using gene cloning technology. The specific method is as follows:

[0072] The CDS sequence of OsPrx114 (Os07g0677500) gene was downloaded from RAP-DB (http: / / rapdb.dna.affrc.go.jp / ) database, and PCR specific primers OsPrx114_CDS_F1 (SEQ ID NO:3) and OsPrx114_CDS_R1 (SEQ ID NO:4) were designed. The coding sequence of OsPrx114 gene was amplified with the cDNA of rice Nipponbare leaves as template, with a total length of 936 bp. The polymerase used was KOD-Fx (purchased from TOYOBO), and the reaction conditions were 98℃ pre-denaturation for 2 min; 98℃ for 10 s, 60℃ for 30 s, 68℃ for 1 min, 33 cycles; 68℃ extension for 7 min. The PCR product was recovered by gel cutting after electrophoresis and used for subsequent vector construction.

[0073] 2.2 OsWRKY50 gene cloning:

[0074] According to the CDS sequence of OsWRKY50 (Os11g0117600) in the RAP-DB database, PCR specific primers OsWRKY50_CDS_F1 (SEQ ID NO: 5) and OsWRKY50_CDS_R1 (SEQ ID NO: 6) were designed, and the coding sequence of the OsWRKY50 gene was amplified with cDNA of rice Nipponbare leaves as template, with a total length of 990 bp. The polymerase used was KOD-Fx (purchased from TOYOBO), and the reaction conditions were 98℃ pre-denaturation for 2 min; 98℃ for 10 s, 58℃ for 30 s, 68℃ for 1 min, 33 cycles; 68℃ extension for 7 min. The PCR product was recovered by gel cutting after electrophoresis and used for subsequent vector construction.

[0075] The primer sequences used are shown in Table 1:

[0076] Table 1

[0077] Primer name Nucleotide number Nucleotide sequence (5'-3') OsPrx114_CDS_F1 SEQ ID NO:3 atggccaaagcaacttgcat OsPrx114_CDS_R1 SEQ ID NO:4 ttacgagttcaccttggagc OsWRKY50_CDS_F1 SEQ ID NO:5 atggaggaggcctactg OsWRKY50_CDS_R1 SEQ ID NO:6 ttaagtgaggaaatgggtgat

[0078] 2. Construction of OsPrx114 overexpression genetic transformation vector:

[0079] The OsPrx114 gene is inserted into an appropriate plant expression vector, and the CaMV35S promoter is usually used to drive the expression of the gene. A 3xFLAG tag can be attached to the 3' end of the gene for subsequent protein level analysis. The overexpression binary vector used in this embodiment is 35S-3xFlag-1300, which is a binary expression vector containing the CaMV35S promoter and the 3xFLAG tag transformed from the vector pCAMBIA1300. The vector is double-digested with BamHI and SalI, and the adapter primers OsPrx114_CDS_F2 (SEQ ID NO: 7) and OsPrx114_CDS_R2 (SEQ ID NO: 8) are designed according to the sequences on both sides of the restriction site. The PCR amplification fragment of the OsPrx114 gene is used as a template for a second round of amplification, and the PCR reaction conditions are the same as the first round. The recovered PCR product was homologously recombined with the 35S-3xFlag-1300 vector after restriction digestion to fuse the OsPrx114 gene without a stop codon with the 3xFLAG tag. The recombinase used was In-Fusion (purchased from TAKARA), and the recombination method was carried out according to the instructions. After recombination, the correct vector containing OsPrx114 was identified by sequencing and named 35S-OsPrx114-3xFlag-1300. Figure 1 shown.

[0080] 3. Construction of OsWRKY50 prokaryotic expression vector:

[0081] The prokaryotic expression vector used in this example is pCold TF (Takara), and the vector is double-digested with NdeI and BamHI. The adapter primers OsWRKY50_CD S_F2 (SEQ ID NO: 9) and OsWRKY50_CDS_R2 (SEQ ID NO: 10) are designed according to the sequences on both sides of the restriction site. The PCR amplified fragment of the OsWR KY50 gene is used as a template for the second round of amplification. The PCR reaction conditions are the same as those of the first round. The recovered PCR product is homologously recombined with the pCold-TF vector after restriction digestion to fuse the His tag with the OsWRKY50 gene. The recombination method is carried out according to the In-Fusion manual. After recombination, the correct vector containing OWRKY50 identified by sequencing is named pCold-OsWRKY50.

