Application of BAK gene in enhancing flood tolerance of rape

Abstract

The invention belongs to the field of crop science and agricultural molecular biology, and particularly relates to application of a BAK gene to enhancement of flood tolerance of rape, and the BAK gene is a BnaA04.BAK7 gene; the login number of the BnaA04. BAK7 gene in a gene pool is BnaA04g015000WE, and the login number of the BnaA04. BAK7 gene in the gene pool is By destroying the expression of the BAK gene, it is found that after the expression of the BAK gene is destroyed, the flooding tolerance of the brassica napus under flooding stress is weakened, and the invention discloses for the first time that hypocotyl growth of the brassica napus under flooding stress is slow and chlorophyll content is reduced due to function deletion of the BAK gene. New gene resources and theoretical guidance are provided for research and application of the flood tolerance of the rape.

Description

Technical Field

[0001] The present invention belongs to the field of crop science and agricultural molecular biology, and specifically relates to B.A.K. Application of genes in enhancing submergence tolerance in rapeseed. Background Art

[0002] rape( translations brassica napus Rapeseed (L.) is one of the most important oil crops in the world. Its seeds have an oil content of up to 33%-50%. It is not only the main source of edible oil, but also an important basis for feed, biodiesel and industrial raw materials. The rapeseed planting area in my country has been stable at more than 100 million mu all year round.

[0003] According to botanical classification, rapeseed is mainly divided into three categories: cabbage type, mustard type and cabbage type. Among them, cabbage type rapeseed has become the world's leading variety due to its strong disease resistance, high yield and wide adaptability, accounting for more than 70% of the planting area. Its seeds contain 35%-45% oil, and its meal protein content reaches 40%. It has the functions of oil, feed and vegetable, and is a typical representative of multi-purpose crops in modern agriculture.

[0004] However, large-scale cultivation of Brassica napus faces significant environmental challenges. Its main production areas are affected by the climate, with concentrated rainy seasons and heavy precipitation, which leads to waterlogging in the fields or oversaturation of the soil, causing waterlogging (flooding stress). Studies have shown that Brassica napus is extremely sensitive to flooding stress: long-term hypoxia in the roots inhibits respiration, leading to energy metabolism disorders, accumulation of reactive oxygen species (ROS) and hormone imbalance, which in turn causes leaf yellowing, plant lodging, and poor silique development, ultimately reducing yields by 20%-50%. Especially in the rice-oil rotation model, the heavy soil and difficult drainage after rice harvest further exacerbate the risk of waterlogging. Although traditional agronomic measures (such as ditching and drainage) can partially alleviate the problem, they are costly and difficult to adapt to the needs of mechanized production. Therefore, the development of new waterlogging-tolerant regulation technologies is of great significance to ensure high and stable yields of rapeseed. Summary of the invention

[0005] According to the demand for new rapeseed waterlogging tolerance regulation technology in the prior art, the present invention provides B.A.K. The specific technical scheme for the application of genes in enhancing rapeseed's flood tolerance is as follows: In a first aspect, the present invention provides B.A.K. Application of genes in enhancing rapeseed's flood tolerance, the B.A.K. Gene BnaA04.BAK7 gene; BnaA04.BAK7 The accession number of the gene in the gene bank is BnaA04g0150000WE.

[0006] Furthermore, the application method is: (1) Through overexpression B.A.K.Genes that enhance plants' ability to withstand flooding; or, (2) by destroying B.A.K. The expression of genes reduces the plant's ability to tolerate flooding.

[0007] Furthermore, the overexpression B.A.K. Gene, including the following steps: (1) Using wild-type rapeseed cDNA as a template, primer sequences were designed to construct B.A.K. Gene overexpression vectors; (2) Transforming the vector into Agrobacterium competent cells to obtain overexpression B.A.K. Agrobacterium tumefaciens of genes; (3) Include B.A.K. Agrobacterium carrying the gene overexpression vector was transferred into the explants of common wild-type rapeseed, and seedlings were obtained by tissue culture. B.A.K. Gene overexpression plants.

