IDH1 R132H site mutation method and application of IDH1 R132H site mutation method in inhibition of cancer cell proliferation

Abstract

The invention relates to the technical field of biology, and discloses an IDH1R132H site mutation method which comprises the following steps: establishing a tumor research model for inducing IDH1R132H mutation; preparing a gRNA plasmid or a gRNA virus of a targeted IDH1 gene R132 site; inducing the IDH1R132H mutation of the tumor cells by using the gRNA plasmid or the gRNA virus; wherein the nucleotide sequence of the gRNA is as shown in SEQ ID NO. 1; the invention also discloses an application of the IDH1R132H site mutation method in inhibition of cancer cell proliferation. According to the invention, rapid establishment of a malignant tumor research model for inducing IDH1R132H mutation is realized, gRNA of an IDH1 gene R132 site is targeted, and the method can be applied to drugs for inhibiting cancer cell proliferation and therapeutic schedules.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a method for mutating an IDH1 R132H site and an application thereof in inhibiting cancer cell proliferation. Background Art

[0002] The IDH1 (isocitrate dehydrogenase 1) gene encodes a key enzyme in cell metabolism, mainly involved in the citric acid cycle (also known as the tricarboxylic acid cycle). The function of this enzyme is to convert isocitrate into α-ketoglutarate (α-KG) and produce reduced nicotinamide adenine dinucleotide (NADPH) in the process. NADPH plays an important role in the antioxidant and other metabolic processes of cells.

[0003] IDH1 mutations are closely related to the occurrence of these tumors. Among them, the most common mutation of IDH1 is the IDH1R132H mutation, that is, a point mutation occurs in the amino acid at position 132 of the IDH1 gene, causing the original amino acid to be replaced by histidine (H). The mutation will cause changes in the function of the IDH1 enzyme, causing it to produce 2-hydroxyglutarate (2-HG) instead of normal α-ketoglutarate. 2-HG is a metabolite that can inhibit more than 80 α-KG-dependent dioxygenases, thereby interfering with normal cellular functions, including affecting DNA repair and transcriptional regulation, and thus affecting the occurrence and development of tumors.

[0004] Under normal physiological conditions, wild-type IDH1 catalyzes the conversion of isocitrate into α-ketoglutarate (a-KG) and does not produce 2-hydroxyglutarate (2-HG). Once the R132H mutation occurs, the enzyme activity of IDH1 changes, and the mutant IDH1 R132H further catalyzes a-KG into 2-HG, a metabolite that accumulates and plays a carcinogenic role in tumor cells.

[0005] Existing treatment options mainly use drugs to inhibit the activity of IDH1 R132H mutation to control tumor progression. Current research and drugs (such as Ivosidenib) mainly focus on binding to mutant IDH1 to reduce the production of 2-hydroxyglutarate (2-HG), thereby alleviating the abnormal high methylation state of DNA and histones caused by 2-HG, helping cells to restore normal differentiation and inhibit tumor cell proliferation.

[0006] However, in the field of glioma, patients with mutant IDH1 tumors often have better clinical prognosis (reference: DOI:10.1126 / scitranslmed.aaq1427), and IDH1 mutant gliomas respond better to anti-tumor therapy than IDH1 wild-type (WT) gliomas. Treating malignant tumors by inducing IDH1 R132H mutation is a promising new treatment approach.

[0007] To this end, a reliable method for inducing the IDH1 R132H mutation is needed. Summary of the invention

[0008] The purpose of the present invention is to provide a method for mutating the IDH1 R132H site and its application in inhibiting cancer cell proliferation, so as to solve the technical problem of how to induce IDH1 R132H mutation in the prior art.

[0009] In order to solve the above technical problems, the present invention specifically provides the following technical solutions:

[0010] The present invention provides a method for mutating the IDH1 R132H site, comprising the following steps:

[0011] Establish a tumor research model that induces IDH1 R132H mutation;

[0012] Prepare a gRNA plasmid or gRNA virus targeting the R132 site of the IDH1 gene;

[0013] Using the gRNA plasmid or virus to induce IDH1 R132H mutation in the tumor cells;

[0014] Among them, the nucleotide sequence of gRNA is shown in SEQ ID NO.1.

