Rice grain cadmium accumulation-related gene OsTF11 and its application

Abstract

The invention discloses a rice grain cadmium accumulation-related gene OsTF11 The present invention belongs to the field of plant breeding, and specifically relates to a gene related to cadmium accumulation in rice grains. OsTF11 The protein OsTF11 of the present invention or a substance that regulates the activity or content of the protein or regulates the expression of the gene encoding the protein can be used in any of the following ways: 1) in regulating the cadmium content in plant seeds; 2) in preparing products for regulating the cadmium content in plant seeds; 3) in cultivating plants with altered cadmium content in seeds; 4) in preparing products for cultivating plants with altered cadmium content in seeds; 5) in plant breeding. ostf11 Gene mutants can effectively reduce the cadmium content in rice grains and improve the safety and quality of rice.

Description

Technical Field

[0001] The present invention belongs to the field of plant breeding, and in particular relates to a rice grain cadmium accumulation-related gene OsTF11 and an application thereof. Background Art

[0002] Cadmium accumulation poses significant risks to crop and human health. When cadmium concentrations reach 1.0 mg kg⁻¹ in plant tissues, it can hinder root growth and inhibit water and nutrient absorption, leading to a series of physiological and metabolic disturbances. These disturbances include impeded protein, sugar, and chlorophyll synthesis, decreased photosynthetic intensity, and altered enzyme activity. These symptoms can cause plants to exhibit symptoms such as faded leaf color, dwarfing, and delayed phenology, ultimately leading to reduced crop quality, yield, and even death. When soil contains 0.43 mg kg⁻¹ of soluble cadmium, rice yields decrease by 10%, while concentrations of 8.1 mg kg⁻¹ can reduce yields by 25%.

[0003] Rice is my country's primary staple food crop, but it's also a major contributor to dietary cadmium intake, contributing 58.6% of total cadmium intake. Cadmium is a potent carcinogen, teratogen, and mutagenic agent, posing significant risks to the human body. Cadmium's toxic effects are classified as acute and chronic. Acute effects primarily manifest as lung damage, gastrointestinal irritation, general fatigue, muscle aches, and collapse; chronic effects primarily manifest as a range of damage to the bones, liver, kidneys, immune system, and genetics, and can induce various cancers. Breeding low-cadmium rice can effectively reduce cadmium levels in rice, increase overall grain production, and provide effective support for food security, thus significantly contributing to food security.

[0004] Cadmium accumulation in rice occurs through root uptake and compartmentalization, xylem loading and transport, distribution to rice stem nodes, and redistribution to leaves, resulting in an overall cadmium distribution pattern: root > stem > sheath > leaf > grain. Cadmium transporters are typically located at the plasma membrane and tonoplast and participate in transmembrane ion transport, enabling cadmium uptake, efflux, and vacuolar compartmentalization in plant cells. Multiple transporter families have been identified in rice roots, including the NRAMP (natural resistance-associated macrophage protein) family, the HMA (heavy metal transporting ATPase) family, and the ZIP (zinc-iron transporter) family. Cadmium transporters in stem nodes include ZIPs and the plant calcium / cation transporter superfamily. Cadmium, lacking a specific transporter in rice, accumulates in leaves along with other metals and is redistributed to grains during the reproductive period. Two leaf cadmium transporter genes, OsLCD and OsMTP1, have been identified. Transcription factors participate in rice's response to cadmium by regulating the spatiotemporal expression of cadmium-related genes in rice, but reports on related genes are limited. Summary of the Invention

[0005] The main problem to be solved by the present invention is how to regulate the cadmium content in plant seeds and reduce cadmium pollution.

[0006] In order to solve the problems existing in the prior art, the present invention provides the use of a protein or a substance that regulates the activity or content of the protein or regulates the expression of a gene encoding the protein in regulating the cadmium content in plant seeds.

[0007] Use of the protein or gene expression regulating substance provided by the present invention or the substance regulating the activity or content of the protein in any of the following:

[0008] 1) Application of regulating cadmium content in plant seeds;

[0009] 2) Application in the preparation of products for regulating cadmium content in plant seeds;

[0010] 3) Application in the cultivation of plants with altered cadmium content in their grains;

[0011] 4) Use in the preparation of products for cultivating plants with altered cadmium content in their seeds;

[0012] 5) Application in plant breeding;

[0013] The protein is any one of the following proteins:

[0014] a1) a protein having the amino acid sequence of SEQ ID No: 1;

[0015] a2) a protein having the same function as the amino acid sequence of SEQ ID No: 1 after one or more amino acid residues are substituted and / or deleted and / or added;

[0016] a3) a protein with an amino acid sequence of at least 75% identity to any of the ones specified in a1) or (a2) and having the same function;

[0017] a4) A fusion protein obtained by ligating a tag to the end of any of the proteins defined in a1) to (a3).

