Molecular markers and specific primers and identification method for identifying t. obscurus, t. jordani and hybrid t. obscurus x t. jordani

The multiplex PCR amplification method using InDel molecular markers and specific primers has solved the problem of rapid and accurate identification of pufferfish, redfin pufferfish, and hybrid pufferfish, achieving low-cost and efficient identification that is suitable for germplasm conservation and scientific research.

CN119776544BActive Publication Date: 2026-05-29HOHAI UNIV

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
HOHAI UNIV
Filing Date
2025-01-24
Publication Date
2026-05-29

AI Technical Summary

Technical Problem

Existing technologies struggle to quickly and accurately distinguish between the dark-spotted pufferfish, the red-finned pufferfish, and the hybrid pufferfish. Traditional morphological identification methods have a high error rate, while high-throughput sequencing methods are costly and unsuitable for large-scale identification.

Method used

Using InDel molecular markers and specific primers, we designed specific primers to identify genomic differences in *Pueraria lobata*, *Pueraria rubra*, and hybrid pufferfish via multiplex PCR amplification combined with agarose gel electrophoresis, enabling rapid and accurate species identification.

Benefits of technology

This technology enables rapid identification of three fish species using only a single PCR test, reducing testing costs and improving identification accuracy and result readability. It is suitable for germplasm conservation and scientific research.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119776544B_ABST
    Figure CN119776544B_ABST
Patent Text Reader

Abstract

The application discloses a molecular marker and specific primers and an identification method for identifying Takifugu obscurus, Takifugu poecilonotus and hybrid Arlea japonica. The application can realize multiple test results through one-time PCR, and simultaneously complete the rapid identification of the three species of Takifugu obscurus, Takifugu poecilonotus and hybrid Arlea japonica. The application provides a fast and accurate identification method for Arlea japonica variety identification, solves the problems of difficult naked-eye differentiation and low operation accuracy of morphological feature differentiation, and realizes the characteristics of easy result judgment, high conservation, high accuracy and the like. The application provides technical support for variety identification and parent selection of the special economic fish, provides a train of thought for further carrying out genetic scientific research of hybrid Arlea japonica, and is favorable for promoting the vigorous development of the hybrid Arlea japonica breeding industry.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic information identification of rare and endemic fish, and specifically relates to a molecular marker, specific primers and identification method for identifying pufferfish, redfin pufferfish and hybrid pufferfish. Background Technology

[0002] Pufferfish belong to the class Osteichthyes, order Tetrodontiformes, and family Tetradontidae. The dark-spotted pufferfish (Takifugu obscurus) is a typical migratory fish in the Yangtze River basin of China and a major freshwater aquaculture species, renowned as one of the "Three Delicacies of the Yangtze River." Its male testes are even praised as "Xi Shi Tofu." The red-finned pufferfish (Takifugu rubripes) is a major pufferfish species farmed in marine environments in northern China. Due to its ferocity, large size, and unique markings, it is also known as the "Tiger Pufferfish." This species is characterized by rapid growth, large size, and strong resistance to low temperatures. In recent years, in-depth research on hybrid breeding technology has been reported (Gao FX, Lu WJ, Shi Y, et al. Transcript ome profiling revealed the growth superiority of hybrid pufferfish derived from Takifu guobscurus♀×Takifugu rubripes♂[J]. Comparative Biochemistry and Physiology Part D: Genomics and Proteomics, 2021, 40: 100912. [2] Wang C, Shi Y, Gao Y, et al. Construction of a Growth Model and Screening of Growth-Related Genes for a Hybrid Puffer(Takifugu obscurus♀×Takifugu rubripes♂)[J].Fishes,2024,9(10):404.) Dark-spotted pufferfish and red-finned pufferfish can be hybridized to produce offspring hybrid pufferfish (Dark-spotted pufferfish♀×Red-finned pufferfish♂) with advantages such as growth advantage, rich nutrition, aquaculture in both fresh and sea water, and strong resistance. At the same time, with the gradual opening of the consumer market, pufferfish have shown great market development potential.

