Application of CHPO and coding gene thereof in regulating and controlling low-temperature restoring force of rice

Abstract

The invention discloses application of CHPO and a coding gene thereof in regulating and controlling low-temperature restoring force of rice. Specifically, the invention discloses a protein CHPO (SEQ ID NO: 2) and an application of a coding gene thereof in regulation and control of low-temperature resilience or low-temperature resistance of plants. According to the invention, the transgenic homozygous rice is successfully created by constructing an overexpression vector of the CHPO gene and a CRISPR / Cas9 knockout vector. Experimental results show that the protein CHPO and the coding gene thereof have the effect of regulating and controlling the low-temperature restoring force or low-temperature resistance of plants, and the restoring force and the low-temperature resistance of rice under the low-temperature stress condition can be remarkably improved by overexpressing the CHPO gene. A good gene resource is provided for low-temperature-resistant breeding of rice, a new field is developed for application of the CHPO gene, and the gene has wide application prospects and important significance for cultivating novel low-temperature-resistant rice and promoting the commercial breeding process of the rice.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to the application of CHPO and its encoding gene in regulating the low temperature resilience of rice. Background Art

[0002] Rice ( Oryza sativa ) As one of the world's major food crops, rice provides the main source of food for humans, and its yield and quality are crucial to agricultural production. During the growth and development of rice, it will be subject to various abiotic stresses, such as low temperature, high temperature, drought and salt stress, which will lead to crop yield reduction and seriously affect food security. Rice originated from freshwater swamp environment and is a crop that is highly sensitive to low temperature stress. Low temperature and cold damage seriously limit rice productivity and are one of the main adverse factors affecting rice yield. Due to climate change, more than 15 million hectares of rice-growing areas have been affected by cold weather, and low temperatures pose a major challenge to rice cultivation. Although some research progress has been made on rice cold-tolerant genes, because rice cold-tolerant stress is a complex quantitative trait regulated by multiple genes, the number of cold-tolerant genes that have been cloned and functionally identified is still limited. In addition to causing the death of rice seedlings, low temperature stress will also inhibit the growth and development of seedlings for a long time, such as tillering, an important yield-determining trait. However, most of the existing studies have revealed the regulatory mechanism of rice's low temperature tolerance based on survival rate. There is currently no research on the regulatory mechanism of rice seedling low temperature resilience (tillering growth and development after low temperature stress).

[0003] In view of this, revealing the molecular mechanism of rice adapting to low temperature environment, exploring and utilizing rice cold-resistant genes, improving rice's cold resilience and cold resistance, and continuously cultivating new rice varieties with strong cold resilience and tolerance are of great theoretical and practical significance for ensuring food security and sustainable development. Summary of the invention

[0004] The technical problem to be solved by the present invention is how to regulate the low temperature tolerance or low temperature recovery of plants. The technical problem to be solved is not limited to the described technical subject matter, and those skilled in the art can clearly understand other technical subjects not mentioned in this article through the following description.

[0005] In order to solve the above technical problems, the present invention first provides an application of protein, which can be any of the following: A1) Application in regulating plant low temperature resilience; A2) Application in regulating plant low temperature tolerance; A3) Application in breeding low temperature tolerant plants; A4) Application in molecular breeding of cold-tolerant plants or improvement of cold-tolerant germplasm resources; The protein name may be CHPO, which may be any of the following: B1) a protein having an amino acid sequence of SEQ ID NO: 2; B2) a protein having more than 80% identity with the protein shown in B1) and having the same function as the protein shown in B1) obtained by replacing, deleting and / or adding amino acid residues of the amino acid sequence shown in SEQ ID NO:2; B3) A fusion protein with the same function is obtained by connecting a tag to the N-terminus and / or C-terminus of B1) or B2).

[0006] In the above application, the protein can be derived from rice ( Oryza sativa ).

[0007] The substitutions described in B2) may be conservative substitutions.

[0008] The connection in B3) can be directly connected via a peptide bond or connected via a linker.

[0009] In order to facilitate the separation, purification, detection and / or positioning of the protein in B1), a tag protein can be connected to its amino terminal or carboxyl terminal. The tag includes but is not limited to: GST (glutathione sulfhydryl transferase) tag protein, Trx (thioredoxin) tag protein, nitrogen utilization substrate A (NusA) tag protein, His tag protein (His-tag), MBP (maltose binding protein) tag protein, Flag tag protein, SUMO tag protein, HA (influenza hemagglutinin) tag protein, Myc tag protein, LacZ tag protein, CBD (cellulose binding domain) tag protein, bacteriophage T7 protein kinase (T7PK) tag protein, GFP (green fluorescent protein), CFP (cyan fluorescent protein), YFP (yellow-green fluorescent protein), mCherry (monomeric red fluorescent protein) or AviTag tag protein. The use of the tag does not change the function of the target protein, and those skilled in the art know how to select a suitable tag protein according to the desired purpose.

[0010] The application can be achieved by up-regulating or down-regulating the content and / or activity of the protein CHPO.

[0011] Furthermore, the application may include improving the low temperature recovery or low temperature tolerance of a plant by upregulating the content and / or activity of the CHPO protein (eg, overexpressing a gene encoding the CHPO protein).

[0012] The present invention also provides an application of biomaterials related to the protein CHPO, which may be any of the following: C1) Application in regulating plant low temperature resilience; C2) Application in regulating plant low temperature tolerance; C3) Application in breeding low temperature tolerant plants; C4) Application in molecular breeding of plant cold tolerance or improvement of cold tolerance germplasm resources; The biological material may be any of the following: D1) a nucleic acid molecule encoding the protein CHPO; D2) an expression cassette containing the nucleic acid molecule described in D1); D3) a recombinant vector containing the nucleic acid molecule described in D1), or a recombinant vector containing the expression cassette described in D2); D4) a recombinant microorganism containing the nucleic acid molecule described in D1), or a recombinant microorganism containing the expression cassette described in D2), or a recombinant microorganism containing the recombinant vector described in D3); D5) a recombinant host cell containing the nucleic acid molecule described in D1), or a recombinant host cell containing the expression cassette described in D2), or a recombinant host cell containing the recombinant vector described in D3); D6) transgenic plant tissue containing the nucleic acid molecule described in D1), or transgenic plant tissue containing the expression cassette described in D2); D7) A transgenic plant organ containing the nucleic acid molecule described in D1) or a transgenic plant organ containing the expression cassette described in D2).

[0013] In the above application, the nucleic acid molecule D1) may be a DNA molecule whose coding sequence or nucleotide sequence is SEQ ID NO: 1.

[0014] The nucleic acid molecule described herein may be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule may also be RNA, such as mRNA or hnRNA.

[0015] The nucleotide sequence shown in SEQ ID NO: 1 may be CHPO The coding sequence (CDS) of the gene encodes the protein CHPO with the amino acid sequence shown in SEQ ID NO:2.

[0016] D1) The nucleic acid molecule may also include a nucleic acid molecule obtained by modifying the codon preference based on the nucleotide sequence shown in SEQ ID NO: 1.

[0017] Those skilled in the art can easily mutate the nucleotide sequence encoding protein CHPO by using known methods, such as site-directed mutagenesis (including oligonucleotide primer-mediated site-directed mutagenesis, PCR-mediated site-directed mutagenesis and cassette mutagenesis, etc.) or directed evolution (including error-prone PCR, DNA shuffling and in vitro random priming recombination, etc.). Those artificially modified nucleotide sequences that have 75% or more identity with the nucleotide sequence encoding protein CHPO (such as SEQ ID NO: 1) are all derived from the nucleotide sequence of the present invention and are equivalent to the sequence of the present invention as long as they encode protein CHPO and have the same function as protein CHPO.