[0082] The primer sequences used above are shown in Table 2:

[0083] Table 2

[0084]

[0085]

[0086] Example 2

[0087] 1. Rice transformation:

[0088] The expression vector 35S-OsPrx114-3xFlag-1300 was transformed into Nipponbare callus under the mediation of Agrobacterium tumefaciens EHA105, and the selective marker gene hygromycin (50 mg / L) was used for resistance screening to obtain transgenic plants.

[0089] 2. Select transformed plants:

[0090] Highly expressed transformed plants were identified by gene expression analysis (such as RT-qPCR) of transformed plants. Total RNA from leaves of transgenic rice was extracted and reverse transcribed into cDNA. SYBR qPCR Master Mix (purchased from Nearshore) was used for qPCR analysis of the expression of OsPrx114 gene in transgenic rice plants. The specific steps were carried out according to the instructions of the kit and amplified using the LightCycler 480 quantitative PCR instrument of Roche. The rice OsActin gene (Os11g0163100) was used as the internal reference gene. The primer sequences used are shown in Table 3.

[0091] Table 3

[0092] Primer name Nucleotide number Nucleotide sequence (5'-3') OsAct_F SEQ ID NO:11 gagtatgatgagtcgggtccag OsAct_R SEQ ID NO:12 acaccaacaatcccaaacagag OsPrx114_RT_F SEQ ID NO:13 gcatcaaggcgcagatagag OsPrx114_RT_R SEQ ID NO:14 tgcacctgtagagtcccttc

[0093] According to the qPCR results, two strains with higher RNA expression levels were selected (see Appendix Figure 2 a), extract the total protein from the leaves and perform SDS-PAGE gel electrophoresis, transfer the membrane and perform Western blot using anti-Flag antibody (purchased from Genscript). The results are shown in the attached figure. Figure 2 As shown in b, the levels of OsPrx114-FLAG fusion protein were also high in the two transgenic lines.

[0094] Example 3: Drought tolerance assessment

[0095] 1. Drought treatment:

[0096] The transgenic lines (#21, #30) with high expression of OsPrx114-3xFlag obtained in Example 2 and the wild-type Nipponbare (Nip) seeds were sterilized and germinated on 1 / 2MS solid medium for 7 days, transferred to water-soaked soil for normal growth for 10 days, treated with water shortage and drought for 5 days, and restored to watering for 4 days. The incubator conditions were 30°C for 14 hours of light and 28°C for 10 hours of darkness. The plants at each stage were photographed, and the survival rate of the plants after the drought treatment was recorded. The experimental results are shown in the attached figure. Figure 3 a and 3b.

[0097] According to the attached Figure 3 a and 3b show that compared with the wild-type Nip of Nipponbare, the two OsPrx114-3xFlag lines have greatly improved tolerance to drought. After 4 days of rehydration, most of the leaves of Nip have severely wilted and cannot be revived, with a survival rate of 31%, while the leaves of the transgenic lines overexpressing OsPrx114 have a low degree of wilting, and the survival rates after rehydration are 54% and 78%, respectively. These results show that overexpressing the OsPrx114 gene can significantly improve the plant's resistance to drought.

[0098] 2. Determination of water loss rate:

[0099] Two-week-old plants were removed from the rice nutrient solution, the roots were dried with paper, and then placed on filter paper. The fresh weight of OsPrx114 overexpressing plants and wild-type plants was weighed every half hour until the fresh weight did not change. The water loss rate was expressed as a percentage of the initial fresh weight, and each sample was repeated at least 3 times. The experimental results are shown in the attached Figure 3 As shown in c.

[0100] According to the attached Figure 3 c It can be seen that there is no significant difference in water loss rate between the transgenic strains overexpressing OsPrx114 and the wild-type plants, indicating that the OsPrx114 gene does not enhance drought tolerance by reducing water rate.

[0101] 3. Oxidative stress analysis:

[0102] ROS accumulation analysis: DAB staining was used to detect the ROS accumulation in plants under drought stress. DAB staining was performed using the 3,3'-diaminobenzidine (DAB) absorption method. The specific steps are as follows:

[0103] ① Prepare Tris HCL (pH = 3.8) with a concentration of 0.1M;

[0104] ② Weigh 0.05 g of DAB (Shenggong) and dissolve it in 50 mL of 0.1 M Tris HCL (pH = 3.8) solution;

[0105] ③ Take normal and drought-treated rice leaves, place them in DAB solution, and soak them at 25℃ under light for 5 hours;

[0106] ④ Prepare decolorizing solution (glacial acetic acid: ethanol = 1:1), decolorize in a 37°C incubator, and change the decolorizing solution until all chlorophyll is removed;

[0107] ⑤ Use a stereoscope (Nikon SMZ1000) to take photos and record the results.