[0015] As a preferred embodiment of the present invention, the method specifically comprises the following steps:

[0016] The cells were cultured to about 50-70% confluence and Polybrene was added to obtain cell fluid;

[0017] Dilute the lentivirus or adenovirus solution of the CBE editor to an appropriate concentration, mix well and add to the cell culture medium, add the culture medium containing Polybrene and the CBE editor virus to the cell solution, mix well, and obtain the virus solution;

[0018] The virus solution was placed in an incubator at 37° C. and 5% CO 2 for 6-12 hours, the virus supernatant was discarded, and the culture medium was replaced with fresh culture medium and continued to be cultured for 24-48 hours to allow the CBE editor to be fully expressed;

[0019] 48-72 hours after transfection, use puromycin to screen positive cells, and gradually reduce the drug concentration to select monoclonal cells with strong drug tolerance, select the constructed cell line that stably expresses CBE editor, and prepare gRNA plasmid or gRNA virus;

[0020] The gRNA plasmid or the gRNA virus is introduced into a stable tumor cell line by liposome-mediated transfection or viral infection. Fresh culture medium is replaced 6-12 hours after transfection, and culture is continued for 24-48 hours to obtain tumor cells with stable mutations.

[0021] The present invention also provides an application of a mutation method of IDH1 R132H site in inhibiting the proliferation of cancer cells, wherein the cancer cells include renal cancer cells and brain glioma cells.

[0022] The present invention also provides an application of a mutation method for an IDH1 R132H site in the preparation of a product for inhibiting cancer cell proliferation, wherein the product contains the gRNA or the gRNA virus.

[0023] The present invention also provides an application of gRNA in preparing a product for inhibiting cancer cell proliferation.

[0024] Compared with the prior art, the present invention has the following beneficial effects:

[0025] The present invention uses CRISPR / Cas9 technology to provide a new means of inducing IDH1 R132H mutation in vitro through a cytosine base editor (CBE). By designing a specific gRNA sequence SEQ ID NO.1, it can efficiently and accurately target the R132 site of the IDH1 gene for editing, thereby achieving precise introduction of the mutation.

[0026] The present invention discloses a method for inducing IDH1 R132H mutation by gRNA, which can inhibit the proliferation of cancer cells including brain glioma, renal cancer cells, etc., so that the production rate of cancer cells decreases, has little effect on normal cells, and reduces the side effects of mutation;

[0027] The mutation method provided by the present invention can be applied to the treatment process of cancer cells, and can increase the sensitivity of cancer to drugs under the action of other drugs, thereby improving the treatment effect. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] In order to more clearly illustrate the implementation methods of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for the implementation methods or the description of the prior art. Obviously, the drawings in the following description are only exemplary, and for ordinary technicians in this field, other implementation drawings can be derived from the provided drawings without creative work.

[0029] Figure 1 A schematic diagram of a method for mutating the IDH1 R132H site is provided for the present invention;

[0030] Figure 2 The present invention provides the Western blot diagram shown in Example 1;

[0031] Figure 3 The present invention provides a graph showing changes in the content of α-KG in 786-O cells before and after transfection with the gRNA sequence shown in Example 1;

[0032] Figure 4 The present invention provides a graph showing changes in the content of α-KG in U251 cells before and after transfection with the gRNA sequence shown in Example 1;

[0033] Figure 5 The present invention provides a graph showing changes in 2-HG content in 786-O cells before and after transfection with the gRNA sequence shown in Example 1;

[0034] Figure 6 The present invention provides a graph showing changes in 2-HG content in U251 cells before and after transfection with the gRNA sequence shown in Example 1;