[0018] In the above biological material, the recombinant vector can be a cloning vector or an expression vector.

[0019] Furthermore, the recombinant vector may be a gene encoding protein CHPO ( CHPO A recombinant expression vector is a recombinant expression vector obtained by cloning a gene into an expression vector (such as a prokaryotic expression vector, a eukaryotic expression vector or a viral expression vector).

[0020] Existing plant expression vectors can be used to construct CHPO Recombinant expression vector of gene. The plant expression vector includes but is not limited to binary expression vector (such as pBI series vector (such as pBI121), pBIN series vector (such as pBin19), pCAMBIA series vector (such as pCAMBIA1300 vector), pPZP series vector, pGreen series vector, pBIBAC series vector, pSKI015 vector, pSKI074 vector, pRI101-AN vector, etc.) and co-integration vector (can be constructed by inserting a segment homologous to Ti plasmid or its segment in an intermediate vector by homologous recombination or cloning). The plant expression vector contains elements required for the expression of foreign genes, such as promoters, multiple cloning sites, terminators, ribosome binding sites, etc. The plant expression vector may also contain the 3' non-translated region of the foreign gene, i.e., a polyadenylation signal and any other DNA fragments involved in mRNA processing or gene expression. The polyadenylic acid signal can guide the addition of polyadenylic acid to the 3' end of the mRNA precursor, such as but not limited to the Agrobacterium crown gall induction (Ti) plasmid gene (such as rouge synthase Nos gene), plant gene (such as soybean storage protein gene) 3' end transcription of the non-translated region has similar functions. When the gene encoding the protein CHPO of the present invention is introduced by Agrobacterium method, it is preferred to use an expression vector suitable for Agrobacterium method, such as a binary vector or a modified vector thereof. Examples of these plant expression vectors include pBI121, pBIN19, pSMAB704, pCAMBIA series vectors and pGreen series vectors.

[0021] use CHPO When constructing a recombinant plant expression vector, any enhanced promoter or constitutive promoter may be added before the transcription start nucleotide, including but not limited to cauliflower mosaic virus (CaMV) 35S promoter, maize ubiquitin promoter (Ubi), rice actin promoter (Actin), Emu promoter, maize Adhl Gene promoter, rice rbcS Gene promoter, tomato rbcS Gene promoter, potato pinⅡ gene promoter, they can be used alone or in combination with other plant promoters; in addition, when using the gene of the present invention to construct a plant expression vector, enhancers can also be used, including translation enhancers or transcription enhancers. These enhancer regions can be ATG start codons or adjacent region start codons, etc., but must be the same as the reading frame of the coding sequence to ensure the correct translation of the entire sequence. The sources of the translation control signal and the start codon are extensive and can be natural or synthetic. The translation start region can come from the transcription start region or the structural gene.

[0022] In order to facilitate the identification and screening of transgenic plant cells or plants, the plant expression vector used can be processed, such as adding genes that can be expressed in plants and encode enzymes or luminescent compounds that can produce color changes (GUS gene, luciferase gene, GFP gene, etc.), antibiotic resistance genes (kanamycin resistance gene kanr, neomycin resistance gene neo, hygromycin resistance gene hyg, chloramphenicol resistance gene cat, streptomycin resistance gene str, bleomycin resistance gene ble, etc.) or herbicide resistance genes (bar gene, glyphosate resistance marker gene epsps, chlorsulfuron resistance marker gene als, etc.). Considering the safety of transgenic plants, it is also possible to directly screen transformed plants without adding any selective marker genes.

[0023] The present invention also provides a method for cultivating low-temperature tolerant plants, the method comprising increasing the content and / or activity of the protein CHPO in a target plant to obtain a low-temperature tolerant plant having higher low-temperature tolerance than the target plant.

[0024] In the above method, increasing the content and / or activity of the protein CHPO in the target plant can be achieved by increasing the expression level of the gene encoding the protein CHPO in the target plant.

[0025] The increasing the expression level of the gene encoding the protein CHPO in the target plant can be achieved by at least one of the following methods: (1) increasing the copy number of the gene encoding the protein CHPO; (2) expressing the gene encoding the protein CHPO under the drive of a strong promoter; (3) increasing the regulatory elements of the gene encoding the protein CHPO to overexpress it, wherein the regulatory elements include enhancer elements, elements that improve mRNA stability, elements that enhance translation efficiency, and / or elements that enhance protein secretion; (4) increasing the ribosome binding site of the gene encoding the protein CHPO; (5) codon optimization of the gene encoding the protein CHPO; (6) Upregulating the expression of the gene (the gene encoding the protein CHPO) by changing epigenetic modifications such as DNA methylation or histone acetylation.

[0026] The strong promoter includes, but is not limited to, T7 promoter, CaMV promoter, SV40 promoter, SFFV promoter, ubq promoter, ubi promoter, RBCS promoter, Actin promoter, Emu promoter, CYP450 promoter, Adhl promoter and pinⅡ promoter.

[0027] The enhancers include, but are not limited to, CMV enhancer, SV40 enhancer and RSV enhancer.

[0028] In the above method, increasing the expression level of the gene encoding the protein CHPO in the target plant can be achieved by introducing the gene encoding the protein CHPO into the target plant.

[0029] In the above method, the nucleotide sequence of the gene encoding the protein may be SEQ ID NO:1.

[0030] Furthermore, the method for cultivating low-temperature tolerant plants may include the following steps: (1) constructing a recombinant vector containing a gene encoding protein CHPO; (2) introducing the recombinant vector constructed in step (1) into the target plant; (3) Obtain low-temperature-tolerant plants through screening and identification.

[0031] Furthermore, the nucleotide sequence of the gene encoding the protein CHPO may be SEQ ID NO:1.

[0032] Furthermore, in the above method, after step (3), step (4) may be included: hybridizing the obtained low-temperature-tolerant plant with the plant to be improved to obtain an offspring transgenic plant, wherein the offspring transgenic plant has substantially the same low-temperature tolerance as the transgenic plant (i.e., the transgenic plant as the parent).

[0033] Furthermore, the introduction method includes but is not limited to: Agrobacterium-mediated method, plant virus vector-mediated transformation method, gene gun method (also known as microparticle bombardment method or biological missile method), chemical stimulation method, electric shock method, liposome-mediated method, microinjection method, laser microbeam method, pollen tube channel method, ultrasonic method, air gun method and vortex method, etc.

[0034] Furthermore, the introduction method may be an Agrobacterium-mediated method.

[0035] Furthermore, the Agrobacterium-mediated method may include the following steps: introducing the recombinant vector constructed in step (1) into Agrobacterium (such as Ca ion-induced transformation method, polyethylene glycol-mediated transformation method, metal cation-mediated transformation method, electroporation transformation method, phage transduction method, etc.) to obtain recombinant Agrobacterium, and infecting the callus tissue or explant of the target plant with the recombinant Agrobacterium; and inducing and culturing the positive callus tissue or explant obtained after identification to obtain regenerated plants.