[0108] The experimental results are as attached Figure 4 As shown in a.

[0109] According to the attached Figure 4 a It can be seen that the DAB staining of the overexpression transgenic plants after drought treatment is lighter than that of the wild-type control, indicating that the accumulated reactive oxygen species (ROS) in the overexpression transgenic plants are less.

[0110] 4. Determination of antioxidant enzyme activity:

[0111] The activities of antioxidant enzymes such as peroxidase and catalase were analyzed in transformed and wild-type rice plants to evaluate their effectiveness in coping with oxidative stress.

[0112] The H2O2, Pro, MDA, POD and CAT detection kits (purchased from Solarbio) were used to measure the hydrogen peroxide (H2O2) content, proline (Pro) content, MDA content, and peroxidase (POD) and catalase (CAT) activities of OsPrx114 overexpressing plants and Nip plants after normal treatment and drought treatment for 3 days, respectively. All the samples were from 3 biological replicates. The results are shown in the attached figure. Figure 4 As shown in b-4f.

[0113] According to the attached Figure 4b-4f shows that after drought treatment, the hydrogen peroxide (H2O2) content and malondialdehyde (MDA) content in the overexpressing transgenic plants were lower than those in the wild-type Nip, while the peroxidase (POD) activity, catalase (CAT) activity and proline (Pro) content were all greater than those in the wild-type, indicating that overexpression of OsPrx114 can improve rice tolerance to drought by enhancing the scavenging of reactive oxygen species.

[0114] Example 4

[0115] This example is used to illustrate the regulation of OsWRKY50 on OsPrx114 and the evaluation of drought tolerance:

[0116] 1. Obtaining His-OsWRKY50 fusion protein:

[0117] The pCold-OsWRKY50 prokaryotic expression vector constructed in step 1 was transformed into Escherichia coli BL21 (DE3), and the Escherichia coli was spread on LB (containing 50 mg / L ampicillin) plates and cultured at 37°C overnight. A single clone was picked and identified as a positive clone. It was inoculated in a small amount of LB culture medium and cultured at 37°C overnight. The next day, it was transferred to LB culture medium at a ratio of 1:100, cultured at 37°C, 230rpm until the OD600 value was about 0.5, IPTG was added to a final concentration of 0.1mM, and cultured at 16°C, 230rpm for 20 hours. After the cells were collected, they were purified using a His purification kit (purchased from Beyotime Company), and the specific steps were carried out according to the instructions. At the same time, the empty vector pCold was expressed as a control according to the above method.

[0118] 2. Gel retardation assay (EMSA):

[0119] The promoter region of 1070 bp upstream of the OsPrx114 gene was analyzed, and sequences F1 and F2 containing the W-box expression cassette (TTGACC) were found. The F1 and F2 probes were synthesized by Qingke Biotechnology Co., Ltd. At the same time, the expression cassette mutation probes mF1 and mF2 were synthesized. The primer sequences are shown in Table 4.

[0120] Table 4

[0121] Primer name Nucleotide number Nucleotide sequence (5'-3') F1 SEQ ID NO:15 gagcacgtcgaatgccaacacacgttggtcaatactgttcatacccacgatcaaaa mF1 SEQ ID NO:16 gagcacgtcgaatgccaacacacgttggtgtatactgttcatacccacgatcaaaa F2 SEQ ID NO:17 gaataagacaaatggtcaaacatgtaagaaaagaaagtcaacggcgtcatctattt mF2 SEQ ID NO:18 gaataagacaaatggtgtaacatgtaagaaaagaaagtcaacggcgtcatctattt

[0122] Then, the probe was biotin labeled using the LightShift EMSA kit from Thermo Company, and the binding reaction system was prepared according to the instructions. The purified His protein and His-OsWRKY50 fusion protein were subjected to 16 reaction experiments with labeled probes (biotin probe), unlabeled probes (cold probe) and mutant probes (mutant probe). The total volume of each reaction was 10uL. After mixing, the mixture was placed at room temperature for 30 minutes. After the reaction, 6% PAGE gel was used for electrophoresis, followed by transfer, hybridization and color development. The experimental results are shown in Figure 2. Figure 5 shown.