[0008] Furthermore, the destruction B.A.K. Gene expression includes the following steps: (1) Based on B.A.K. Gene target sequence, sgRNA design, and CRISPR / Cas9 vector construction; (2) constructing an Agrobacterium genetically engineered bacterium containing the CRISPR / Cas9 vector described in step (1); (3) transforming the genetically engineered bacteria containing the CRISPR / Cas9 vector described in step (2) into Brassica napus to obtain a homozygous mutant strain that does not contain exogenous Cas9 protein and is stably inherited; Said B.A.K. Gene BnaA04.BAK7 gene; BnaA04.BAK7 The accession number of the gene in the gene bank is BnaA04g0150000WE.

[0009] Furthermore, the nucleotide sequence of the sgRNA is shown in SEQ ID NO.2~3.

[0010] In a second aspect, the present invention provides the use of BAK protein in enhancing the flooding resistance of rapeseed, wherein the BAK protein is BnaA04.BAK7 protein; the accession number of the BnaA04.BAK7 protein in the gene bank is BnaA04g0150000WE.

[0011] In a third aspect, the present invention provides an application of a recombinant vector in enhancing the flooding tolerance of rapeseed, wherein the recombinant vector comprises B.A.K. gene; B.A.K. Gene BnaA04.BAK7 gene; BnaA04.BAK7The accession number of the gene in the gene bank is BnaA04g0150000WE.

[0012] In a fourth aspect, the present invention provides the use of genetically engineered bacteria in enhancing the flooding resistance of rapeseed, wherein the genetically engineered bacteria comprises B.A.K. gene; B.A.K. Gene BnaA04.BAK7 Gene; or BnaA04.BAK7 Gene, BnaC03.BAK7 Gene, BnaA03.BAK7 Gene, BnaA07.BAK7 Genes and BnaC07.BAK7 Gene; or BnaC07.BAK1 Gene, BnaA03.BAK1 Gene, BnaC01.BAK1 Genes and BnaA08.BAK1 Gene; Said BnaA04.BAK7 The gene accession number in the gene bank is BnaA04g0150000WE; BnaC03.BAK7 The gene accession number in the gene bank is BnaC03g0413100WE; BnaA03.BAK7 The gene accession number in the gene bank is BnaA03g0402600WE; BnaA07.BAK7 The gene accession number in the gene bank is BnaA07g0046900WE; BnaC07.BAK7 The gene accession number in the gene bank is BnaC07g0066700WE; BnaC07.BAK1 The gene accession number in the gene bank is BnaC07g0455300WE; BnaA03.BAK1 The accession number of the gene in the gene bank is BnaA03g0542200WE; BnaC01.BAK1 The gene accession number in the gene bank is BnaC01g0030300WE; BnaA08.BAK1 The accession number of the gene in the gene bank is BnaA08g0124100WE.

[0013] In a fifth aspect, the present invention provides a method for enhancing the flooding tolerance of rapeseed, comprising the following steps: (1) Based on B.A.K. Gene sequence, construction of overexpression vector; (2) constructing an Agrobacterium genetically engineered bacterium containing the overexpression vector described in step (1); (3) transforming the genetically engineered bacteria containing the overexpression vector described in step (2) into rapeseed to obtain a rapeseed strain with enhanced flooding tolerance; Said B.A.K. Gene BnaA04.BAK7 gene; BnaA04.BAK7 The accession number of the gene in the gene bank is BnaA04g0150000WE.

[0014] Compared with the prior art, the present invention has the following beneficial effects: The present invention destroys B.A.K. Gene expression, found B.A.K. After the expression of the gene is destroyed, the flooding tolerance of Brassica napus is weakened under flooding stress, and the present invention discloses for the first time B.A.K. The loss of gene function will lead to slow hypocotyl growth and reduced chlorophyll content in Brassica napus under waterlogging stress, providing new genetic resources and theoretical guidance for the research and application of rapeseed's flooding tolerance. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 for B.A.K. Gene molecular evolution tree and illustration of the mutant genes of each rapeseed mutant.

