Application of PKIA gene or SEMA6A gene as target spot in inhibition of breast cancer radiotherapy resistance cell proliferation

Abstract

The invention belongs to the technical field of biological genetic engineering, particularly relates to application of a PKIA gene or an SEMA6A gene as a target spot in inhibition of radiotherapy-resistant cell replication of breast cancer, and finds that by inhibiting or silencing the PKIA gene or the SEMA6A gene, the replication of radiotherapy-resistant breast cancer cells can be inhibited, and the radiotherapy-resistant breast cancer cell replication can be inhibited. The compound can be used as a target for preparing a medicine for inhibiting radiotherapy-resistant breast cancer cell proliferation; the small interfering RNA is designed by taking a PKIA gene or an SEMA6A gene as a target spot, and the small interfering RNA can interfere with duplication of radiotherapy-resistant breast cancer cells and can be used for preparing drugs for inhibiting proliferation of the radiotherapy-resistant breast cancer cells.

Description

Technical Field

[0001] The present invention belongs to the technical field of biological gene engineering, and specifically relates to the application of PKIA gene or SEMA6A gene as a target in inhibiting the proliferation of breast cancer radiotherapy-resistant cells. Background Art

[0002] Breast cancer is the most common malignant tumor in women and also the tumor with the highest mortality rate in women. It can be divided into four types according to estrogen receptor, progesterone receptor and human epidermal receptor 2: luminal A, luminal B, HER2 positive and triple negative. Among them, triple negative breast cancer has the highest malignancy and the worst prognosis. At present, the treatment methods for breast cancer include targeted therapy, hormone therapy, radiotherapy and surgery. Among them, radiotherapy is one of the important means of comprehensive treatment of breast cancer, but some patients will have radiotherapy resistance. Radiotherapy resistance means that breast cancer cells can continue to survive and proliferate after receiving radiotherapy, resulting in failure of local tumor control or recurrence, affecting the patient's prognosis. The generation of radiotherapy resistance is related to the intrinsic factors of tumor cells and the tumor microenvironment. Due to the existence of radiotherapy resistance, some patients have poor treatment effects and poor clinical benefits. In addition, due to individual differences in radiotherapy, there are huge differences in clinical efficacy and prognosis. Therefore, radiotherapy resistance is an important factor affecting the control rate and survival rate of breast cancer.

[0003] The PKIA (cAMP-Dependent Protein Kinase Inhibitor Alpha) gene mainly encodes an inhibitory protein α of cAMP-dependent protein kinase (PKA). It plays a key regulatory role in the intracellular signal transduction process. In neurological diseases, abnormalities in the PKIA gene may play a certain role. For example, in Alzheimer's disease (AD), abnormalities in PKIA may aggravate the symptoms of AD. In endocrine cells, changes in the PKIA gene may affect the activity of PKA, thereby interfering with the secretion of hormones in endocrine cells. In the cardiovascular system, PKA is involved in regulating physiological processes such as the contractility and heart rate of cardiomyocytes. Abnormalities in the PKIA gene may affect the activity of PKA, thereby changing the function of cardiomyocytes. However, there is currently no literature proving that it is associated with radiotherapy resistance in breast cancer.

[0004] The gene encodes Semaphorin 6A (SEMA6A), which is a member of the Semaphorin family. The Semaphorin family plays a key role in many physiological processes such as neural development, angiogenesis, and immune regulation. Mutations in the SEMA6A gene are associated with a variety of neurodevelopmental disorders. For example, in diseases such as autism spectrum disorder (ASD) and schizophrenia, abnormalities in the SEMA6A gene may cause problems with axon guidance. Failure of axons to grow and connect correctly will affect the normal construction of the brain's neural network, which may in turn lead to abnormalities in cognition, social interaction, and behavior. Defects in the SEMA6A gene have also been found in some cases of mental retardation, which may be due to errors in axon guidance during neural development, affecting the normal functional development of the brain. In vascular diseases, abnormal expression of SEMA6A may affect the normal process of angiogenesis. In the process of tumor angiogenesis, abnormal expression of SEMA6A may also promote the abnormal formation of tumor blood vessels, providing conditions for tumor growth and metastasis. In terms of immune-related diseases, changes in the SEMA6A gene may lead to imbalanced immune regulation. However, there is currently no literature proving that it is associated with radioresistance in breast cancer.