[0035] Figure 7 The present invention provides a line graph of cell growth rate measured by CCK8 after inducing 786-O cells to produce IDH1 R132H mutation as shown in Example 1;

[0036] Figure 8 The present invention provides a line graph of cell growth rate measured by CCK8 after inducing A498 cells to produce IDH1 R132H mutation as shown in Example 1;

[0037] Fig. 9 The present invention provides a line graph of cell growth rate measured by CCK8 after inducing U251 cells to produce IDH1 R132H mutation as shown in Example 1;

[0038] Fig.10 The present invention provides a line graph of cell growth rate measured by CCK8 after inducing immortalized renal tubular epithelial cells to produce IDH1 R132H mutation as shown in Example 1;

[0039] Fig.11 The present invention provides a line graph of subcutaneous tumor volume growth established from the 786-O cell line with IDH1 R132H mutation and the parental 786-O cell line as shown in Example 3. DETAILED DESCRIPTION

[0040] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0041] like Figure 1 As shown, the present invention provides a method for mutating the IDH1 R132H site, comprising the following steps:

[0042] Culture the cells to be transfected to the logarithmic growth phase to ensure that the cells are in good condition. Inoculate the cells at an appropriate density in a culture dish or 6-well plate and culture to about 50-70% confluence for viral transfection. Add Polybrene (recommended concentration is 4-8μg / mL, the specific concentration is optimized according to the tolerance of the cell line) before viral transfection to enhance the efficiency of viral infection.

[0043] Dilute the CBE editor lentivirus or adenovirus solution to an appropriate concentration, mix well, and add to the cell culture medium. Add the culture medium containing Polybrene and CBE editor virus to the cells and mix gently. Incubate in a 37°C, 5% CO2 incubator for 6-12 hours, discard the viral supernatant, replace with fresh culture medium and continue to culture for 24-48 hours to ensure that the CBE editor is fully expressed.

[0044] 48-72 hours after transfection, puromycin was used to select positive cells, and the drug concentration was gradually reduced to select monoclonal cells with strong drug tolerance. Single cells were diluted to 96-well plates and cultured as monoclones, expanded, and verified whether the monoclones had successfully integrated the CBE editor.

[0045] Select a cell line that has been constructed to stably express the CBE editor and prepare sgRNA plasmid or virus according to the recommended ratio.

[0046] The sgRNA is introduced into the stable cell line by liposome-mediated transfection or viral infection. Fresh culture medium is replaced 6-12 hours after transfection, and culture is continued for 24-48 hours. Genomic DNA is extracted for PCR amplification, and the editing efficiency is detected by Sanger sequencing or high-throughput sequencing.

[0047] The present invention utilizes CRISPR / Cas9 technology to provide a new means of inducing IDH1 R132H mutation in vitro through a cytosine base editor (CBE). By designing a specific gRNA sequence: GCATGACGACCTATGATGAT, the R132 site of the IDH1 gene can be efficiently and accurately targeted for editing, thereby achieving precise introduction of mutations. A method for inducing IDH1R132H mutation in a variety of cancer cell lines is proposed, which is highly feasible and easy to operate.

[0048] The present invention proposes to provide a malignant tumor research model for inducing IDH1 R132H mutation, and discloses technical means for inducing IDH1R132H mutation. It can induce IDH1 R132H mutation through gRNA, inhibit the malignant growth of tumors, increase the sensitivity of tumors to existing treatment methods such as radiotherapy, and has low side effects and no significant toxicity to the kidneys and liver of mice.

[0049] In the field of glioma, patients with IDH1 R132H mutations generally have a better prognosis than patients with wild-type IDH1. IDH1 R132H mutations are more common in low-grade gliomas and a small number of glioblastomas, and are considered to be associated with a better survival prognosis. Studies have shown that patients with gliomas with IDH1 mutations generally have slower tumor growth and are less malignant than gliomas with wild-type IDH1. Although the accumulation of 2-HG caused by mutant IDH1 promotes certain cancer-promoting processes, it also limits the proliferation of tumor cells to a certain extent and may increase sensitivity to treatment, so that patients with IDH1 mutations generally have longer progression-free survival (PFS) and overall survival (OS).