[0016] Figure 2 for Bnbak7s , Bnbak7p and Bnbak1q Schematic diagram of the mutation types of mutants.

[0017] Figure 3 for Bnbak7s , Bnbak7p , Bnbak1q The phenotypic identification results of mutants and westar under waterlogging stress during the germination period; A is the plant phenotype diagram, B is the statistical diagram of the hypocotyl length of rapeseed plants, and Mock is the control group.

[0018] Figure 4 for Bnbak7s , Bnbak7p and Bnbak1q The phenotypic identification results of mutants and westar under waterlogging stress at the seedling stage; A is the plant phenotype diagram, B is the statistical diagram of chlorophyll content in the aboveground part of rapeseed plants, and Mock is the control group.

[0019] Figure 5 for BnaA04.BAK7 , BnaC03.BAK7 , BnaA03.BAK7 , BnaA07.BAK7 , BnaC07.BAK7 , BnaC07.BAK1 , BnaA03.BAK1 , BnaC01.BAK1 and BnaA08.BAK1 The results of gene expression identification in westar plants after 12 hours of flooding stress during the germination period.

[0020] Figure 6 This is a diagram showing the results of identifying gene overexpression in 35S:BnaA04.BAK7-GFP overexpression material.

[0021] Figure 7The figure shows the phenotypic identification results of 35S:BnaA04.BAK7-GFP overexpression materials and westar under waterlogging stress during the germination period; among them, A is the plant phenotype diagram, B is the statistical diagram of the hypocotyl length of rapeseed plants, and Mock is the control group. DETAILED DESCRIPTION

[0022] In order to make those skilled in the art better understand the scheme of the present invention, the technical scheme of the present invention is clearly and completely described below in conjunction with specific embodiments. It should be noted that the following detailed descriptions are all exemplary and are only embodiments of a part of the present invention, rather than all embodiments.

[0023] Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making any creative work should fall within the scope of protection of the present invention.

[0024] Unless otherwise specified, all technical and scientific terms used herein have the same meanings as those commonly understood by those of ordinary skill in the art to which this application belongs. The experimental materials used in the examples of the present invention are all conventional experimental materials in the art and can be purchased through commercial channels. Experimental methods without specifying detailed conditions were performed according to conventional experimental methods or according to the operating instructions recommended by the supplier.

[0025] Culture medium: DM suspension (1 L): MS 4.4 g, sucrose 30 g, AS 100 µM, pH 5.8.

[0026] M0 medium (1 L): MS 4.4 g, Agar 8 g, pH 5.8.

[0027] M1 medium (1 L): MS 4.4 g, sucrose 30 g, Agar 8 g, AS 100 µM, Kinetin 0.3 mg, 2,4-D 1 mg, pH 5.8.

[0028] M2 medium (1 L): MS 4.4 g, sucrose 30 g, Agar 8 g, 2,4-D 1 mg, STS 0.02 mM, Kinetin 0.3 mg, Hygromycin 25 mg, Timentin 300 mg, pH 5.8.

[0029] M3 medium (1 L): MS 4.4 g, glucose 10 g, Agar 8 g, Zeatin 2 mg, Timentin 300 mg, IAA 0.1 mg, Hygromycin 25 mg, pH 5.8.

[0030] M4 medium (1 L): MS 4.4 g, sucrose 10 g, Agar 8 g, pH 5.8.

[0031] The pAtU6-26-M vector and pUBQ10:Cas9-P2A-GFP vector used in the following examples are recorded in patent application number 201911080944.3.