[0018] The protein described in a1) above is named OsTF11.

[0019] In order to facilitate purification or detection of the protein in a1), a tag protein may be connected to the amino terminus or carboxyl terminus of the protein consisting of the amino acid sequence shown in SEQ ID No: 1 in the sequence listing.

[0020] The tag protein includes but is not limited to: GST (glutathione sulfhydryltransferase) tag protein, His6 tag protein (His-tag), MBP (maltose binding protein) tag protein, Flag tag protein, SUMO tag protein, HA tag protein, Myc tag protein, eGFP (enhanced green fluorescent protein), eCFP (enhanced cyan fluorescent protein), eYFP (enhanced yellow-green fluorescent protein), mCherry (monomeric red fluorescent protein) or AviTag tag protein.

[0021] The above proteins can be synthesized artificially, or their encoding genes can be synthesized first and then expressed biologically.

[0022] Those skilled in the art can readily mutate the nucleotide sequence encoding the OsTF11 protein of the present invention using known methods, such as directed evolution or point mutagenesis. Artificially modified nucleotide sequences that are 75% or more identical to the nucleotide sequence of the isolated OsTF11 protein of the present invention are derived from and are equivalent to the nucleotide sequence of the present invention, as long as they encode the OsTF11 protein and possess the function of the OsTF11 protein.

[0023] The aforementioned 75% or greater identity may be 80%, 85%, 90% or 95% or greater identity.

[0024] As used herein, identity refers to amino acid sequence or nucleotide sequence identity. Amino acid sequence or nucleotide sequence identity can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, the identity of a pair of amino acid or nucleotide sequences can be calculated by searching using Advanced BLAST 2.1 using blastp as the program, setting the Expect value to 10, all filters to OFF, BLOSUM62 as the matrix, and setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values), respectively. The identity value (%) can then be obtained.

[0025] Herein, the 80% or greater identity may be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity.

[0026] Herein, the 90% or greater identity may be at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity.

[0027] In the above application, the protein is derived from rice ( Oryza sativa L.).

[0028] Herein, the substance that regulates the activity and / or content of the protein may be a substance that regulates the expression of a gene encoding the protein OsTF11.

[0029] In the above, the substance that regulates gene expression may be a substance that performs at least one of the following six types of regulation:

[0030] 1) Regulation at the transcriptional level of the gene;

[0031] 2) post-transcriptional regulation of the gene (i.e., regulation of the splicing or processing of the primary transcript of the gene);

[0032] 3) Regulation of RNA transport of the gene (i.e., regulation of the transport of the mRNA of the gene from the nucleus to the cytoplasm);

[0033] 4) regulation of the translation of the gene;

[0034] 5) regulation of mRNA degradation of the gene;

[0035] 6) Post-translational regulation of the gene (i.e., regulation of the activity of the protein translated from the gene).

[0036] In the present invention, the regulation may be up-regulation, enhancement or increase. The regulation may also be inhibition, reduction or down-regulation.

[0037] Herein, the upregulation or enhancement or increase of the expression level of the gene encoding the protein mentioned above in the recipient plant, or / and the enhancement, improvement or upregulation of the activity and / or content of the gene encoding the above protein is achieved by introducing the gene encoding the above protein into the recipient plant.

[0038] Herein, regulating the expression of the gene encoding the protein may also be inhibiting, reducing or down-regulating the expression of the gene encoding the protein. Inhibiting, reducing or down-regulating the expression of the gene encoding the protein may be achieved by gene knockout or gene silencing.

[0039] Gene knockout refers to the inactivation of a specific target gene through gene editing techniques. Gene knockout inactivates a specific target gene by altering its DNA sequence, including but not limited to zinc-finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and the CRISPR / Cas system. CRISPR (clustered regulatory interspaced short palindromic repeats) is a site in the genome containing multiple short repeats. The Cas9 protein, under RNA guidance, can cleave the target sequence recognized by crRNA–tracrRNA.