[0036] The explants include, but are not limited to, seeds, roots, leaves, petioles, cotyledons, cotyledon petioles, hypocotyls, stem segments, stem apical meristems, epidermal parenchyma cells, tubers, stolon segments, embryonic suspension cells, and protoplasts.

[0037] The screening and identification methods are known to those skilled in the art, and for example, transformed transgenic plants (including transgenic offspring materials) can be identified by techniques such as PCR detection, Southern hybridization, immunoblotting, Northern hybridization, enzyme-linked immunosorbent assay (ELISA), functional identification (testing the presence of selection marker genes and target genes) and / or in situ hybridization.

[0038] The present invention also provides a method for improving the low temperature tolerance or low temperature recovery of a target plant, the method comprising increasing the content and / or activity of the protein CHPO in the target plant (e.g., overexpressing CHPO Gene ） .

[0039] Furthermore, increasing the content and / or activity of the protein CHPO in the target plant may be achieved by increasing the expression level of the gene encoding the protein CHPO in the target plant.

[0040] Furthermore, increasing the expression level of the gene encoding the protein CHPO in the target plant may be achieved by introducing the gene encoding the protein CHPO into the target plant.

[0041] Furthermore, the nucleotide sequence of the gene encoding the protein may be SEQ ID NO:1.

[0042] The present invention also provides a method for low-temperature-tolerant breeding, the method comprising the step of hybridizing a low-temperature-tolerant plant obtained by any of the methods for cultivating low-temperature-tolerant plants described herein with a plant to be improved to obtain a transgenic offspring plant; the transgenic offspring plant has substantially the same phenotype as the low-temperature-tolerant plant. The substantially same phenotype may be an enhanced low-temperature tolerance compared to the plant to be improved.

[0043] Herein, the plant may be any of the following: E1) monocots or dicots; E2) Gramineae; E3) Oryza; E4) Rice.

[0044] The protein CHPO or the biological material described herein is also within the protection scope of the present invention.

[0045] The modulation described herein may be up-regulation or down-regulation.

[0046] The low temperature resilience or low temperature tolerance described herein can be reflected in the growth potential, survival rate and / or tillering rate of plants under low temperature stress conditions.

[0047] Herein, the low temperature tolerant plants are understood to include not only the first generation transgenic plants obtained by introducing or knocking out the CHPO encoding gene in the target plant, but also the progeny transgenic plants thereof. The transgenic plants include seeds, callus tissues, complete plants and cells.

[0048] The present invention is constructed by CHPO Gene overexpression vectors and CRISPR / Cas9 knockout vectors were successfully created. CHPO Gene overexpression and knockout homozygous rice. The experimental results show that by overexpression CHPO The gene can significantly improve the resilience of rice to low temperature stress, and knocking out CHPO The gene can significantly reduce the resilience of rice under low temperature stress conditions, indicating that the protein CHPO and its encoding gene of the present invention have the function of regulating the low temperature resilience or low temperature tolerance of plants.

[0049] The present invention discloses for the first time the application of protein CHPO and its encoding gene in regulating plant low temperature resilience or low temperature tolerance. By increasing the content and / or activity of protein CHPO (e.g., overexpression CHPO Gene) to improve the low temperature resilience or low temperature tolerance of plants. By down-regulating the content and / or activity of the protein CHPO (e.g. silencing or knocking out CHPO Genes) can reduce the low temperature recovery or low temperature tolerance of plants. The present invention provides good gene resources for breeding rice with low temperature tolerance, CHPOThe application of genes has opened up new areas and has broad application prospects and important significance for cultivating new cold-resistant rice and promoting the commercial breeding process of rice.

[0050] Definition of terms In the present invention, unless otherwise specified, the scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. Meanwhile, in order to better understand the present invention, the definitions and explanations of the relevant terms are provided below.

[0051] The term "expression cassette" generally refers to a nucleic acid construct containing nucleic acid elements sufficient to express a target gene. A typical expression cassette contains a promoter, an MCS (multiple cloning site) and a terminator. An expression cassette may also include a target gene, a marker gene (such as TK gene, DHFR gene, CAT gene and NEO gene), a ribosome recognition and binding site (SD), a transcription factor binding site (TFBS), an enhancer, a silencer, a repressor, an intron, a poly (A) signal sequence and / or an mRNA splicing signal sequence, etc. The elements in the expression cassette may be directly connected or indirectly connected through a linker.

[0052] The term "vector" generally refers to a vector that can carry exogenous DNA or target gene into host cells for amplification and / or expression. The vector can be a cloning vector or an expression vector. The vector can be introduced into the host cell by transformation, transduction or transfection, so that the genetic material elements it carries are amplified and / or expressed in the host cell. Those skilled in the art can select a suitable vector according to the purpose of genetic engineering and the properties of the recipient cell. The vector includes, but is not limited to, plasmid, phage (such as lambda phage or M13 phage), cosmid (i.e., Cosmid), phagemid, shuttle vector (such as yeast expression vector), Ti plasmid, artificial chromosome (such as yeast artificial chromosome (YAC), bacterial artificial chromosome (BAC), P1 artificial chromosome (PAC) or Ti plasmid artificial chromosome (TAC)), viral vector (such as baculovirus vector, retrovirus (including lentivirus), adenovirus, adeno-associated virus, poxvirus, papillomavirus, papillomavirus (such as SV40), herpes virus (such as herpes simplex virus)). A vector may contain a variety of elements for controlling expression, including but not limited to promoter sequence, transcription start sequence, enhancer sequence, selection element and reporter gene. In addition, the vector may also contain a replication start site.

[0053] The term "microorganism" generally includes bacteria, viruses, fungi, actinomycetes, rickettsia, mycoplasma, chlamydia, spirochetes, algae, etc. For example, the bacteria may be from the genus Escherichia ( Escherichia sp. ) (such as Escherichia coli), Erwinia spp. ( Erwinia sp. ), Agrobacterium ( Agrobacterium sp. ) (such as Agrobacterium tumefaciens), Flavobacterium ( Flavobacterium sp. )、Alcaligenes spp. Alcaligenes sp. ), Pseudomonas ( Pseudomonas sp. ) and Bacillus ( Bacillus sp. ) (such as Bacillus), etc. The virus may include rotavirus, baculovirus, retrovirus (such as lentivirus), adenovirus, adeno-associated virus, poxvirus, papillomavirus, influenza virus, papillomavirus (such as SV40) and herpes virus (such as herpes simplex virus), etc. The fungus may be from the genus Saccharomyces ( Saccharomyces sp. ) (such as Saccharomyces cerevisiae, methanol yeast, Pichia pastoris), Fusarium spp. ( Fusarium sp. ), Rhizoctonia spp. Rhizoctonia sp. ), Verticillium ( Verticillium sp. )、Penicillium( Penicillium sp. )、Aspergillus( Aspergillus sp. ) and Cephalosporium ( Cephalosporium sp. ) etc. The actinomycetes may be from the genus Streptomyces ( Streptomyces sp. ) (such as Streptomyces). The algae may be from Cyanophyta (such as cyanobacteria), Fucus ( Fucus sp. ), the genus A. Achnanthes sp. ), Cocoon algae ( Amphiprora sp. ), Diplocoriaceae ( Amphora sp. ), Fibrocystis spp. Ankistrodesmus sp. ), Astrophytum ( Asteromonas sp. ) and Chromophytes ( Boekelovia sp. )wait.