[0032] In this application, BnaA04.BAK7 The CDS sequence of the gene is shown in SEQ ID NO.1, and the accession number in the gene bank is BnaA04g0150000WE; BnaC03.BAK7 The gene accession number in the gene bank is BnaC03g0413100WE; BnaA03.BAK7 The gene accession number in the gene bank is BnaA03g0402600WE; BnaA07.BAK7 The gene accession number in the gene bank is BnaA07g0046900WE; BnaC07.BAK7 The gene accession number in the gene bank is BnaC07g0066700WE; BnaC07.BAK1 The gene accession number in the gene bank is BnaC07g0455300WE; BnaA03.BAK1 The accession number of the gene in the gene bank is BnaA03g0542200WE; BnaC01.BAK1 The gene accession number in the gene bank is BnaC01g0030300WE; BnaA08.BAK1 The accession number of the gene in the gene bank is BnaA08g0124100WE.

[0033] SEQ ID NO.1: Example 1 Obtaining gene knockout mutants The Westar rapeseed genome was used as the reference sequence, and the target genes included BnaA04.BAK7 Gene, BnaC03.BAK7 Gene, BnaA03.BAK7 Gene, BnaA07.BAK7 Gene, BnaC07.BAK7 Gene, BnaC07.BAK1 Gene, BnaA03.BAK1 Gene, BnaC01.BAK1 Genes and / or BnaA08.BAK1 Gene, the evolutionary tree of the above gene is as follows Figure 1 As shown. Figure 1 sgRNA was designed for the mutant gene in the indicated mutants. sgRNA was designed using the CRISPR-P 2.0 website (http: / / crispr.hzau.edu.cn / CRISPR / ).

[0034] The sgRNA sequence was constructed into the pAtU6-26-M vector to obtain the pAtU6-26-sgRNA vector. The pAtU6-26-sgRNA vector was digested with Kpn I and Sal I, and the sgRNA expression sequence structure was cloned into the pUBQ10:Cas9-P2A-GFP(Hyg) vector.

[0035] by BnaA04.BAK7 The primers for the CRISPR / Cas9 vector constructed for the target gene are: sgRNA-BnBAK7s-F: GATT GTAACATGAAACCATGAACA (SEQ ID NO. 2); sgRNA-BnBAK7s-R:AAA CTGTTCATGGTTTCATGTTAC (SEQ ID NO. 3).

[0036] by BnaA04.BAK7 , BnaA07.BAK7 , BnaC07.BAK7 The primers for the CRISPR / Cas9 vector constructed for the target gene are: sgRNA-Bnbak7p-F1: GATT GCTAAAAGAAGAACGTACCA; sgRNA-Bnbak7p-R1:AAACTGGTACGTTCTTCTTTTAGC.

[0037] by BnaC03.BAK7 , BnaA03.BAK7 The primers for the CRISPR / Cas9 vector constructed for the target gene are: sgRNA-Bnbak7p-F2:GATTGGTGGAGTAGAGATAGGAGG; sgRNA-Bnbak7p-R2:AAACCCTCCTATCTCTACTCCACC.

[0038] by BnaC07.BAK1 , BnaA03.BAK1 , BnaC01.BAK1 The primers for the CRISPR / Cas9 vector constructed for the target gene are: sgRNA-Bnbak1q-F1: GATT GTAATTCTATTACTCCCTGC; sgRNA-Bnbak1q-R1:AAACGCAGGGAGTAATAGAATTAC.

[0039] by BnaA08.BAK1 The primers for the CRISPR / Cas9 vector constructed for the target gene are: sgRNA-Bnbak1q-F2:GATTGGACAATCCCAGAGACGCTT; sgRNA-Bnbak1q-R2:AAAC AAGCGTCTCTGGGATTGTCC.

[0040] The specific steps are: (1) Mix equal amounts of the F primer and the R primer, anneal and obtain sgRNA oligo; digest the pAtU6-26-M vector with BbsI restriction endonuclease, recover the vector by gel lysis and connect it with the sgRNA oligo to obtain pAtU6-26-BnBAK7s vector, pAtU6-26-Bnbak7p-1 vector, pAtU6-26-Bnbak7p-2 vector, pAtU6-26-Bnbak1q-1 vector and pAtU6-26-Bnbak1q-2 vector.