[0040] The gene silencing refers to the phenomenon of not expressing or underexpressing a gene without damaging the original DNA. Gene silencing is based on the premise that the DNA sequence is not changed, so that the gene is not expressed or underexpressed. Gene silencing can occur at two levels. One is gene silencing at the transcriptional level due to DNA methylation, heterochromatinization and position effects, and the other is post-transcriptional gene silencing, that is, gene inactivation by specifically inhibiting the target RNA at the level after gene transcription, including antisense RNA, co-suppression, gene repression (quelling), RNA interference (RNAi) and microRNA (miRNA)-mediated translation inhibition, etc.

[0041] In the above applications, the substance that regulates gene expression or the substance that regulates the activity or content of the protein may be a biological material related to the protein mentioned above, and the biological material may be any of the following:

[0042] c1) a nucleic acid molecule encoding the protein described above;

[0043] c2) an expression cassette containing the nucleic acid molecule described in c1);

[0044] c3) a recombinant vector containing the nucleic acid molecule described in c1), or a recombinant vector containing the expression cassette described in c2);

[0045] c4) a recombinant microorganism containing the nucleic acid molecule described in c1), or a recombinant microorganism containing the expression cassette described in c2), or a recombinant microorganism containing the recombinant vector described in c3);

[0046] c5) a transgenic plant cell line containing the nucleic acid molecule described in c1) or a transgenic plant cell line containing the expression cassette described in c2);

[0047] c6) transgenic plant tissue containing the nucleic acid molecule described in c1) or transgenic plant tissue containing the expression cassette described in c2);

[0048] c7) a transgenic plant organ containing the nucleic acid molecule described in c1) or a transgenic plant organ containing the expression cassette described in c2);

[0049] e1) a nucleic acid molecule that inhibits, reduces or silences the expression of the gene encoding the protein mentioned above;

[0050] e2) an expression cassette containing the nucleic acid molecule described in e1);

[0051] e3) a recombinant vector containing the nucleic acid molecule described in e1), or a recombinant vector containing the expression cassette described in e2);

[0052] e4) a recombinant microorganism containing the nucleic acid molecule described in e1), or a recombinant microorganism containing the expression cassette described in e2), or a recombinant microorganism containing the recombinant vector described in e3);

[0053] e5) a transgenic plant cell line containing the nucleic acid molecule described in e1), or a transgenic plant cell line containing the expression cassette described in e2);

[0054] e6) transgenic plant tissue containing the nucleic acid molecule described in e1), or transgenic plant tissue containing the expression cassette described in e2);

[0055] e7) A transgenic plant organ containing the nucleic acid molecule described in e1) or a transgenic plant organ containing the expression cassette described in e2).

[0056] In the above application, the nucleic acid molecule in c1) can be any of the following DNA molecules,

[0057] d1) The nucleotide sequence is a DNA molecule shown in SEQ ID No: 3;

[0058] d2) the coding region sequence is the DNA molecule shown in SEQ ID No: 2;

[0059] d3) a DNA molecule that has 90% or more identity with the nucleotide sequence defined in d1) or d2) and encodes the protein described above;

[0060] d4) A DNA molecule that hybridizes under stringent conditions to the nucleotide sequence defined in d1) or d2) and encodes the protein described above.

[0061] The nucleic acid molecule described herein can be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule can also be RNA, such as gRNA, mRNA, siRNA, shRNA, sgRNA, miRNA or antisense RNA.

[0062] The vectors described herein are well known to those skilled in the art, and include, but are not limited to, plasmids, phages (such as lambda phage or M13 filamentous phage), cosmids (i.e., cosmids), Ti plasmids, or viral vectors. Specifically, the vector BGK03 may be used.

[0063] Optionally, e3) the recombinant vector contains an expression cassette sequence of sgRNA SEQ ID No: 4, and the target site of the sgRNA is located at OsTF11 The second exon of the gene, the nucleotide sequence of the target of the sgRNA is 515-537 of SEQ ID No: 3 or 2951-2973 of SEQ ID No: 2. Nucleotides 1-245 of SEQ ID No: 4 are a promoter that initiates transcription of the sgRNA gene, the sgRNA gene is located at positions 246-265 of SEQ ID No: 4 in the sequence listing, and nucleotides 342-346 are a terminator that terminates transcription of the sgRNA gene.