[0054] The term "host cell" is also referred to as a recipient cell, and generally refers to any type of cell that can be used to introduce a vector, such as a plant cell and an animal cell. The host cell can be understood to refer not only to a specific recipient cell, but also to the offspring of such a cell, and due to natural, accidental or intentional mutations and / or changes, the offspring may not necessarily be completely identical to the original parent cell, but is still included in the scope of the host cell. Suitable host cells are known in the art, among which: the plant cell can be Arabidopsis thaliana ( Arabidopsis thaliana ),tobacco( Nicotiana tabacum ),corn( Zea mays )、Rice( Oryza sativa ),wheat( Triticum aestivum) and other plant cells, but not limited thereto; the animal cells may be mammalian cells (e.g., Chinese hamster ovary cells (CHO cells), Chinese hamster ovary cell substrain (CHO-K1 cells), African green monkey kidney cells (Vero cells), SV40-transformed African green monkey kidney cells (COS cells), baby hamster kidney cells (BHK cells), mouse breast cancer cells (C127 cells), human embryonic kidney cells (HEK293 cells), human HeLa cells, fibroblasts, bone marrow cell lines, T cells or NK cells, etc.), avian cells (e.g., chicken or duck cells), amphibian cells (e.g., African clawed frogs ( Xenopus laevis ) cells or giant salamander ( Andrias davidianus ) cells), fish cells (such as grass carp, carp, rainbow trout or catfish cells), insect cells (such as Sf21 cells, Sf-9 cells or Hi-5), etc. but are not limited thereto.

[0055] The term "recombinant vector" generally refers to a recombinant DNA molecule constructed by connecting an exogenous target gene to a vector in vitro. It can be constructed in any suitable manner, as long as the constructed recombinant vector can carry the exogenous target gene into the recipient cell and provide the exogenous target gene with the ability to replicate, integrate, amplify and / or express in the recipient cell.

[0056] The term "recombinant microorganism" generally refers to a recombinant microorganism with changed functions obtained by manipulating and modifying the genes of a target microorganism, such as introducing an exogenous target gene or a recombinant vector into the target microorganism, or directly editing the endogenous genes of the target microorganism.

[0057] The term "recombinant host cell" generally refers to a recombinant host cell whose function has been changed by manipulating and modifying the genes of the host cell, such as introducing an exogenous target gene or a recombinant vector into the host cell, or directly editing the endogenous genes of the host cell.

[0058] The term "link" generally refers to the association of two or more molecules. The link can be covalent or non-covalent. The link described herein can be directly connected by a peptide bond, or connected by a linker (joint).

[0059] The term "identity" generally refers to the extent to which two (nucleotide or amino acid) sequences have the same residue at the same position in the alignment, and is generally expressed as a percentage. Identity as described herein may refer to the identity of an amino acid sequence or a nucleotide sequence. Two copies with exactly the same sequence have 100% identity. It is known to those skilled in the art that the identity of an amino acid sequence or a nucleotide sequence can be determined using an identity search site on the Internet, such as the BLAST webpage of the NCBI homepage website. For example, in Advanced BLAST2.1, by using blastp as a program, setting the Expect value to 10, setting all Filters to OFF, using BLOSUM62 as a Matrix, setting Gap existence cost, Perresidue gap cost and Lambda ratio to 11, 1 and 0.85 (default values) respectively and searching to calculate the identity of the amino acid sequence, the value of identity (%) can then be obtained. In addition, sequence analysis software (such as CLC Main Workbench and MegAlignTM) can be used for determination, such as computer programs BLAST using default parameters, especially BLASTP or TBLASTN. The 75% or more identity described herein may be 75%, 80%, 85%, 90% or more identity. Herein, the 80% or more identity may be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or more identity.

[0060] The term "conservative substitution" generally refers to replacing an amino acid residue with another amino acid residue having a side chain with similar physicochemical properties. For example, conservative substitutions can be made between hydrophobic side chain amino acid residues (e.g., Met, Ala, Val, Leu, and Ile), between neutral hydrophilic side chain residues (e.g., Cys, Ser, Thr, Asn, and Gln), between acidic side chain residues (e.g., Asp, Glu), between basic side chain amino acids (e.g., His, Lys, and Arg), or between aromatic side chain residues (e.g., Trp, Tyr, and Phe). It is known in the art that conservative substitutions usually do not cause significant changes in the conformational structure of the protein and do not substantially change the biological activity of the protein. Conservative substitutions in the protein sequence that are expected to have little or no effect on the protein structure or function can be easily designed by a person of ordinary skill in the art.

[0061] The term "overexpression" generally refers to increasing or upregulating the level and / or activity of a target protein or gene. Overexpression can be achieved by regulation at the gene level (such as gene replication, transcription, translation, post-transcriptional modification and / or post-translational modification), or by promoting or increasing the content, activity and / or function of the target protein at the protein level. There is no particular limitation on the means of overexpression, and those skilled in the art are familiar with many ways to achieve overexpression. For example, a nucleic acid molecule to be overexpressed or a nucleic acid molecule encoding a protein to be overexpressed can be placed under the control of a strong promoter; the copy number of one or more genes encoding the protein of the present invention can also be increased; or the strength of the ribosome binding site or Kozak sequence can be increased, the stability of mRNA can be improved, the codon usage can be changed, the inhibitory element can be knocked out, etc.

[0062] The term "promoter" generally refers to the site that RNA polymerase specifically recognizes and binds to, located upstream of the transcription start point of the structural gene, with strict directionality and initiation of transcription. Because the strength of the promoter determines the efficiency of transcription, different types of promoters can be used in genetic engineering to regulate the expression of key genes. It is known to those skilled in the art that the use of a constitutive strong promoter can overexpress the target gene. In order to further enhance the expression of the target gene, multiple promoters can also be used in series.

[0063] The term "enhancer" generally refers to a DNA sequence that is located upstream or downstream of a structural gene and can also be located in an intron and can enhance gene transcription activity.

[0064] The term "regulatory element" generally refers to a DNA molecule with gene regulatory activity. Regulatory elements that function in plants include promoters, leader sequences, enhancers, introns, and 3'UTRs.

[0065] The term "operably linked" generally refers to the physical and / or functional connection of a DNA segment to another DNA segment in a manner that allows the segment to function in its intended manner. DNA encoding a gene product is operably linked to a regulatory element that can directly or indirectly regulate the transcription of the DNA. For example, when an enhancer is operably linked to DNA encoding a gene product, it can enhance DNA transcription, and the enhancer can be located upstream, downstream, or embedded in the coding region of the DNA.

[0066] The term "codon optimization" generally refers to a technique that improves protein expression levels in organisms by increasing the translation efficiency of target genes. Codon optimization usually involves redesigning genes to improve translation efficiency and thus protein expression levels by avoiding rare codons, using preferred codons, simplifying the secondary structure of mRNA, optimizing repetitive sequences, eliminating restriction enzyme sites, and adjusting GC content.