[0123] according to Figure 5 It can be seen that His-OsWRKY50 protein can bind to F1 and F2 probes, and the binding signal can be weakened by 10x, 50x and 100x unlabeled F1 and F2 probes, while the mutated F1 and F2 probes cannot bind to His-OsWRKY50 protein, indicating that OsWRKY50 protein can specifically bind to the W-box on the OsPrx114 promoter, and OsWRKY50 protein is an upstream regulatory factor of the OsPrx114 gene.

[0124] Example 4

[0125] This example is used to illustrate the drought tolerance evaluation of OsWRKY50 overexpression materials:

[0126] The preparation of OsWRKY50 overexpression material was carried out by a method similar to that in Example 2, and drought treatment was carried out by the method in Example 3 to obtain the experimental results as shown in FIG. Figure 6 shown.

[0127] according to Figure 6 It can be seen that: compared with the wild type (WT), the two OsWRKY50 overexpression lines have increased tolerance to drought. After 4 days of rehydration, the survival rate of WT was 12.5%, while the leaf wilting degree of the transgenic lines overexpressing OsWRKY50 was lower, and the survival rates after rehydration were 45.8% and 54.2%, respectively, but the water loss rate was no different from that of the wild type control. These results indicate that overexpression of the OsWRKY50 gene can also improve plant resistance to drought. Combined with the results of the regulation of the OsWRKY50 protein on the OsPrx114 promoter, it is shown that the OsWRKY50-OsPrx114 transcription module plays an important role in regulating plant drought tolerance.

[0128] The above description is only a specific embodiment of the present invention, so that those skilled in the art can understand or implement the present invention. Various modifications to these embodiments will be apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments described herein, but should conform to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. Application of OsPrx114 gene in regulating drought resistance of rice, characterized in that: The sequence of the OsPrx114 gene is selected from: a DNA sequence as shown in SEQ ID NO: 1; or a DNA sequence at least 90% homologous to SEQ ID NO: 1; or a subfragment functionally equivalent to the sequence shown in SEQ ID NO:

1.

2. The use according to claim 1, characterized in that: The application includes: obtaining rice mutants with enhanced drought resistance by overexpressing rice OsPrx114 gene.

3. Application of OsWRKY50 gene in regulating drought resistance of rice, characterized in that: The sequence of the OsWRKY5 gene is selected from: a DNA sequence as shown in SEQ ID NO: 2; or a DNA sequence at least 90% homologous to SEQ ID NO: 2; or a subfragment functionally equivalent to the sequence shown in SEQ ID NO:

2.

4. The use according to claim 3, characterized in that: The application includes: overexpressing the rice OsWRKY50 gene to obtain a rice mutant with enhanced drought resistance; Alternatively, the OsWRKY50 gene activates the expression of OsPrx114 by binding to the W-box element in the promoter of the OsPrx114 gene.

5. A method for enhancing the tolerance of rice to drought stress, characterized in that: The method comprises the following steps: cloning and expressing the OsPrx114 gene to achieve high-level expression of the OsPrx114 gene in rice plants, wherein the nucleotide sequence of the OsPrx114 gene is as shown in claim 1.

6. A method for enhancing the tolerance of rice to drought stress, characterized in that: The method comprises the following steps: cloning and expressing the OsWRKY50 gene to achieve high-level expression of the OsWRKY50 gene in rice plants, wherein the nucleotide sequence of the OsWRKY50 gene is as shown in claim 3.

7. A method for enhancing the tolerance of rice to drought stress, characterized in that: The method comprises the following steps: cloning and expressing the OsPrx114 gene to achieve high-level expression of the OsPrx114 gene in rice plants, cloning and expressing the OsWRKY50 gene to achieve high-level expression of the OsWRKY50 gene in rice plants, and simultaneously expressing OsPrx114 and OsWRKY50 in rice plants, wherein the nucleotide sequence of the OsPrx114 gene is as shown in claim 1, and the nucleotide sequence of the OsWRKY50 gene is as shown in claim 3.

8. The method according to any one of claims 5 to 7, characterized in that: The expression of OsPrx114 and OsWRKY50 genes is regulated by the CaMV35S promoter; Optionally, the expression sequence of the OsPrx114 gene is appended with a 3xFLAG tag so that the expression of OsPrx114 can be detected at the protein level; Alternatively, OsPrx114 and OsWRKY50 act synergistically to reduce ROS accumulation in rice plants under drought stress and enhance antioxidant enzyme activities, including peroxidase and catalytic enzymes.

9. A rice strain obtained by the method according to any one of claims 5 to 8.

10. Use of the method according to any one of claims 5 to 8 for improving rice yield and quality, or improving rice drought tolerance.

Images