[0064] The present invention also provides a method for reducing the cadmium content in plant seeds, which includes step P, wherein step P is to inhibit, reduce or silence the activity and / or content of the protein mentioned above in the target plant, or / and, inhibit, reduce or silence the expression level of the gene encoding the protein mentioned above, so as to reduce the cadmium content in the plant seeds.

[0065] In a specific embodiment, the method for inhibiting, reducing or silencing the cadmium content in plant seeds may include the following steps:

[0066] A) Using the CRISPR / Cas9 system to clone the gene encoding the OsTF11 protein in the recipient plant OsTF11 Perform gene editing and make the OsTF11 Gene mutations lead to premature termination of protein translation, which reduces the cadmium content in the seeds of the target plant;

[0067] B) self-pollinating the target plant to obtain a homozygous plant, namely the target plant, wherein the cadmium content in the seeds of the target plant is higher than that of the recipient plant.

[0068] In the above method, the gene encoding the OsTF11 protein in the recipient plant is OsTF11 Gene editing can be performed by performing at least one of the following mutations on the protein encoding gene (nucleotide sequence shown in SEQ ID No: 2) in the plant genome:

[0069] 1) replacing 5'- GCAGCCTTGGACTATTTGACTGG -3' in the protein encoding gene in the plant genomic DNA with 5'- GCAGCCTTGGACTGACTGG -3', thereby knocking out the gene encoding the OsTF11 protein;

[0070] 2) Replacing 5'-GCAGCCTTGGACTATTTTTGACTGG-3' in the protein encoding gene in the plant genomic DNA with 5'-GCAGCCTTGGACTATTTTTGACTGG-3', thereby knocking out the gene encoding the OsTF11 protein.

[0071] The present invention also provides a method for increasing the cadmium content in plant seeds, which includes step M, wherein step M is to enhance, increase or upregulate the activity and / or content of the protein mentioned above in the target plant, or / and enhance, increase or upregulate the expression level of the gene encoding the protein mentioned above, so as to increase the cadmium content in the plant seeds.

[0072] In the above method, reducing the expression level and / or activity of the gene encoding the protein OsTF11 in the target plant can be: using gene mutation, gene knockout, gene editing or gene knockdown technology to reduce or inactivate the activity of the gene encoding the protein OsTF11 in the genome of the target plant.

[0073] The present invention provides a method for cultivating plants with reduced cadmium content in grains, comprising inhibiting, reducing or silencing the expression of the gene encoding the above-mentioned protein and / or the content and / or activity of the above-mentioned protein in the target plant, or / and inhibiting, reducing or silencing the activity and / or content of the gene encoding the above-mentioned protein, to obtain plants with reduced cadmium content in grains.

[0074] In one embodiment of the present invention, the breeding method for cultivating plants with reduced cadmium content in grains comprises the following steps:

[0075] (1) constructing a recombinant expression vector for inhibiting, reducing or silencing the gene encoding the protein described above;

[0076] (2) The recombinant expression vector constructed in step (1) is transferred into a recipient plant to obtain a plant having a cadmium content in the grains lower than that of the recipient plant.

[0077] In the above method, the inhibition, reduction or silencing of the aforementioned protein may specifically be knocking out the protein.

[0078] In the above method, the knockout is achieved through the CRISPR / Cas9 system.

[0079] In the above method, the target of gene editing by the CRISPR / Cas9 system is positions 515-537 of SEQ ID No: 3 or positions 2951-2973 of SEQ ID No: 2.

[0080] In the present invention, the purpose of plant breeding may include cultivating plants with reduced cadmium content in seeds.

[0081] In the present invention, the plant may be as follows:

[0082] N1) Monocots or dicots;

[0083] N2) Gramineae;

[0084] N3) Grasses;

[0085] N4) Oryza spp.;

[0086] N5) Rice.

[0087] This study OsTF11 Genes significantly affect rice's cadmium accumulation capacity, created by CRISPR / Cas9 ostf11 The gene mutant can effectively reduce the cadmium content in rice grains, improving the safety and quality of rice. This study provides important information for understanding the mechanism of cadmium accumulation in rice and also provides new components for future rice breeding and food security. BRIEF DESCRIPTION OF THE DRAWINGS

[0088] Figure 1 for OsTF11 CRISPR Strain construction and identification. a, Gene schematic diagram and target sequence of OsTF11; b, OsTF11 CRISPR mutation sequence.