[0067] The term "introduction" generally refers to the transfer of exogenous genes into recipient cells such as eukaryotic recipient cells or prokaryotic recipient cells. The method of introduction is not particularly limited, and any known transformation method can be used as long as it can transfer the target gene (such as the DNA molecule of the present invention) into the recipient cell. The introduced DNA molecule can be a single copy or multiple copies. The introduction can be the integration of the exogenous gene into the host chromosome, or it can be expressed extrachromosomally by a plasmid. The introduction method may include any of the following: (1) introducing the target gene or a recombinant vector containing the target gene into the host bacteria by chemical transformation (such as Ca ion-induced transformation, polyethylene glycol-mediated transformation, or metal cation-mediated transformation, etc.) or physical transformation (such as electroporation transformation). (2) transducing the target gene into the host bacteria by phage transduction. (3) The target gene is transferred into plant receptor cells by physical or chemical methods, such as gene gun method (also known as microprojectile bombardment method or biological missile method), chemical stimulation method, electric shock method, liposome-mediated method, microinjection method, laser microbeam method, pollen tube channel method, ultrasound method, air gun method and vortex method, etc. (4) The target gene is transferred into plant receptor cells by vector, such as Agrobacterium Ti plasmid vector (including Ti plasmid-derived vectors such as co-integration vector system and binary vector system) mediated method (Agrobacterium-mediated method), plant virus vector-mediated transformation method, etc.

[0068] The term "explant" generally refers to a part of a plant body used as an in vitro culture material in plant tissue culture, which can be regenerated into a whole plant under appropriate conditions after appropriate treatment. In actual operation, those skilled in the art select appropriate explants for transformation according to different plants.

[0069] The term "callus" usually refers to the newly formed tissue on the wound surface after the original plant body is partially stimulated by trauma. It is composed of living thin-walled cells and can originate from living cells of various tissues in any organ of the plant body. In plant tissue culture, it can refer to a group of disorderly growing thin-walled cells with vigorous division ability formed by explants. Cultivating callus on an appropriate culture medium can induce it to form a whole plant. BRIEF DESCRIPTION OF THE DRAWINGS

[0070] Figure 1 for CHPO PCR amplification results of gene CDS sequence.

[0071] Figure 2 For the overexpression vector pUN1301- CHPO The physical map of .

[0072] Figure 3 Real-time PCR identification of overexpressed transgenic rice.

[0073] Figure 4 To observe and count the phenotypes of overexpressed transgenic rice. Figure 4 A in CHPO Phenotypic observation of overexpression lines before and after low temperature treatment; Figure 4 B is CHPO Observation of tillering phenotype of overexpression lines after low temperature treatment; Figure 4 C is CHPO Statistics of survival rate of overexpression lines after low temperature treatment; Figure 4 D is CHPO Statistics of tillering rate of surviving individuals in overexpression lines after low temperature treatment.

[0074] Figure 5 for CHPO Gene CRISPR mutation vector construction physical map.

[0075] Figure 6 for chpo Sequencing results of mutants.

[0076] Figure 7 for chpo Observation and statistics of mutant phenotypes. Figure 7 A in CHPO Phenotypic observation of mutants before and after low temperature treatment; Figure 7 B is CHPO Observation of tillering phenotype of mutants after low temperature treatment; Figure 7 C is CHPO Statistics of mutant survival rate after low temperature treatment; Figure 7 D is CHPO Statistics of tillering rate of surviving individuals of mutants after low temperature treatment. DETAILED DESCRIPTION

[0077] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0078] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0079] The following examples were processed using R language, and the experimental results were expressed as mean ± standard deviation. The t-test method was used, and P < 0.05 (*) indicated statistical difference, P < 0.01 (**) indicated statistically significant difference, and P < 0.001 (***) indicated extremely significant statistical difference. The quantitative experiments in the following examples were set up for three biological replicates unless otherwise specified, and the results were averaged.

[0080] Example 1, CHPO encoding gene ( CHPO Acquisition of genes Total RNA was extracted from three-leaf seedlings of Oryza sativa L. cv. Kongyu 131 (KY131), and reverse transcription and PCR were used to obtain CHPO The specific experimental steps are as follows: Plant total RNA extraction: 0.1 g of KY131 three-leaf seedlings was used as the material, ground in liquid nitrogen to form a freeze-dried powder, and total RNA was extracted using a safe RNA extraction kit (MAGEN, MD023). The specific steps are as follows: Add 600 µL of Buffer RLC to the powder, vortex mix immediately, centrifuge at 14000xg for 5 minutes, and take the supernatant. Put the purification column B10 into a 2 mL collection tube, transfer the lysate or supernatant into the column, centrifuge at 14000xg for 2 minutes, and discard the DNA binders in the purification column B10. Add 0.7 times the volume of the filtrate Buffer SW2 and mix gently with a pipette 3-5 times. Put a new B10 column into the collection tube, transfer half of the volume of the mixture to the column, centrifuge at 12000xg for 1 minute, discard the filtrate, reinstall the column back into the collection tube, and repeat the above steps. Then add 700 µL Buffer RW1 to the column, centrifuge at 12000xg for 1 minute, discard the filtrate, put the column back into the collection tube, add 700 µL Buffer SW2, and centrifuge at 12000xg for 30-60 seconds. Discard the effluent again and centrifuge at 12000xg for 2 minutes. Transfer the column to a 1.5 mL centrifuge tube, add 50 µL RNase-free water to the center of the column membrane, let stand at room temperature for 2 minutes, centrifuge at 12000xg for 1 minute, discard the column and store the RNA at -80℃, or use it directly for RT-PCR reverse transcription.

[0081] Reverse transcription (RT-PCR): Reverse transcription was performed using the extracted total RNA as a template using a reverse transcription kit (Yeasen, 11123ES60). The reaction system included 2 µL of 5×gDNA digestion buffer, 1 µL of gDNA digestion enzyme, 2 µg of total RNA, and RNase-free water to a total volume of 10 µL, and incubated at 42°C for 2 minutes. Then 10 µL of 2×Hifair® II SuperMix plus was added, and the mixture was incubated according to the following procedure: 5 minutes at 25°C, 60 minutes at 50°C, and 5 minutes at 85°C.

[0082] PCR amplification and cloning: PCR reaction was performed according to the following system: 0.2 µL PrimerSTAR HS DNA polymerase (5U / µL), 10 µL 2×GC buffer, 2.0 µL dNTPs, 0.5 µL 5´ primer (10 µM), 0.5 µL 3´ primer (10 µM), 1 µL DMSO, final volume 20 µL. Primer sequences are as follows: 5´ primer is 5´- GTCGACTCTAGAGGATCC ATGACCTCCCAGGCGGCGAC -3' (the underlined part is the BamH1 site), the 3' end primer is 5'- AAATTCGAGCTCGGTAC C TCATTGGTGCATCTTGGCCG -3´ (the underlined part is the Kpn1 site). The PCR program was as follows: pre-denaturation at 98°C for 30 seconds, followed by 35 cycles (denaturation at 98°C for 15 seconds → annealing at 55°C for 15 seconds → extension at 72°C for 1 minute and 30 seconds), and finally extension at 72°C for 10 minutes.

[0083] The amplified products were separated by 0.8% agarose gel electrophoresis. Figure 1 A specific band with a molecular weight of about 9.21 kb was displayed. The fragment was recovered using the AxyPrep DNA Gel Recovery Kit to obtain 20 µL of product. Sequencing analysis showed that the nucleotide sequence of the PCR product was CHPO Gene sequence.

[0084] CHPO The coding sequence (CDS) of the gene is shown in SEQ ID NO: 1; CHPO The gene encodes CHPO protein, and the amino acid sequence of CHPO protein is shown in SEQ ID NO:2.