[0005] The present invention has found in the research process that by inhibiting or silencing the expression of PKIA gene or SEMA6A gene, the replication of radiotherapy-resistant breast cancer cells can be inhibited, and it can be used as a target for preparing drugs for inhibiting the replication of radiotherapy-resistant breast cancer cells. Based on this, the present invention uses PKIA gene or SEMA6A gene as a target and designs small interfering RNA, which can interfere with the replication of radiotherapy-resistant breast cancer cells and can be used to prepare drugs for inhibiting the replication of radiotherapy-resistant breast cancer cells. Summary of the invention

[0006] The primary purpose of the present invention is to provide the use of PKIA gene or SEMA6A gene as a target in screening drugs for preventing or treating breast cancer radiotherapy resistance, wherein the drug targets PKIA gene or SEMA6A gene and inhibits or silences the expression of PKIA gene or SEMA6A gene.

[0007] The second objective of the present invention is to provide an application of an agent for inhibiting the expression of PKIA gene or SEMA6A gene in the preparation of a drug for preventing or treating breast cancer radiotherapy resistance.

[0008] The third object of the present invention is to provide the use of a drug for inhibiting the expression of PKIA gene or SEMA6A gene in the preparation of a drug for preventing or treating breast cancer radiotherapy resistance.

[0009] Preferably, the reagent or drug is a small interfering RNA designed with the PKIA gene or the SEMA6A gene as a target.

[0010] Preferably, the small interfering RNA is the following siRNA:

[0011] hPKIA sense:GAUGCACAACGAAGUUCUATThPKIA antisense:UAGAACUUCGUUGUGCAUCTT.

[0012] The fourth objective of the present invention is to provide the use of PKIA gene or SEMA6A gene as a target in inhibiting the replication of breast cancer radiotherapy-resistant cells.

[0013] 1. The fifth object of the present invention is to provide the use of a small interfering RNA for inhibiting the expression of the PKIA gene in the preparation of a drug for increasing the radiosensitivity of breast cancer, wherein the small interfering RNA with the PKIA gene as a target is the following siRNA:

[0014] hPKIA sense:GAUGCACAACGAAGUUCUATT

[0015] hPKIA antisense:UAGAACUUCGUUGUGCAUCTT;

[0016] The small interfering RNA targeting the SEMA6A gene is the following siRNA:

[0017] hSEMA6A sense:GAUGCACAACGAAGUUCUATT

[0018] hSEMA6A antisense: UAGAACUUCGUUGUGCAUCTT.

[0019] The sixth object of the present invention is to provide the use of a small interfering RNA for inhibiting the expression of the SEMA6A gene in the preparation of a drug for increasing the radiosensitivity of breast cancer, wherein the small interfering RNA is the following siRNA:

[0020] hSEMA6A sense:GAUGCACAACGAAGUUCUATThSEMA6A antisense:UAGAACUUCGUUGUGCAUCTT.

[0021] The seventh object of the present invention is to provide a cell line with PKIA gene or SEMA6A gene knocked out, wherein the cell line is obtained by knocking out the PKIA gene through gene editing technology.

[0022] The beneficial effects of the present invention are: (1) The present invention finds that by inhibiting or silencing the PKIA gene or the SEMA6A gene, the replication of radiotherapy-resistant breast cancer cells can be inhibited, and the PKIA gene or the SEMA6A gene can be used as a target for preparing drugs for inhibiting the proliferation of radiotherapy-resistant breast cancer cells; (2) The present invention uses the PKIA gene or the SEMA6A gene as a target and designs a small interfering RNA, which can interfere with the replication of radiotherapy-resistant breast cancer cells and can be used to prepare drugs for inhibiting the proliferation of radiotherapy-resistant breast cancer cells. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 Comparison results of MDA-MB-231, BT-549 and corresponding radiotherapy-resistant cell lines after irradiation with 0, 1, 2, 3, 4, and 5 Gy doses

[0024] Figure 2 This is a flow chart for obtaining genes related to radiotherapy resistance through transcriptome and proteome sequencing.