[0003] In recent years, with the emergence of hybrid pufferfish and the expansion of the market, pufferfish have also faced the challenge of germplasm protection. However, the morphological characteristics of *Pueraria lobata* and *Pueraria rubiginosa* are similar, especially the hybrid pufferfish, which are difficult to distinguish from their parents with the naked eye. This has impacted efforts to preserve aquatic breeds, interspecific hybridization breeding, and scientific research on related species. Traditional identification methods that construct species discrimination formulas based on morphological characteristics are simple but have a high error rate and are not suitable for rigorous preservation work. While high-throughput sequencing methods based on detecting species genotypes, such as single nucleotide polymorphisms, can distinguish species, these require expensive sequencing costs and high-precision instruments, making them unsuitable for large-scale germplasm identification and related scientific research. Therefore, the problem of how to develop a simple, inexpensive, and highly accurate method for identifying *Pueraria lobata*, *Pueraria rubiginosa*, and hybrid pufferfish to provide technical support for pufferfish breeding, preservation, and related species research urgently needs to be solved.

[0004] The genomic genetic information of a species is highly conserved, genetically stable, and exhibits interspecific differences, thus it is frequently used to analyze species evolution and classification. However, obtaining comprehensive genetic information during research requires specialized personnel to perform genome sequencing analysis, which demands high levels of expertise in experimental equipment, data analysis, and interpretation. Molecular markers, as tags of genetic information, possess characteristics of conservation, stability, and representativeness, and are widely used in germplasm identification, genetic selection, and population genetic analysis. Conducting research on the genetic molecular markers of *Puerlotus pufferfish*, *Puerlotus ruber*, and hybrid pufferfish not only helps to understand their molecular biological characteristics and improve our understanding of their genetic background, but also provides a theoretical basis for the preservation of superior breeds and the identification of hybrids. In recent years, existing species identification techniques have largely focused on SNP sequencing and SSR analysis. SNP sequencing technology is relatively expensive and complex; SSR is more widely used due to its low cost, but copy number differences may exist between individuals of the same species, and the copy number differences of SSR repetitive sequences are small across species. Conventional agarose gel electrophoresis struggles to achieve the required resolution for amplified bands. When judging solely by the length of the amplified product, the results are not only affected by agarose gel electrophoresis, but two amplified products of similar length can also influence the interpretation of the results. Therefore, developing a PCR identification technique based on genetic information, which achieves species identification solely through the specific fusion amplification of genetic information using specific primers, is of great significance for the germplasm conservation and species identification of pufferfish. Summary of the Invention

[0005] Purpose of the invention: In order to solve the above-mentioned technical problems, the present invention aims to provide a molecular marker and specific primer for identifying pufferfish, redfin pufferfish and hybrid pufferfish, which can achieve multiple testing results with only one PCR and simultaneously complete the rapid identification of the three species of pufferfish.

[0006] This invention also provides an identification method for identifying the dark-spotted pufferfish, the red-finned pufferfish, and the hybrid pufferfish, providing a rapid and accurate identification method for pufferfish species identification. It solves the problems of difficulty in distinguishing by the naked eye and low accuracy of morphological feature differentiation, and achieves the characteristics of easy result judgment, high conservatism, and high accuracy.

[0007] Technical solution: In order to achieve the above objectives, the present invention provides a molecular marker for identifying the dark-spotted pufferfish, the red-finned pufferfish, and the hybrid pufferfish. The molecular marker is an InDel marker within the species genome, and the base sequences of the InDel marker are shown in SEO ID NO.1-2, respectively.

[0008] The present invention discloses specific primers for identifying *Pueraria lobata*, *Pueraria rubra*, and hybrid pufferfish, comprising primer pair 1, primer pair 2, or primer pair 1 and primer pair 2. The base sequences of primer pair 1 are shown in SEO ID NO. 3-4, and the base sequences of primer pair 2 are shown in SEO ID NO. 5-6.

[0009] SEO ID NO.3: DF1 CTCCGACTTCAGGACCGTATCA;

[0010] SEO ID NO.4: DR1 GGCGACGCTGACACAAGAGA,

[0011] SEO ID NO.5: IF1 GGCAAGGCAGGAGAGCAGTA;

[0012] SEO ID NO.6: IR1 GCTTCCACAATTACAATTATTATACACA.

[0013] Furthermore, the specific primer pair for identifying *Pueraria lobata*, *Pueraria rubra*, and hybrid pufferfish is preferably primer pair 1 and primer pair 2, wherein the base sequences of primer pair 1 are shown in SEO ID NO. 3-4, and the base sequences of primer pair 2 are shown in SEO ID NO. 5-6.

[0014] SEO ID NO.3: DF1 CTCCGACTTCAGGACCGTATCA;

[0015] SEO ID NO.4: DR1 GGCGACGCTGACACAAGAGA,

[0016] SEO ID NO.5: IF1 GGCAAGGCAGGAGAGCAGTA;

[0017] SEO ID NO.6: IR1 GCTTCCACAATTACAATTATTATACACA.