[0085] Example 2, overexpression vector pUN1301- CHPO Construction 1. Obtaining pUN1301 vector 1) Weigh about 0.2 g of corn seedlings (variety: Zhongzuo-Zhongdan 8, provided by Beijing Zhongnongzuo Technology Development Co., Ltd.), grind into powder in liquid nitrogen. Add 800 µL of freshly prepared extraction buffer (0.1 M Tris-HCl pH8.0, 50 mM EDTA, 0.5 M NaCl, 1% SDS and 1% β-mercaptoethanol), and mix vigorously to completely suspend the sample. Then heat in a 65℃ water bath for 30 minutes, invert and mix every 5 minutes. Add 250 µL of pre-cooled 5 M potassium acetate solution, invert and mix quickly, and place on ice for 5 minutes. Then add an equal volume of phenol / chloroform for one extraction, and centrifuge at 12000 rpm for 5 minutes. Collect the supernatant, add 0.6 times the volume of isopropanol for DNA precipitation, stand at room temperature for 40 minutes, centrifuge at 4℃, 12000 rpm for 15 minutes, and discard the supernatant. The precipitate was washed with 70% and 100% ethanol, dried, and dissolved in 20 μL of ddH2O containing 100 μg / mL RNase to obtain maize genomic DNA.

[0086] 2) Use 2 µL of the corn genomic DNA solution extracted above as a template and use a 5' primer with a Hind III site (5'- GG AAGCTT CTGCAGTGCAGCGTGACCCGG -3´) and a 3´ primer with a BamHI site (5´-CG GGATCC AAGTAACACCAAACAACAGGG -3´) was used for PCR amplification. The PCR reaction conditions were: 94℃ pre-denaturation for 3 minutes; followed by 35 cycles, each cycle including 94℃ 45 seconds, 62℃ 45 seconds and 72℃ 2 minutes; and finally 72℃ extension for 10 minutes. After the amplification, the results of 0.8% agarose gel electrophoresis analysis showed that the target fragment with a length of about 2 kb was obtained, which was consistent with expectations. The fragment was recovered and sequenced, and the results verified that its sequence was maize ubiquitin promoter (UbiPro), that is, maize ubiqutin The promoter has a nucleotide sequence as shown in SEQ ID NO: 3. The promoter can also be obtained by artificial synthesis.

[0087] 3) The Noster poly A terminator sequence (277 bp) was cut from the plasmid vector pBI121 (provided by Beijing Biodi Biotechnology Co., Ltd., catalog number: MP-091) using restriction endonucleases Sac I and EcoR I, and ligated between the Sac I and EcoR I sites of the vector pUC19 (provided by Beijing Biotech Biotechnology Co., Ltd., catalog number: DP7801). The constructed recombinant vector was named pUC19-Noster. Subsequently, pUC19-Noster was double-digested with HindIII and BamHI, and the linearized vector large fragment was recovered by electrophoresis and ligated with the maize ubiquitin promoter (UbiPro) generated by double-digestion with HindIII and BamHI in step 2) to obtain the recombinant vector pUN19.

[0088] 4) The constructed recombinant vector pUN19 was partially digested with EcoRI and completely digested with HindIII: first, EcoRI was added at 37℃ for partial digestion, and after half an hour of digestion, EcoRI was inactivated by heating at 65℃ for 20 minutes, and then HindIII was added for complete digestion at 37℃ for 3 hours. The fragment containing UbiPro and Noster was cut out, with a length of about 2.3 kb. The fragment was cloned into the EcoRI and HindIII sites of the vector pCAMBIA1301 (provided by Biovector Co., LTD, catalog number Biovec-11) to construct the recombinant vector pUN1301.

[0089] 2. Overexpression vector pUN1301- CHPO Construction The plasmid pUN1301 constructed in step 1 was double-digested with BamHI and KpnI. The reaction system included: 2 µL of plasmid, 2 µL of 10× digestion buffer, 0.5 µL of BamHI (10 U / µL), 0.5 µL of KpnI (10 U / µL), and ddH2O was used to make up to a total reaction volume of 20 µL. The digestion was performed at 37°C for 1 hour. The digestion products were then separated by agarose gel electrophoresis, and the 4392 bp linearized pUN1301 large fragment was recovered and dissolved in 20 µL ddH2O for later use.

[0090] The obtained in Example 1 CHPO3 µL of gene (SEQ ID NO: 1) solution, 1 µL of the recovered pUN1301 linearized vector and 5 µL of recombinase 2×SoSoo Mix Plus (Tsingke Biological Technology, catalog number TSV-S2) were mixed and incubated at 50°C for 15 minutes for ligation. Subsequently, the ligation product was transformed into DH5α competent Escherichia coli, and positive clones were screened on a resistance plate containing kanamycin. The recombinant plasmid in the positive clone was extracted and sequenced for verification. The results showed that the recombinant plasmid was CHPO The gene (SEQ ID NO: 1) was inserted into the expression vector constructed between the BamHI and KpnI restriction sites of pUN1301 and named pUN1301 -CHPO The sequencing results confirmed that the promoter, gene and terminator sequences and structures in the plasmid were complete and correct (see Figure 2 In this expression vector, the maize ubiquitin promoter (UbiPro) was used to drive CHPO The target gene is efficiently expressed in plants.

[0091] Embodiment 3, CHPO Construction of gene CRISPR vector 1) sgRNA target sequence design Will CHPO The full-length CDS sequence of the gene was input into http: / / www.e-crisp.org / E-CRISP / designcrispr.html for sgRNA design, and the specific parameters were set as follows: Species selection was " Orzya sativa IRGSP-1.0.31", select "Input is FASTA sequence" as the input format, set the application intensity to "medium", and click "StartSgRNA search" to start the sgRNA sequence search. CHPO The sgRNA sequence is highly conserved in the gene, and the target sequence of sgRNA was finally determined to be: 5´-GGAGGTGCGGAGGCACTACG-3´.

[0092] 2) pCRISPR- CHPO Vector construction Add "TGTG" to the 5' end of the target sequence as a forward primer, and add "AAAC" to the 5' end of the reverse complementary sequence as a reverse primer, and finally obtain the following primers: Forward: 5´-TGTGGGAGGTGCGGAGGCACTACG-3´, Reverse: 5´-AAACCGTAGTCCTCCGCACCTCC-3´.

[0093] An appropriate amount of primers (10 μM) were mixed in equal volumes, and the annealing preparation of oligo dimers was performed using a PCR instrument. The conditions were set as follows: heating at 95°C for 3 minutes, and then cooling down to 20°C at a rate of 0.2°C / s. 2 μL of pTCRISPR vector (purchased from BioGene) was taken and digested with BasI enzyme. The digestion reaction system was as follows: pTCRISPR 2 μl, BasI 1 μl, Buffer 2 μl, H2O 15 μl, and the total volume was 20 μl.

[0094] After 2 hours of digestion at 37°C, the digestion products were separated by agarose gel electrophoresis, and the 15900 bp linearized pTCRISPR large fragment was recovered and dissolved in 20 μL ddH2O. Then, 1 μL of the linearized pTCRISPR vector was ligated with 3 μL of Oligo dimer using T4 ligase. The ligation reaction system was as follows: 1 μl of linearized pTCRISPR, 3 μl of Oligo dimer, 1 μl of T4 ligase, 1 μl of T4 ligase buffer, 4 μl of ddH2O, and the total volume was 10 μl.