[0025] Figure 3 Comparison of transfection efficiency of different siRNAs on PKIA gene

[0026] Figure 4 Comparison of transfection efficiency of different siRNAs on SEMA6A gene Figure 5 Comparison of cell proliferation ability before and after PKIA gene knockout Figure 6 Comparison of cell proliferation ability before and after SEMA6A gene knockout DETAILED DESCRIPTION

[0027] In order to make the purpose, technical scheme and advantages of the present invention clearer, the embodiments of the present invention will be described in detail below in conjunction with the accompanying drawings. However, it will be appreciated by those skilled in the art that in the embodiments of the present invention, many technical details are provided to enable the reader to better understand the present application. However, even without these technical details and various changes and modifications based on the following embodiments, the technical scheme claimed in the present application can be implemented.

[0028] Gene knockout refers to the process of inactivating or deleting a specific gene in an organism through certain technical means. This technology can be operated at the cellular level or the individual level to study the function of a specific gene. Commonly used technical means include homologous recombination technology and CRISPR-Cas9 technology.

[0029] Homologous recombination technology: It is the main method for early gene knockout. It is widely used in model organisms such as mice. It uses the homologous sequence of the gene to introduce DNA fragments containing exogenous screening marker genes into cells. These DNA fragments undergo homologous recombination with the target gene in the cell, and the cells that have undergone homologous recombination are screened out by screening marker genes. For example, when constructing gene knockout mice, the designed targeting vector (containing sequences homologous to the target gene and screening marker genes, such as neomycin resistance genes, etc.) is introduced into embryonic stem cells (ES cells), and then drug screening (such as neomycin screening) is used to obtain ES cells that have undergone homologous recombination, and then these cells are injected into blastocysts, which eventually develop into gene knockout mice.

[0030] CRISPR-Cas9 technology: It is currently the more commonly used and efficient gene knockout technology. The CRISPR-Cas9 system is derived from the bacterial immune system. Among them, the Cas9 protein is a nuclease, and the sgRNA (single guide RNA) can guide the Cas9 protein to bind to the specific sequence of the target gene. When the sgRNA is paired with the complementary sequence of the target gene, the Cas9 protein cuts the DNA double strand at the target site, causing a double-strand break (DSB). The cell's own repair mechanism may introduce insertion or deletion (indel) mutations when repairing DSBs, thereby destroying the reading frame of the target gene and causing gene inactivation. For example, when performing a gene knockout experiment in a cell line, the gene encoding the Cas9 protein and the sgRNA designed for the target gene can be co-transfected into the cell to achieve the knockout of a specific gene.

[0031] The clone formation experiment is a common experimental method for detecting cell proliferation ability and tumor cell activity. By calculating indicators such as the number and size of clone formation, the proliferation potential of cells under in vitro culture conditions can be understood. Normal cells and tumor cells have different proliferation abilities. Tumor cells often have higher proliferation activity. The clone formation experiment can reflect this difference. It can also be used to detect the effects of different treatment factors (such as drugs, radiation, etc.) on cell survival. For example, when studying the killing effect of a certain anticancer drug on tumor cells, observe the changes in the ability of cells to form clones after drug treatment.

[0032] siRNA interference technology (Small interfering RNAinterference technology) is an important gene silencing technology. There is a natural RNA interference (RNAi) phenomenon in cells. When exogenous or endogenous double-stranded RNA (dsRNA) enters the cell, it will be cut into small interfering RNA (siRNA) of 21-23 nucleotides in length by a nuclease called Dicer. siRNA is the key starting molecule of the RNA interference pathway. It consists of a sense strand and an antisense strand, with 2-3 protruding nucleotides at each end of the double strand. Subsequently, siRNA and some enzymes in the body form an RNA-induced silencing complex (RISC). In RISC, one strand of siRNA (usually the antisense strand) will guide RISC to complementary pair with the target mRNA, and then the nuclease in RISC will cut and degrade the target mRNA in the pairing area, thereby silencing the expression of specific genes and preventing the synthesis of corresponding proteins.