[0041] (2) The pAtU6-26-Bnbak7p-1 vector and the pAtU6-26-Bnbak1q-1 vector were digested with NheI and SalI restriction endonucleases to serve as backbone vectors; the pAtU6-26-Bnbak7p-2 vector and the pAtU6-26-Bnbak1q-2 vector were digested with SpeI and SalI restriction endonucleases to serve as insert fragments. The pAtU6-26-Bnbak7p-1 digested vector fragment and the pAtU6-26-Bnbak7p-2 digested vector fragment were ligated with T4 ligase to obtain the pAtU6-26-Bnbak7p vector. The pAtU6-26-Bnbak1q-1 digested vector fragment and the pAtU6-26-Bnbak1q-2 digested vector fragment were ligated with T4 ligase to obtain the pAtU6-26-Bnbak1q vector.

[0042] (3) The pAtU6-26-BnBAK7s vector, pAtU6-26-Bnbak7p vector and pAtU6-26-Bnbak1q vector were digested with KpnI and SalI restriction endonucleases to recover the AtU6-26-sgRNA fragments; the pUBQ10:Cas9-P2A-GFP(Hyg) vector was digested with KpnI and SalI restriction endonucleases and ligated with the AtU6-26-sgRNA fragments to obtain the final gene editing vectors pUBQ10:Cas9-P2A-GFP-Bnbak7s vector, pUBQ10:Cas9-P2A-GFP-Bnbak7p vector and pUBQ10:Cas9-P2A-GFP-Bnbak1q vector.

[0043] The final vector was transferred into Agrobacterium GV3101 competent cells. The specific steps are as follows: (1) Add 100 ng of vector plasmid to 100 μL of GV3101 competent cells, mix gently, place on ice for 5 min, then in liquid nitrogen for 5 min and at 37°C for 5 min.

[0044] (2) Add 0.5 mL of LB liquid medium and culture in a shaking incubator at 28°C for 3 hours. Take 0.2 mL of the bacterial liquid and spread it on LB solid medium containing kanamycin (50 μg / mL), gentamicin (25 μg / mL), and rifampicin (25 μg / mL) and place it in a 28°C incubator until colonies grow.

[0045] The specific steps for obtaining mutant plants are as follows: (1) Sterilize westar seeds with 75% ethanol for 1 minute, 50% 84 solution for 10 minutes, and rinse with sterile deionized water 5 times.

[0046] (2) The sterilized westar seeds were sown on M0 medium, 40 seeds / medium, and cultured in the dark in an incubator at 22°C for 6 days.

[0047] (3) After 4 days of dark culture, pick the positive monoclonal Agrobacterium and inoculate it into 2 mL LB liquid resistance medium (kanamycin 50 μg / mL, gentamicin 25 μg / mL, rifampicin 25 μg / mL), and culture it in a shaker at 28°C and 220 rpm for 24 hours. Inoculate the bacteria at a ratio of 1:100 into 5 mL LB liquid resistance medium and culture it in a shaker at 28°C and 220 rpm for 12 hours.

[0048] (4) Take 2 mL of fresh bacterial culture and centrifuge at room temperature for 10 minutes (6000 rpm); discard the supernatant, resuspend the bacteria in 2 mL of DM infection medium, and centrifuge at room temperature for 5 minutes (6000 rpm); discard the supernatant, and resuspend the bacteria in 20 mL of DM infection medium.

[0049] (5) Rapeseed hypocotyls cultured in the dark for 6 days are used to prepare explants: the hypocotyls are immersed in M1 liquid culture medium and cut into pieces about 1 cm long using a sterilized scalpel.

[0050] (6) Transfer the hypocotyl explants to the infection solution described in step (4) and infect for 15 minutes, shaking three times during the infection. After the infection is completed, place the explants on sterile filter paper to absorb excess bacterial solution.