[0089] Figure 2 for OsTF11 CRISPR The seedling phenotype of the strain. OsTF11 CRISPR Soil culture phenotype of the strain; b. OsTF11 CRISPR Plant height; c. OsTF11 CRISPR Cadmium content in seeds of different strains. DETAILED DESCRIPTION

[0090] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.

[0091] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, were all commercially available.

[0092] Unless otherwise specified, the quantitative tests in the following examples were performed three times, and the results were averaged.

[0093] BGK03 in the following examples has been described in: Lu Y, Ye X, Guo R, et al. Genome-wide Targeted Mutagenesis in Rice Using the CRISPR / Cas9 System. Mol Plant. 2017;10(9):1242-1245. The public can obtain this biological material from the applicant. This biological material is only used to repeat the experiments of the present invention and cannot be used for other purposes.

[0094] The data in the following examples were processed using SPSS 11.5 statistical software. The experimental results were expressed as mean ± standard deviation and tested using One-way ANOVA. P < 0.05 (*) indicated a significant difference, P < 0.01 (**) indicated a very significant difference, and P < 0.001 (***) indicated an extremely significant difference.

[0095] Example 1 OsTF11CRISPR Mutant construction

[0096] OsTF11 The coding sequence (CDS) of the gene in the japonica rice variety Nipponbare is SEQ ID No: 2, and the encoded amino acid sequence of the OsTF11 protein is SEQ ID No: 1. The genomic gene encoding the OsTF11 protein in the genomic DNA of Nipponbare is shown in SEQ ID No: 3 in the sequence listing.

[0097] The CRISPR vector used was BGK03, and the specific construction process was as follows;

[0098] 1) Design and generate gRNA target sequences. Use the Baige gRNA target design tool ( http: / / www.biogle.cn / index / excrispr ) Design and generate the gRNA target sequence: 5'-GCAGCCTTGGACTATTTGACTGG-3', the target sequence is located at OsTF11 The second exon region of the gene ( Figure 1 a) is SEQ ID No: 3, positions 515-537 or corresponds to SEQ ID No: 2, positions 2951-2973.

[0099] 2) Preparation of oligo dimers.

[0100] UP Oligo: 5'-TGTGGTGCAGCCTTGGACTATTTGAC-3';

[0101] Low Oligo: 5'-AAACGTCAAATAGTCCAAGGCTGCA-3'.

[0102] Dissolve the synthesized oligo in water to 10 µM. Mix according to the following reaction system, heat at 95°C for 3 minutes, and then slowly cool to 20°C at a rate of approximately 0.2°C / second. The reaction system (20 µl) is as follows: 18 µl of Buffer Anneal (10 µM concentration), 1 µl of UP Oligo (10 µM concentration), and 1 µl of Low Oligo (10 µM concentration). Add water to make up to 20 µl of H2O.

[0103] 3) Construct the oligo dimer into the BGK03 vector. Combine the components on ice according to the following reaction system. Mix thoroughly and incubate at room temperature (20°C) for 1 hour. The ligation system is: 2 µl BGK03 Vector, 1 µl oligo dimer, 1 µl EnzymeMix. Add water to make up to 10 µl of H2O.

[0104] 4) E. coli transformation

[0105] (A) After taking out the competent E. coli cells (Weidi Biotechnology, Cat. No. DL1001), they were immediately placed on ice to thaw.

[0106] (B) In a clean bench, add the recombinant system to the competent cell suspension, pipette gently to mix the contents, and incubate on ice for 30 min.

[0107] (C) Heat shock at 42°C for 90 s, followed by incubation on ice for 3 min.

[0108] (D) Add 900 μl of liquid LB medium to a sterile centrifuge tube, mix thoroughly, and incubate in a shaker at 220 rpm at 37°C for 1-2 h.

[0109] (E) Centrifuge at 12,000 rpm for 1 min, remove the supernatant, add 200 μl of LB liquid medium to resuspend the culture, and use a spreading rod to spread the bacterial liquid on LB solid medium containing 100 mg / L Kan+. Invert and culture in a 37°C incubator overnight.

[0110] (F) Single clones were picked for sequencing, and strains with correct sequencing results were used for subsequent experiments.