[0033] The experimental methods in the following examples are conventional methods unless otherwise specified; the experimental materials used in the following examples are purchased from conventional biochemical reagent companies unless otherwise specified.

[0034] Example 1: Construction of radiotherapy-resistant cell lines

[0035] The breast cancer MDA-MB-231 and breast cancer BT-549 cells used in the present invention were purchased from Wuhan Pronocell Biotechnology Co., Ltd.

[0036] Breast cancer MDA-MB-231 and breast cancer BT-549 cells were cultured in a 37°C 5% CO2 incubator. After the cells adhered to the wall, the two cells were induced by multiple single-dose 2Gy radiotherapy to screen out breast cancer cells with radiotherapy resistance.

[0037] The screened radiotherapy-resistant strains were verified by cloning experiments. After the cells adhered, breast cancer MDA-MB-231 cells, breast cancer BT-549 cells and the prepared radiotherapy-resistant strains were irradiated with a dose gradient of 0, 1, 2, 3, 4, and 5 Gy. The cells were cultured for 14 days and fixed with 4% paraformaldehyde fixative (Coolaber, Beijing). The cells were stained with crystal violet staining solution (Coolaber, Beijing) and the cell clones were counted and analyzed.

[0038] Figure 1This is the comparison result of breast cancer MDA-MB-231 and breast cancer BT-549 and the corresponding radiotherapy-resistant cell lines after irradiation with doses of 0, 1, 2, 3, 4, and 5 Gy. A is the plate after irradiation with different doses of radiation, and B is the cell survival curve drawn according to the cell clone-forming ability. After irradiation with different doses of radiation, the survival rate of the radiotherapy-resistant strain was higher than that of the control group, indicating that the radiotherapy-resistant breast cancer cell line was successfully constructed. They were named breast cancer MDA-MB-231-R and breast cancer BT-549-R, respectively.

[0039] Example 2: Multi-omics screening of genes associated with radiotherapy resistance in breast cancer

[0040] Breast cancer MDA-MB-231, breast cancer BT-549 and the corresponding radiotherapy-resistant cell lines were sent to Shanghai Biogene Technology Co., Ltd. for transcriptome sequencing and proteome sequencing, and |log2FC|≥1&q<0.05 were used as the difference conditions for screening.

[0041] Figure 2 This is a flow chart for obtaining genes related to radiotherapy resistance through transcriptome and proteome sequencing. The results of transcriptome sequencing showed that a total of 35,133 genes were measured in breast cancer MDA-MB-231 and breast cancer MAD-MB-231-R, of which 618 genes were differentially upregulated and 1,347 genes were differentially downregulated. A total of 33,139 genes were measured in breast cancer BT-549 and breast cancer BT-549-R, of which 1,885 genes were differentially upregulated and 1,951 genes were differentially downregulated.

[0042] The results of proteomic sequencing showed that a total of 6212 proteins were detected in breast cancer MDA-MB-231 and breast cancer MAD-MB-231-R, of which 108 proteins were differentially upregulated and 141 proteins were differentially downregulated; a total of 6322 proteins were detected in breast cancer BT-549 and breast cancer BT-549-R, of which 554 proteins were differentially upregulated and 667 proteins were differentially downregulated. The intersection of genes upregulated in both radiotherapy-resistant cell lines was taken, and 90 genes related to radiotherapy resistance were found.

[0043] Since non-coding genes cannot encode proteins, 22 non-coding genes were removed. Then, to remove false positive genes, we used PCR technology to detect the mRNA expression level of radioresistance genes.

[0044] The method for extracting mRNA is:

[0045] (1) Add 1 ml of total RNA extraction reagent to the cells and lyse them on ice for 15 minutes;

[0046] (2) Add 200 μl of chloroform, shake and mix, let stand for 3 minutes, and then centrifuge at 11000 rpm for 15 minutes

[0047] (3) Pipette 500 μl of supernatant, add 500 μl of isopropanol, mix by inversion, let stand for 10 minutes, centrifuge at 11000 rpm for 10 minutes, and discard the supernatant;

[0048] (4) Add 1 ml of 75% ethanol and centrifuge at 7500 rpm for 5 min. Discard the supernatant. Repeat twice, invert and dry, then add DEPC water to dissolve again. Use NanoDrop2000 (ThermoFisher, USA) to measure the concentration of the extracted mRNA.