[0095] The ligation product was transformed into DH5α competent E. coli, and positive clones were screened on a plate containing kanamycin. The recombinant plasmids in the positive clones were extracted and sequenced to confirm that the correct CHPO gene CRISPR vector and named it pTCRISPR- CHPO (See Figure 5 ).

[0096] Recombinant vector pTCRISPR- CHPO contain CHPO The gene editing target and the coding gene of the Cas9 protein on the vector are introduced into the receptor, and the transcribed guide RNA (sgRNA) can target the target sequence near the PAM of the receptor cell genome through base complementary pairing, that is, targeting CHPO Gene, Cas9 protein CHPO The double-stranded DNA break at the gene target site causes a gene mutation in the sheared region through the organism's own DNA damage repair response mechanism during the repair process, resulting in a frameshift mutation in the coding gene or premature termination of translation, thereby achieving CHPO Knockout of genes.

[0097] Example 4: Obtaining transgenic rice The above pUN1301 -CHPO and pTCRISPR -CHPOThe plasmid was transformed into Agrobacterium EHA105 by electroporation (reference: Hiei Y, Ohta S, Komari T, Kumashiro T (1994) Efficient transformation of rice (Oryza sativa L.) mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA. Plant J 6: 271–282; this strain can be obtained from the Institute of Botany, Chinese Academy of Sciences). The overexpression and CRISPR mutant engineering strains of the positive clones were obtained by screening on resistance plates containing kanamycin and rifampicin and were named EHA105 / pUN1301, respectively. -CHPO and EHA105 / pTCRISPR -CHPO . Obtain engineered bacteria EHA105 / pUN1301 -CHPO and EHA105 / pTCRISPR -CHPO After that, it was used to infect the callus tissue of Oryza sativa L. cv Kongyu 131 (hereinafter referred to as wild-type rice). CHPO and EHA105 / pTCRISPR -CHPO The callus tissue was washed five times with sterile water containing 300 mg / L cephalosporin, dried and transferred to N6D2S1 medium for first-generation screening. Two weeks later, the callus tissue was transferred to N6D2S2 medium for second-generation screening (screening for 2 weeks per generation). The resistant callus tissue that grew vigorously after 3 generations of screening was selected and transferred to differentiation medium (1), and cultured in a differentiation incubator (photoperiod of 12 hours, 28°C during the day and 25°C at night) for 7 days. The callus tissue was then transferred to differentiation medium (2) and cultured until regenerated seedlings grew out. The regenerated plants obtained took root on the rooting and seedling medium. When the seedlings grew to about 10 cm, the sealing film of the container was opened and the seedlings were hardened for 2-3 days, and then moved to an artificial climate chamber for cultivation. Finally, T0-generation rice plants of 10 overexpression lines and 7 CHPO mutant lines were obtained. The culture medium used is shown in Table 1.

[0098]

[0099] Example 5: Overexpression CHPO Identification of transgenic rice 1. GUS histochemical staining The 24 T0 generations obtained CHPO2-3 mm root segments of transgenic rice were placed in GUS staining solution and incubated at 37°C for 1 hour. After staining, plants with blue roots were positive transgenic materials. The components of GUS staining solution (pH 7.0) include: 100 mM Na3PO4 (pH 7.0), 0.1% Triton X-100, 10 mM EDTA, 0.5 mM potassium ferrocyanide, 0.5 mM potassium ferrocyanide and 1 mg / mL X-Gluc. The results showed that a total of 11 strains were identified, with a total of 19 positive T0 lines. CHPO Genetically modified rice.

[0100] Subsequently, the positive T0 generation plants were moved to the greenhouse for cultivation, and seeds were collected according to the strains to obtain T1 generation transgenic seeds. On this basis, they were bred to obtain homozygous T2 generation seeds. In subsequent experiments, the T1 generation transgenic seeds numbered OE were selected. jap -1. OE jap -2 T2 generation transfer CHPO Rice as material.

[0101] 2. Quantitative PCR identification From OE Jap -1. OE Jap -2 T2 generation CHPO Total RNA was extracted from transgenic rice seedlings and treated with RNase-free DNase I. 2 μg of total RNA was used for first-strand cDNA synthesis using M-MLV reverse transcriptase. After total RNA was reverse transcribed to generate cDNA, gene-specific primers were designed using Primer 5.0, with Ubiquitin primers as internal references. The primer length was set to 20 bp, the Tm value was between 55-70°C, the GC content was between 40-80%, and the expected amplified fragment length was 100-150 bp. The following are the primers used for quantitative PCR detection: 5' end primer F: 5'-GCCGGGCATGAAGCACCACC-3', 3' end primer R: 5'-GGTAGCCGACGGGCACGACGTAC-3'.

[0102] The reverse transcription product was diluted 30 times, and 3 μl was used as a template. The reaction solution was prepared using the SYBR GREEN PCR kit (SYBR® Green Realtime PCR Master Mix, Toyobo, Japan). The system was as follows: SYBR® Green Realtime PCR Master Mix 7.5 μl, Primer F 0.25 μl, Primer R 0.25 μl, cDNA 3.0 μl, H2O 3.25 μl, DMSO 0.75 ul, total volume: 15.0 μl.

[0103] PCR amplification was performed on a real-time quantitative PCR instrument QuantStudio 3 (Applied Bio Systems, USA) with the following program settings: 95°C pre-denaturation for 3 min; 95°C for 15 s, 72°C for 35 s, for a total of 45 cycles; then 95°C for 30 s, 56°C for 30 s, and 95°C for 30 s. The relative expression of the gene was calculated by the CT value. The results are shown in Figure 2. Figure 3 As shown, Ubiquitin was used as an internal reference to compare wild-type rice (ZH11) with OE jap -1 and OE jap -2 T2 generation CHPO Genetically modified rice seedlings, CHPO The expression abundance of genes in transgenic plants showed different degrees of upregulation, indicating that the target gene ( CHPO ) was successfully expressed at the transcriptional level.

[0104] Embodiment 6, CHPO Identification of gene CRISPR / Cas9 mutants Take 16 CHPO Gene CRISPR / Cas9 The genomic DNA was extracted from the leaves of the mutant seedlings. 2 µL of genomic DNA solution was used as a template. CHPO Gene CRISPR / Cas9 PCR amplification was performed using dedicated sequencing primers. The amplification primers are as follows: CHPO -CRseq-F:5´-TCTTGTGGATAAGGCTCCCTC-3´, CHPO -CRseq-R: 5´-CTTCTGGCATCTGATCTATGTATGT-3´.

[0105] The PCR reaction conditions were set as follows: pre-denaturation at 95°C for 3 minutes; followed by 35 cycles (95°C for 45 seconds, 55°C for 45 seconds, and 72°C for 30 seconds); and finally extension at 72°C for 2 minutes. After the reaction, the PCR product was subjected to 0.8% agarose gel electrophoresis, showing an amplified fragment of approximately 1 kb, which was consistent with the expected result. The target fragment was recovered and sequenced, and the strain with a double peak in the sequencing result was selected for breeding to obtain the T1 generation transgenic strain. On this basis, breeding was continued and a round of identification and sequencing was performed to screen out the homozygous T2 generation single plants. In the end, a total of 2 homozygous mutant strains were identified, named chpo-1 and chpo- 2 These two strains will be used as materials in subsequent experiments (see Figure 6 ).