[0111] The structure of the recombinant vector PBGK03-sgTF11 is described as follows: a DNA fragment with the sequence of SEQ ID No. 5 is inserted between the 5'-gcgctgtcgcttgtgt-3' and 5'-ctagctctaaaaca-3' fragments of the starting vector BGK03, while keeping the other sequences of the starting vector BGK03 unchanged.

[0112] The recombinant vector PBGK03-sgTF11 contains the sgRNA expression cassette sequence SEQ ID No: 4, wherein nucleotides 1-245 of SEQ ID No: 4 are a promoter for initiating transcription of the sgRNA gene, the sgRNA gene is located at positions 246-265 of SEQ ID No: 4 in the sequence listing, and nucleotides 342-346 are terminators for terminating transcription of the sgRNA gene.

[0113] Rice transformation was performed using the Agrobacterium-infected rice callus method, with the rice variety Nipponbare as the background. CRISPR vector construction and rice transformation were completed by Weimi Biotechnology Co., Ltd. The recombinant vector PBGK03-sgTF11 was inoculated with Agrobacterium tumefaciens EHA105 strain to obtain Agrobacterium EHA105 / PBGK03-sgTF11. Agrobacterium EHA105 / PBGK03-sgTF11 was then transformed into the rice variety Nipponbare via the Agrobacterium-infected rice callus method, successfully obtaining two OsTF11 CRISPR mutant lines: cr-osdof11- L3 (abbreviated as L3) and cr-osdof11-L4 (Abbreviated as L4).

[0114] Sequence analysis revealed that ( Figure 1 Middle b): Compared with the genomic DNA of rice Nipponbare, the genes encoding OsTF11 protein in both homologous chromosomes of L3 strains have undergone the following mutation: "5'-GCAGCCTTGGACTATTTGACTGG-3' (corresponding to positions 2951-2973 of SEQ ID No: 3 and positions 515-537 of SEQ ID No: 2)" has mutated to "5'-GCAGCCTTGGACTGACTGG-3'"; the four bases "ATTT" are deleted in the protein coding sequence, making OsTF11 A frameshift mutation occurs, resulting in loss of function and knocking out the gene encoding the OsTF11 protein.

[0115] Compared with the genomic DNA of rice Nipponbare, the genes encoding OsTF11 protein in the two homologous chromosomes of the L4 strain underwent the following mutation: "5'-GCAGCCTTGGACTATTTGACTGG-3' (corresponding to positions 2951-2973 of SEQ ID No: 3 and positions 515-537 of SEQ ID No: 2)" mutated to "5'-GCAGCCTTGGACTATTTTTGACTGG-3'"; two bases "TT" were inserted in the protein coding sequence, making OsTF11 A frameshift mutation occurs, resulting in loss of function and knocking out the gene encoding the OsTF11 protein.

[0116] Example 2 OsTF11CRISPR Field phenotype of strains

[0117] The wild rice variety Nipponbare (Nip) and ostf11-L3, ostf11-L4 The materials were planted in cadmium-free and cadmium-contaminated soils for cadmium treatment experiments. The specific cadmium treatment experiments were as follows: Environment I had a soil cadmium concentration of 0.8 mg / kg (abbreviated as EN1); Environment II had a soil cadmium concentration of 1.2 mg / kg (abbreviated as EN2).

[0118] During the rice maturity period, the plant height was detected and found ( Figure 2 Figures a and b): 1) In the field without cadmium pollution, the aboveground plant height of the mutant was 95.33±0.577 cm and 88.33±0.577 cm, respectively, which was significantly lower than the wild type's 101±1 cm; 2) This phenomenon still existed in the two cadmium-polluted fields. In environmental type I, the aboveground plant height of the mutant was 77.67±2.082 and 78.33±2.887 cm, respectively, which was significantly lower than the wild type's 90.67±1.155 cm; in environmental type II, the aboveground plant height of the mutant was 86.7±1.044 and 81.67±2.517 cm, respectively, which was significantly lower than the wild type's 96.33±3.51 cm. This result shows that OsTF11 The knockout of affected the normal growth of rice plants, and this phenomenon existed both in cadmium-free and normal cadmium-contaminated fields.