[0051] (6) Place the hypocotyl explants on M1 solid culture medium and culture in a dark incubator at 22°C for 2 days.

[0052] (7) After 2 days of dark culture, the hypocotyl explants were transferred to M2 solid medium and cultured at 22°C under long light conditions for 18 days.

[0053] (8) After 18 days, transfer the hypocotyl explants to M3 solid medium and transfer to fresh M3 solid medium every 14 days.

[0054] (9) The explants with true leaves grown on M3 medium were transferred to M4 solid medium for rooting culture, and finally BnBAK7s Single mutant, Bnbak7p Five mutant plants and Bnbak1q Quadruple mutant plants.

[0055] Identification of mutant plants: To get BnBAK7s Single mutant, Bnbak7p Five mutant plants and Bnbak1q The four mutant plants were used to identify the mutation types, and the results are as follows Figure 2 As shown, Bnbak7s Single mutant BnaA04.BAK7The gene has 1 base inserted. Bnbak7p Among the five mutants, BnaC03.BAK7 64% of the mutations in the gene were 1 base deletions, and 36% were 5 base deletions. BnaA03.BAK7 58% of the mutations in the gene were 1 base deletions, and 42% were 5 base deletions. BnaA04.BAK7 The gene is a deletion of 8 bases. BnaA07.BAK7 The gene is a 2-base deletion. BnaC07.BAK7 The gene is a 55-base deletion. Bnbak1q Among the four mutants, BnaC07.BAK1 The gene is a 1-base insertion. BnaA03.BAK1 The gene is a 1-base insertion. BnaC01.BAK1 The gene is a 4-base deletion. BnaA08.BAK1 The gene is a deletion of 1 base. The above mutations all lead to frameshift mutations.

[0056] Example 2 Phenotypic observation of knockout mutants For the germination period flooding stress experiment, the Bnbak7s Mutants, Bnbak7p Mutants, Bnbak1q The mutant and westar wild-type seeds were disinfected with 5% (v / v) NaClO, washed 5 times with sterile deionized water, and then inoculated on 1 / 2MS medium. They were grown under white light for 36 hours. The white seeds of the treatment group were transferred to a 5.0 mL centrifuge tube filled with sterile deionized water and flooded for 6 hours. The treated seeds were then transferred to 1 / 2MS solid medium to resume growth for 2 days. The control group was grown on 1 / 2MS solid medium throughout the whole process as the control group. Three biological replicates were set up for each control group and treatment group, and the length of the hypocotyl of rapeseed was counted.

[0057] The results are as follows Picture 3 As shown in A and B, after flooding during the germination period, Bnbak7s Mutants, Bnbak7p Mutants and Bnbak1q The hypocotyl length of the mutant is significantly reduced compared to the westar wild type. BAK The loss of the gene affects the hypocotyl elongation of rapeseed under flooding conditions.

[0058] For the flooding stress experiment at the seedling stage, the Bnbak7s Mutants, Bnbak7p Mutants and Bnbak1qThe mutant and westar wild-type seeds were sown in the soil and flooded at the two-leaf and one-heart stage. The water level was parallel to the soil surface to simulate flooding stress for 7 days, and then growth resumed for 2 days. The control group maintained normal water supply throughout the process. Three biological replicates were set for each control group and treatment group, and the chlorophyll content of the aboveground part was measured. The results are shown in Picture 4 As shown in A, after flooding stress at the seedling stage, Bnbak7s Mutants, Bnbak7p Mutants and Bnbak1q The leaves of the mutant turned yellow and red, while those of westar remained green. Picture 4 As shown in Figure B, there is no significant difference in chlorophyll content between the mutant and the wild type in the control group, and the chlorophyll content of the mutant in the treatment group is significantly decreased compared with the wild type. BAK The loss of the gene will affect the accumulation of chlorophyll when rapeseed encounters waterlogging stress during the seedling stage.