[0106] Example 7: Phenotypic observation of transgenic rice 1. CHPO Phenotypic observation of overexpression strains The number is OE jap -1. OE jap -2 T2 generation transfer CHPO Rice seeds and Zhonghua 11 (ZH11; WT) seeds were germinated after being soaked in 30℃ water for 3 days, transferred to Kimura B culture medium on 96-well plates, and cultured in an artificial climate chamber until the three-leaf stage (light intensity of 10000 µmol / m² / s, light duration of 14 hours / day, temperature of 30℃). The three-leaf seedlings were then placed in a low-temperature water bath at 4℃ and then transferred back to the artificial climate chamber to resume growth. Seedling photos were taken and the survival rate was calculated. 32 plants were treated for each strain, the experiment was repeated three times, and the results were averaged.

[0107] The results are as follows Figure 4 Middle A and Figure 4 As shown in B, before low temperature treatment, wild-type rice (ZH11) and CHPO There was no significant difference in the phenotype of the overexpression strains; after treatment at 4°C and recovery of growth, CHPO The recovery capacity of overexpressing rice after low temperature stress was significantly higher than that of wild type (ZH11). Figure 4 Middle C and Figure 4 Center D shows the statistical results of survival rate and tillering rate.

[0108] After 72 hours of treatment at 4°C and 28 days of recovery, OE jap -1 and OE jap -2 T2 generation transfer CHPO The survival rates of rice were 50.6% and 50.9%, respectively, while that of ZH11 was 15.2%. jap -1 and OEjap The tillering rates of surviving individuals of -2 reached 64.5% and 73.5%, respectively, while that of ZH11 was 30.2%.

[0109] The results show that CHPO The survival rate and tillering rate of transgenic rice after low temperature treatment were significantly higher than those of wild type, indicating that CHPO Transgenic rice has a higher tolerance to low temperature stress and a stronger ability to recover after stress. CHPO Overexpression of the gene can enhance rice's tolerance and resilience to low temperature.

[0110] 2. chpo Mutant phenotype observation The number will be chpo-1 and chpo-2 The T2 generation seeds of KY131 (WT) and seeds of KY131 (WT) were soaked in 30℃ water for 3 days, and after germination, they were placed in Kimura B culture medium in 96-well plates and cultured in an artificial climate chamber (light intensity 10000 µmol / m² / s, light 14 hours / day, temperature 30℃) until the three-leaf stage. The three-leaf seedlings were then placed in a 4℃ low-temperature water bath for treatment, and then moved back to the artificial climate chamber to resume growth, and photos were recorded and the survival rate was calculated. 32 plants were treated for each strain, and the experiment was repeated three times, and the results were averaged.

[0111] The results are as follows Figure 7 Middle A and Figure 7 As shown in B, before low temperature treatment, wild-type rice (KY131) and chpo There was no obvious phenotype difference between the mutant strains; however, after treatment at 4°C and recovery of growth, chpo The cold stress resilience of the mutant was significantly lower than that of the wild type (KY131). Figure 7 Middle C and Figure 7 Center D shows the statistical results of survival rate and tillering rate.

[0112] After 72 hours of treatment at 4°C and 28 days of recovery, chpo-1 and chpo-2 The survival rates of KY131 were 3.7% and 6.1%, respectively, while that of KY131 was 32.6%. chpo-1 The tillering rate of surviving individuals was 20%, while that of KY131 was 58%.

[0113] The results showed that after low temperature treatment chpo The survival rate and tillering rate of the mutant rice were significantly lower than those of the wild type, indicating that the chpo mutant had poor tolerance to low temperature stress and weak recovery ability after stress.

[0114] Kimura B culture medium composition is as follows:

[0115] In practical applications, take 5 ml of A liquid mother solution, 5 ml of B liquid mother solution, 1 ml of EDTA-Fe mother solution, 1 ml of trace element mother solution, and 100-300 mg of sodium silicate, mix and dilute to 1 L with distilled water, adjust the pH value of Kimura B culture medium to 5.8 with 1 mol / L HCl, and obtain 1 L Kimura B culture medium.

[0116] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that the present invention can be further improved. In a word, according to the principles of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including departure from the disclosed scope in the application, and changes made with conventional techniques known in the art.

Claims

1. The use of protein, characterized in that The application is any of the following: A1) Application in regulating plant low temperature resilience; A2) Application in regulating plant low temperature tolerance; A3) Application in breeding low temperature tolerant plants; A4) Application in molecular breeding of cold-tolerant plants or improvement of cold-tolerant germplasm resources; The protein is any of the following: B1) a protein having an amino acid sequence of SEQ ID NO: 2; B2) a protein having more than 80% identity with the protein shown in B1) and having the same function as the protein shown in B1) obtained by replacing, deleting and / or adding amino acid residues of the amino acid sequence shown in SEQ ID NO:2; B3) A fusion protein with the same function is obtained by connecting a tag to the N-terminus and / or C-terminus of B1) or B2).

2. Use of a biomaterial related to the protein according to claim 1, characterized in that: The application is any of the following: C1) Application in regulating plant low temperature resilience; C2) Application in regulating plant low temperature tolerance; C3) Application in breeding low temperature tolerant plants; C4) Application in molecular breeding of plant cold tolerance or improvement of cold tolerance germplasm resources; The biological material is any of the following: D1) a nucleic acid molecule encoding the protein according to claim 1; D2) an expression cassette containing the nucleic acid molecule described in D1); D3) a recombinant vector containing the nucleic acid molecule described in D1), or a recombinant vector containing the expression cassette described in D2); D4) a recombinant microorganism containing the nucleic acid molecule described in D1), or a recombinant microorganism containing the expression cassette described in D2), or a recombinant microorganism containing the recombinant vector described in D3); D5) a recombinant host cell containing the nucleic acid molecule described in D1), or a recombinant host cell containing the expression cassette described in D2), or a recombinant host cell containing the recombinant vector described in D3); D6) transgenic plant tissue containing the nucleic acid molecule described in D1), or transgenic plant tissue containing the expression cassette described in D2); D7) A transgenic plant organ containing the nucleic acid molecule described in D1) or a transgenic plant organ containing the expression cassette described in D2).

3. The use according to claim 2, characterized in that: D1) The nucleic acid molecule is a DNA molecule whose coding sequence or nucleotide sequence is SEQ ID NO:

1.

4. A method for cultivating low-temperature tolerant plants, characterized in that: The method comprises increasing the content and / or activity of the protein of claim 1 in the target plant, thereby obtaining a low-temperature resistant plant having higher low-temperature resistance than the target plant.

5. The method according to claim 4, characterized in that The increasing of the content and / or activity of the protein in claim 1 in the target plant is achieved by increasing the expression level of the gene encoding the protein in the target plant.

6. The method according to claim 5, characterized in that The increasing the expression level of the gene encoding the protein in the target plant is achieved by introducing the gene encoding the protein in claim 1 into the target plant.

7. The method according to claim 6, characterized in that The nucleotide sequence of the gene encoding the protein is SEQ ID NO:

1.

8. A method for improving the low temperature tolerance or low temperature recovery of a target plant, characterized in that: The method comprises increasing the content and / or activity of the protein of claim 1 in the target plant.

9. The use according to any one of claims 1 to 3, or the method according to any one of claims 4 to 8, characterized in that: The plant is any of the following: E1) monocots or dicots; E2) Gramineae; E3) Oryza; E4) Rice.

10. The protein according to claim 1, or the biomaterial according to claim 2 or 3.

Images