[0049] (5) Reverse transcribe mRNA into cDNA using the TIANGEN FastKing one-step reverse transcription kit.

[0050] q-PCR quantitative analysis was performed using the Thermo Fisher Scientific QuantStudio TM 3. The real-time fluorescence quantitative PCR system was used for experimental operation to calculate the relative mRNA expression level of radioresistance genes.

[0051] The results of PCR experiments showed that the mRNA expression levels of 47 genes were upregulated in both radiotherapy-resistant cell lines. Therefore, these 47 genes were identified as radiotherapy resistance-related genes, as follows: AIM2, WT1, ALDH1A3, XDH, ESM1, B4GALT6, GLS, C1GALT1C1L, KIF21B, CACNA2D1, NRP2, CAPN5, P2RY6, DAW1, PTPN22, DYNC1I1, RAP1GAP, ELMO1, T PK1, EVC, VDR, EYA4, FAM167A, RARB, FYB1, RNASEH2C, GALNT14, RTN1, hGRAMD1B, SEMA6A, HDGFL3, SPANXB1, hHL A-A, SPANXD, ITGA2, SRI, KCNN2, SVIP, LPXN, TAAR1, hNEDD4, TGFBI, PKIA, TP53I11, PLEKHG4B, VEPH1, hPANX2.

[0052] Example 3: Verification of knocking down radiotherapy resistance genes in breast cancer using siRNA interference technology

[0053] To further verify that the screened genes are associated with radiotherapy resistance, we used siRNA interference technology to knock down the 47 screened genes in breast cancer MDA-MB-231 and breast cancer BT-549 cells, and then used CCK8 to detect cell proliferation ability after 4Gy radiotherapy; the experimental results showed that PKIA gene and SEMA6A gene are associated with radiotherapy resistance in breast cancer.

[0054] Then, multiple groups of siRNA were designed with the PKIA gene as the target. Finally, the two groups of siRNA obtained by screening did not interfere with other genes besides the PKIA gene. The sequences of the two groups of siRNA are as follows:

[0055] name sequence hPKIAsi-1sense GAUGCACAACGAAGUUCUATT hPKI Asi-1antisense UAGAACUUCGUUGUGCAUCTT hPKIAsi-2sense GGAAGAACAGGUAGAAGAATT hPKIAsi-2antisense UUCUUCUACCUGUUCUUCCTT

[0056] The above two groups of siRNA were verified by PCR, and the transfection efficiency of hPKIA si-2 was higher (e.g. Figure 3 As shown in Figure 2, hPKIA si-2 was selected in the subsequent experiments. The primer sequences used in the PCR experiment were:

[0057] name sequence PKIA-F GCCTTGAAATTAGCAGGTCTTGA PKIA-R GCTTCCCCACTTTGTTCTGTAG

[0058] Then, multiple groups of siRNA were designed with SEMA6A gene as the target. Finally, the two groups of siRNA screened out did not interfere with other genes besides SEMA6A gene. The sequences of the two groups of siRNA are as follows:

[0059] name sequence hSEMA6Asi-1sense UGCUGCUAGGGACCAUAUUUATT hSEMA6Asi-1antisense UAAAUAUGGUCCCUAGCAGCATT hSEMA6Asi-2sense CCGAUGUAGACACAUGCAGAATT hSEMA6Asi-2antisense UUCUGCAUGUGUCUACAUCGGTT

[0060] The above two groups of siRNAs were verified by PCR, and the transfection efficiency of hSEMA6A si-1 was higher (e.g. Figure 3 As shown in Figure 2, hSEMA6Asi-1 was selected in subsequent experiments. The primer sequences used in the PCR experiment were:

[0061] name sequence SEMA6A-F AATCAGTATTTCGCATGGCAACT SEMA6A-R GCAATGTAGAGGGTTCCGTTCA

[0062] The specific implementation steps are as follows:

[0063] (1) One day before transfection, transfer cells in good growth condition to a 24-well plate and add 10 5 cells and ensure that the cell density is 50%-70% during transfection.