[0059] Therefore, the present invention destroys BAK The function of the gene realizes the reduction of flooding tolerance of Brassica napus under waterlogging stress.

[0060] Example 3 Detection of BnBAK copy gene expression under flooding stress Wild-type westar seeds of rapeseed were sterilized with 5% (v / v) NaClO, washed with sterile deionized water for 5 times, and then inoculated on 1 / 2MS medium. They were grown under white light for 36 hours. White seeds of the treatment group were transferred to a 5.0 mL centrifuge tube filled with sterile deionized water. After 12 hours of flooding, the seeds of each group were tested. BnBAK Expression level detection. The detection results are as follows Picture 5 As shown, BnaA04.BAK7 , BnaA08.BAK1 , BnaC07.BAK1 , BnaA03.BAK1 The gene was significantly induced by flooding stress, and BnaA04.BAK7 The gene with the highest fold induction. BnaC03.BAK7 Genes and BnaA03.BAK7 The overall gene expression level, and BnaA07.BAK7 Gene, BnaC07.BAK7 The gene was significantly suppressed under flooding stress. BnaC07.BAK1 There is no significant difference in gene expression under flooding stress. BnaA04.BAK7 The gene expression was induced to the greatest extent by flooding stress.

[0061] Example 4 Obtaining overexpression mutants The BnIR website (https: / / yanglab.hzau.edu.cn / ) BnaA04.BAK7 The CDS sequence of BnaA04.BAK7 Full-length CDS sequence.

[0062] Amplification BnaA04.BAK7 Sequence primers: F: AGAGAACACCTGCAGGTCGAC ATGGAACAAGGAAGAACACCCC; R:ACCCGGGGATCCTCTAGAGTCTCTTGGACCCGATAGGTAATC.

[0063] pCAMBIA1300 35S: GFP (C) vector plasmid was digested with SalI restriction endonuclease and homologous recombination was used to transform BnaA04.BAK7 The gene fragment was recombined with restriction enzyme-cut plasmid to obtain pCAMBIA1300 35S:BnaA04.BAK7-GFP vector.

[0064] The method of transferring the final vector into Agrobacterium and obtaining the mutant plant is as described in Example 1, and finally obtaining BnaA04.BAK7 Gene overexpression plants BnaA04.BAK7 Detection of gene expression, such as Picture 6 As shown, in the overexpression lines BnaA04.BAK7 The gene is in an overexpressed state.

[0065] Example 5 Observation of waterlogging phenotype of overexpressing plants Take rapeseed wild-type Westar seeds and the BnaA04.BAK7-GFP The overexpression strain was disinfected with 5% (v / v) NaClO, washed 5 times with sterile deionized water, and then inoculated on 1 / 2MS medium. It was grown under white light for 36 hours. The white seeds of the treatment group were transferred to a 5.0 ml centrifuge tube filled with sterile deionized water and flooded for 6 hours. The treated seeds were then transferred to 1 / 2MS solid medium to resume growth for 2 days. The control group was grown on 1 / 2MS solid medium throughout the whole process as the control group. Three biological replicates were set up for each control group and treatment group to detect the phenotype of each plant. The results are shown in Picture 7 As shown, after waterlogging stress at the germination stage, 35S: BnaA04.BAK7 The hypocotyl length of the transgenic material is significantly longer than that of the wild type, while there is no significant difference in the hypocotyl length between the two under normal culture conditions. BnaA04.BAK7 Gene overexpression alleviated the growth inhibition of hypocotyls of rapeseed under waterlogging stress during the germination stage.

Claims

1. BAK The application of the gene in enhancing the flooding tolerance of rapeseed is characterized in that: Said BAK Gene BnaA04.BAK7 gene; BnaA04.BAK7 The accession number of the gene in the gene bank is BnaA04g0150000WE.

2. The use according to claim 1, characterized in that: The application pathways are: (1) Through overexpression BAK Genes that enhance plants' ability to withstand flooding; or, (2) by destroying BAK The expression of genes reduces the plant's ability to tolerate flooding.