[0050] Therefore, the present invention innovatively proposes a scheme for treating glioma by inducing IDH1 R132H, and for the first time proposes that inducing IDH1 R132H mutation can be used to treat renal cancer.

[0051] The following provides examples:

[0052] Embodiment 1:

[0053] (1) In vitro transfection

[0054] Culture the cells to be transfected to the logarithmic growth phase to ensure that the cells are in good condition. Inoculate the cells at an appropriate density in a culture dish or 6-well plate and culture to about 50-70% confluence for viral transfection. Add Polybrene (recommended concentration is 4-8μg / mL, the specific concentration is optimized according to the tolerance of the cell line) before viral transfection to enhance the efficiency of viral infection.

[0055] Dilute the CBE editor lentivirus or adenovirus solution to an appropriate concentration, mix well, and add to the cell culture medium. Add the culture medium containing Polybrene and CBE editor virus to the cells and mix gently. Incubate in a 37°C, 5% CO2 incubator for 6-12 hours, discard the viral supernatant, replace with fresh culture medium and continue to culture for 24-48 hours to ensure that the CBE editor is fully expressed.

[0056] 48-72 hours after transfection, puromycin was used to select positive cells, and the drug concentration was gradually reduced to select monoclonal cells with strong drug tolerance. Single cells were diluted to 96-well plates and cultured as monoclones, expanded, and verified whether the monoclones had successfully integrated the CBE editor.

[0057] Select a cell line that has been constructed to stably express the CBE editor and prepare sgRNA plasmid or virus according to the recommended ratio.

[0058] The sgRNA is introduced into the stable cell line by liposome-mediated transfection or viral infection. Fresh culture medium is replaced 6-12 hours after transfection, and culture is continued for 24-48 hours. Genomic DNA is extracted for PCR amplification, and the editing efficiency is detected by Sanger sequencing or high-throughput sequencing.

[0059] (2) Verification of editing effects

[0060] Combined with Western blot, the expression level of the target gene or the changes in functional protein were detected to ensure that the gene editing system had successfully targeted the IDH1 R132 site.

[0061] Characterization (Western blot) Figure 2 shown.

[0062] from Figure 2 It can be seen that the gRNA sequence successfully edited the R132 site of the IDH1 gene.

[0063] (3) Mutation effect verification

[0064] 1. After inducing IDH1 R132H mutation in 786-O cells and U251 cells, the 2-HG and α-KG contents in the cells were detected using Elisa kit (aladdin). The results are shown in Figures 3 to 7 As shown, from Figures 3 to 6 It was found that after transfection with this gRNA sequence, the content of α-KG in cells can be reduced, the content of 2-HG in cells can be increased, and the function of IDH1 can be disabled.

[0065] 2. After inducing IDH1 R132H mutation in 786-O cells, U251 cells and A498 cells, CCK8 was used to measure the cell growth rate. The results are shown in Figures 7 to 9 The conclusion is that compared with wild-type cells, the growth rate of tumor cells with IDH1 R132H mutation is significantly reduced.

[0066] 3. This system was used to induce IDH1 R132H mutation in immortalized renal tubular epithelial cells, and CCK8 was used to measure cell growth rate. The results are shown in Fig.10 As shown, the conclusion is that the IDH1 R132H mutation in normal renal tubular epithelial cells does not affect cell growth and can have low side effects.

[0067] Embodiment 2:

[0068] According to the characteristics of the target organ tissue, select the appropriate AAV serotype (such as AAV8, AAV9, etc.) to ensure the efficient expression of the editor and sgRNA in the target tissue (such as liver, muscle or brain).