[0064] (2) 1.5 μl Lipofectamine TM 3000 Reagent was diluted with 25 μl Opti-MEM medium, and 2.5 μl 20 μM siRNA was diluted with 25 μl Opti-MEM medium. The two liquids were gently mixed and incubated at room temperature for 15 minutes.

[0065] (3) Rinse the cells three times with PBS, add 450 μl Opti-MEM medium and 50 μl transfection solution, place in a cell culture incubator for 6-8 hours, and replace with normal medium.

[0066] (4) 48 hours after transfection, the cells were irradiated with 4 Gy, and the cell proliferation capacity was measured 24 hours later.

[0067] The results are as follows Figure 5 As shown in the figure, after knocking out PKIA, the cell viability in breast cancer MDA-MB-231 and breast cancer BT-549 cells was significantly reduced to below 70%. Therefore, PKIA was identified as the final radiotherapy resistance gene screened.

[0068] The results are as follows Figure 6 As shown in the figure, after knocking out the SEMA6A gene, the cell viability in both MDA-MB-231 and BT-549 cells dropped significantly to below 70%. Therefore, the SEMA6A gene was identified as the final radiotherapy resistance gene screened.

[0069] In summary, the present invention found that by inhibiting or silencing the PKIA gene SEMA6A gene, the replication of radiotherapy-resistant breast cancer cells can be inhibited, and the gene can be used as a target for preparing drugs for inhibiting the proliferation of radiotherapy-resistant breast cancer cells; (2) The present invention uses the PKIA gene SEMA6A gene as a target and designs a small interfering RNA. The small interfering RNA can interfere with the replication of radiotherapy-resistant breast cancer cells and can be used to prepare drugs for inhibiting the proliferation of radiotherapy-resistant breast cancer cells.

Claims

1. Use of the PKIA gene or the SEMA6A gene as a target in screening drugs for preventing or treating breast cancer radiotherapy resistance, wherein the drug targets the PKIA gene or the SEMA6A gene and inhibits or silences the expression of the PKIA gene or the SEMA6A gene.

2. Use of agents that inhibit the expression of PKIA gene or SEMA6A gene in the preparation of drugs for preventing or treating breast cancer radiotherapy resistance.

3. The use of drugs that inhibit the expression of PKIA gene or SEMA6A gene in the preparation of drugs for preventing or treating breast cancer radiotherapy resistance.

4. The use according to claim 2 or 3, characterized in that The reagent or drug is a small interfering RNA designed with the PKIA gene or the SEMA6A gene as a target.

5. The use according to claim 4, characterized in that The small interfering RNA targeting the PKIA gene is the following siRNA: hPKIA sense:GAUGCACAACGAAGUUCUATT hPKIA antisense:UAGAACUUCGUUGUGCAUCTT; The small interfering RNA targeting the SEMA6A gene is the following siRNA: hSEMA6A sense:GAUGCACAACGAAGUUCUATT hSEMA6A antisense: UAGAACUUCGUUGUGCAUCTT.

6. Application of PKIA gene or SEMA6A gene as a target to inhibit the replication of radioresistant breast cancer cells.

7. Use of a small interfering RNA that inhibits PKIA gene expression in the preparation of a drug for increasing breast cancer radiotherapy sensitivity, wherein the small interfering RNA is the following siRNA: hPKIA sense:GAUGCACAACGAAGUUCUATT hPKIA antisense:UAGAACUUCGUUGUGCAUCTT.

8. Use of a small interfering RNA that inhibits the expression of the SEMA6A gene in the preparation of a drug for increasing the radiosensitivity of breast cancer, wherein the small interfering RNA is the following siRNA: hSEMA6A sense:GAUGCACAACGAAGUUCUATT hSEMA6A antisense: UAGAACUUCGUUGUGCAUCTT.

9. A cell line with PKIA gene or SEMA6A gene knocked out, characterized in that: The cell line is obtained by knocking out the PKIA gene through gene editing technology.

Images