3. The use according to claim 2, characterized in that: The overexpression BAK Gene, including the following steps: (1) Using wild-type rapeseed cDNA as a template, primer sequences were designed to construct BAK Gene overexpression vectors; (2) Transforming the vector into Agrobacterium competent cells to obtain overexpression BAK Agrobacterium tumefaciens of genes; (3) Include BAK Agrobacterium carrying the gene overexpression vector was transferred into the explants of common wild-type rapeseed, and seedlings were obtained by tissue culture. BAK Gene overexpression plants.

4. The use according to claim 2, characterized in that: The destruction BAK Gene expression includes the following steps: (1) Based on BAK Gene target sequence, sgRNA design, and CRISPR / Cas9 vector construction; (2) constructing an Agrobacterium genetically engineered bacterium containing the CRISPR / Cas9 vector described in step (1); (3) transforming the genetically engineered bacteria containing the CRISPR / Cas9 vector described in step (2) into Brassica napus to obtain a homozygous mutant strain that does not contain exogenous Cas9 protein and is stably inherited; Said BAK Gene BnaA04.BAK7 gene; BnaA04.BAK7 The accession number of the gene in the gene bank is BnaA04g0150000WE.

5. The use according to claim 4, characterized in that The nucleotide sequence of the sgRNA is shown in SEQ ID NO.2~3.

6. Application of BAK protein in enhancing the flooding tolerance of rapeseed, characterized in that: The BAK protein is BnaA04.BAK7 protein; the accession number of the BnaA04.BAK7 protein in the gene bank is BnaA04g0150000WE.

7. Application of the recombinant vector in enhancing the flooding tolerance of rapeseed, characterized in that: The recombinant vector comprises BAK gene; BAK Gene BnaA04.BAK7 gene; BnaA04.BAK7 The accession number of the gene in the gene bank is BnaA04g0150000WE.

8. The use of genetically engineered bacteria in enhancing the flood resistance of rapeseed, characterized in that: The genetically engineered bacteria comprises BAK gene; BAK Gene BnaA04.BAK7 Gene, or BnaA04.BAK7 Gene, BnaC03.BAK7 Gene, BnaA03.BAK7 Gene, BnaA07.BAK7 Genes and BnaC07.BAK7 Gene; or BnaC07.BAK1 Gene, BnaA03.BAK1 Gene, BnaC01.BAK1 Genes and BnaA08.BAK1 Gene; Said BnaA04.BAK7 The gene accession number in the gene bank is BnaA04g0150000WE; BnaC03.BAK7 The gene accession number in the gene bank is BnaC03g0413100WE; BnaA03.BAK7 The gene accession number in the gene bank is BnaA03g0402600WE; BnaA07.BAK7 The gene accession number in the gene bank is BnaA07g0046900WE; BnaC07.BAK7 The gene accession number in the gene bank is BnaC07g0066700WE; BnaC07.BAK1 The gene accession number in the gene bank is BnaC07g0455300WE; BnaA03.BAK1 The gene accession number in the GenBank is BnaA03g0542200WE; Said BnaC01.BAK1 The gene accession number in the gene bank is BnaC01g0030300WE; BnaA08.BAK1 The accession number of the gene in the gene bank is BnaA08g0124100WE.

9. A method for enhancing the flooding tolerance of rapeseed, characterized in that: The following steps are involved: (1) Based on BAK Gene sequence, construction of overexpression vector; (2) constructing an Agrobacterium genetically engineered bacterium containing the overexpression vector described in step (1); (3) transforming the genetically engineered bacteria containing the overexpression vector described in step (2) into rapeseed to obtain a rapeseed strain with enhanced flooding tolerance; Said BAK Gene BnaA04.BAK7 gene; BnaA04.BAK7 The accession number of the gene in the gene bank is BnaA04g0150000WE.

Images