[0119] After rice matures, individual plants are harvested, thoroughly dried, and threshed. The cadmium content of rice grains is determined by the following steps:

[0120] 1) Sample preparation before digestion: Rice grains were dried at 80°C to constant weight and pulverized using a vibrating ball mill;

[0121] 2) Accurately weigh 0.2 g of sample (accurate to 0.0001 g) and place it into a glass tube, trying not to let the sample stick to the wall of the tube;

[0122] 3) Add 1 ml of nitric acid in a fume hood, seal the tube, and pre-digest overnight;

[0123] 4) The next day, place a small funnel at the mouth of the test tube and heat it in an electric digestion furnace for 9 hours at 200°C.

[0124] 5) After removing the tube, let it cool down, then add distilled water to the sample in the digestion tube to make up to 15 ml;

[0125] 6) Shake well and filter into a 10 ml plastic centrifuge tube. Determine the cadmium content using an iCAP6300 inductively coupled plasma optical emission spectrometer.

[0126] For each batch, three blank controls and three standard substance positive controls (rice component analysis standard substances, Institute of Geophysical and Geochemical Exploration) were set up.

[0127] The results showed that ( Figure 2 In c), under two environmental types, OsTF11 The cadmium content in the grains of CRISPR strains L3 and L4 was lower than that of the Nipponbare control. In environmental type I, the cadmium content in the grains of Nipponbare rice was about 0.072±0.007 mg / kg, while OsTF11 The cadmium content in the grains of CRISPR strains L3 and L4 was approximately 0.017±0.001 and 0.024±0.009 mg / kg. In environmental type II, the cadmium content in the grains of Nipponbare rice was approximately 0.139±0.006 mg / kg, while OsTF11 The cadmium contents in the grains of CRISPR strains L3 and L4 were approximately 0.078±0.007 and 0.068±0.002 mg / kg.

[0128] Statistical analysis showed that the difference was extremely significant (P=0.01 and 0.024, environment type I; P=0.0016 and 0.0036, environment type II). The above results indicate that: OsTF11 Gene knockout can significantly reduce cadmium accumulation in rice grains, providing important genetic resources for breeding low-cadmium rice varieties.

[0129] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that further improvements can be made to the present invention. In short, according to the principles of the present invention, this application is intended to include any changes, uses or improvements to the present invention, including changes that depart from the disclosed scope in this application and are made using conventional techniques known in the art.

Claims

1. Use of a substance that inhibits, reduces or downregulates the expression of a protein-coding gene in any of the following: 1) Application in reducing cadmium content in plant seeds; 2) Application in the preparation of products for reducing the cadmium content in plant seeds; 3) Application in cultivating plants with reduced cadmium content in seeds; 4) Use in the preparation of products for cultivating plants with reduced cadmium content in grains; The protein is any one of the following proteins: a1) a protein having the amino acid sequence of SEQ ID No: 1; a2) a fusion protein obtained by ligating a tag to the end of the protein defined in a1); The plant is rice.

2. The use according to claim 1, characterized in that: The substance that inhibits, reduces or downregulates the expression of protein-coding genes is any of the following: e1) a nucleic acid molecule that inhibits, reduces or silences the expression of the protein encoding gene; e2) an expression cassette containing the nucleic acid molecule described in e1); e3) a recombinant vector containing the nucleic acid molecule described in e1), or a recombinant vector containing the expression cassette described in e2); e4) A recombinant microorganism containing the nucleic acid molecule described in e1), or a recombinant microorganism containing the expression cassette described in e2), or a recombinant microorganism containing the recombinant vector described in e3).

3. A method for reducing the cadmium content in plant seeds, characterized in that: The method comprises step P, wherein the step P is to inhibit, reduce or silence the activity and / or content of the protein of claim 1 or 2 in the target plant, or / and, inhibit, reduce or silence the expression of the gene encoding the protein of claim 1 or 2, so as to reduce the cadmium content in the plant seeds; The plant is rice.

4. A method for breeding plants with reduced cadmium content in seeds, characterized in that: The method comprises inhibiting, reducing or silencing the expression of a gene encoding the protein according to claim 1 or 2 in a recipient plant, thereby obtaining a plant with reduced cadmium content in grains, wherein the cadmium content in the grains of the plant with reduced cadmium content is lower than that of the recipient plant; The plant is rice.

5. The method according to claim 4, characterized in that: The steps include: (1) constructing a recombinant expression vector for inhibiting, reducing or silencing the gene encoding the protein of claim 1 or 2; (2) The recombinant expression vector constructed in step (1) is transferred into a recipient plant to obtain a plant having a cadmium content in the plant grains lower than that of the recipient plant.

Images