[0069] Construct an AAV vector containing a CBE editor and sgRNA, which contains expression cassettes encoding the CBE editor and sgRNA, respectively. Ensure that each AAV vector has a tissue-specific promoter (such as liver-specific promoter Alb, muscle-specific promoter MCK, etc.) to achieve precise expression. 12 GC / mL) is delivered to the whole body or specific tissues and organs of mice by tail vein injection, local injection, brain stereotaxic injection, etc. Tissue sampling of mice is performed at different time points (generally 1 week, 2 weeks, 4 weeks, and 8 weeks), and genomic DNA is extracted from target tissues (such as liver, muscle, or brain). PCR and Sanger sequencing are used to analyze the editing effect and evaluate whether the target site is successfully edited.

[0070] Embodiment 3:

[0071] Establishment of R132H subcutaneous tumor model

[0072] The stably transfected 786-O cell line with IDH1 R132H mutation and the parental 786-O cell line were subcutaneously injected to establish a nude mouse xenograft tumor model, and the tumor volume was measured regularly by vernier caliper.

[0073] Results Fig.11 ,Depend on Fig.11 It can be seen that compared with the tumor model established with the parental 786-O cell line, the tumor growth rate in the tumor model of the stably transfected 786-O cell line with the IDH1 R132H mutation was significantly inhibited, indicating that the IDH1 R132H mutation can inhibit the growth of cancer cells.

[0074] Through the mutation method of the IDH1 R132H site shown in the examples and its application in inhibiting the proliferation of cancer cells, it is possible to quickly establish a malignant tumor research model that induces the IDH1 R132H mutation, and target the gRNA at the R132 site of the IDH1 gene, which can be applied to drugs and treatment plans that inhibit the proliferation of cancer cells.

[0075] The above embodiments are only exemplary embodiments of the present application and are not intended to limit the present application. The protection scope of the present application is defined by the claims. Those skilled in the art may make various modifications or equivalent substitutions to the present application within the essence and protection scope of the present application, and such modifications or equivalent substitutions shall also be deemed to fall within the protection scope of the present application.

Claims

1. A method for mutating the IDH1 R132H site, characterized in that: The steps include: Establish a tumor research model that induces IDH1 R132H mutation; Prepare a gRNA plasmid or gRNA virus targeting the R132 site of the IDH1 gene; Using the gRNA plasmid or the gRNA virus to induce IDH1 R132H mutation in the tumor cells; Among them, the nucleotide sequence of gRNA is shown in SEQ ID NO.

1.

2. The method for mutating the IDH1 R132H site according to claim 1, characterized in that: The specific steps include: The cells were cultured to about 50-70% confluence and Polybrene was added to obtain cell fluid; Dilute the lentivirus or adenovirus solution of the CBE editor to an appropriate concentration, mix well and add to the cell culture medium, add the culture medium containing Polybrene and the CBE editor virus to the cell solution, mix well, and obtain the virus solution; The virus solution was placed in an incubator at 37° C. and 5% CO 2 for incubation for 6-12 hours, the virus supernatant was discarded, and the culture medium was replaced with fresh culture medium and continued to be cultured for 24-48 hours to allow the CBE editor to be fully expressed; 48-72 hours after transfection, use puromycin to screen positive cells, and gradually reduce the drug concentration to select monoclonal cells with strong drug tolerance, select the constructed cell line that stably expresses CBE editor, and prepare gRNA plasmid or gRNA virus; The gRNA plasmid or the gRNA virus is introduced into a stable tumor cell line by liposome-mediated transfection or viral infection. Fresh culture medium is replaced 6-12 hours after transfection, and culture is continued for 24-48 hours to obtain tumor cells with stable mutations.

3. An application of the IDH1 R132H site mutation method according to any one of claims 1 to 2 in inhibiting cancer cell proliferation, characterized in that: The cancer cells include renal cancer cells and brain glioma cells.

4. An application of the IDH1 R132H site mutation method according to any one of claims 1 to 2 in the preparation of a product for inhibiting cancer cell proliferation, characterized in that: The product contains the gRNA or the gRNA virus.

Images