[0018] This invention provides a kit for identifying dark-spotted pufferfish, red-finned pufferfish, and hybrid pufferfish, comprising the aforementioned specific primers.

[0019] The application of the specific molecular markers described in this invention as identification and detection markers in the identification of dark-spotted pufferfish, red-finned pufferfish, and hybrid pufferfish.

[0020] The application of the primer pairs or kits described in this invention in the identification of dark-spotted pufferfish, red-finned pufferfish and hybrid pufferfish.

[0021] Furthermore, the method for identifying the dark-spotted pufferfish, the red-finned pufferfish, and the hybrid pufferfish is as follows: DNA from the dark-spotted pufferfish, the red-finned pufferfish, and the hybrid pufferfish to be identified is extracted as a template and subjected to multiplex PCR amplification with specific primer pair 1 and primer pair 2. Species identification is performed based on the difference in the length of the obtained product fragments.

[0022] Furthermore, the multiplex PCR amplification reaction system consists of 10 μl of 2×Rapid Taq Master Mix, 4 μl of specific primers (50 ng / primer), 5 μl of ddH2O, and 1 μl of DNA template (50 ng / sample).

[0023] Furthermore, the multiplex PCR amplification program is based on the principle of falling polymerase chain reaction, with different annealing temperatures designed for the two pairs of primers. First, pre-denaturation is performed at 95℃ for 5 min; then denaturation at 95℃ for 30 s, annealing at 61℃ for 30 s, and extension at 72℃ for 30 s, for 15 amplification cycles; then denaturation at 95℃ for 30 s, annealing at 55℃ for 30 s, and extension at 72℃ for 30 s, for 15 amplification cycles; finally, extension at 72℃ for 5 min ends the amplification program.

[0024] Furthermore, by agarose gel electrophoresis, after the specific primers bound to the samples and amplified, the following specific amplification bands were observed: one 275bp band for the dark-spotted pufferfish; two 320bp and 246bp bands for the red-finned pufferfish; and three 320bp, 275bp, and 246bp bands for the hybrid pufferfish.

[0025] Based on the principle of polymerase chain reaction, species identification can be completed quickly and accurately using only two methods: the number of bands in agarose gel electrophoresis or the length of the amplified fragment.

[0026] This invention, through extensive genetic sequencing of three species populations and further computer analysis of the genetic information, has for the first time identified highly conserved and distinct InDel molecular marker regions among the three species. Based on this InDel marker information, and combining the characteristics of polymerase chain reaction (PCR) and the principle of falling PCR, specific binding primers were designed, making the specific amplification results easier to interpret in the three populations (one product for dark stripes, two products for red fins, and three products for hybridization), and exhibiting high accuracy.

[0027] The two InDel molecular markers used in this invention were obtained by analyzing a large amount of sequencing data, assembling the genome information of *Putrachea obtusifolia* and *Putrachea hybrida*, and then screening to obtain the SEO ID NO. 1-2 base sequences. These InDel markers were selected based on the purpose of identification, exhibiting high conservation, genetic stability, and significant differences between species. The DF1 DR1 primer is located in the SEO ID NO. 1 base sequence, where *Putrachea obtusifolia* has a 34 bp deletion compared to *Putrachea rubiginosa*. *Putrachea hybrida*, influenced by hybridization, has two base types. The IF1 IR1 primer is located in the SEO ID NO. 2 base sequence, where *Putrachea obtusifolia* has a 29 bp insertion compared to *Putrachea rubiginosa*. Similarly, *Putrachea hybrida*, influenced by hybridization, also has two base types. Subsequently, based on the specificity of primer binding, the aforementioned specific primers and the landing PCR reaction procedure matching the specific primers were designed, making the experimental results easier to read, more accurate, and allowing for cross-validation between the two primer pairs.

[0028] The specific primers of this invention are primarily designed to improve the readability of the results. Based on deletion and insertion site information and the PCR primer binding principle, a mismatch design is used at the 3' end of the primers, resulting in different binding strengths of the specific primer DF1DR1 at different deletion sites when it binds to three different species. Furthermore, to achieve multi-primer cross-validation, based on existing DF1DR1 specific primer information, specific primers IF1 and IR1 with different binding annealing temperatures were designed for the insertion site, which do not bind to DF1DR1. The falling PCR principle is used to better reduce competition for template binding among multiple primers, further improving the readability of the results. Ultimately, this allows all primers to complete multi-primer amplification results in a single PCR procedure.

[0029] Given the difficulty in distinguishing hybrid pufferfish, dark-spotted pufferfish, and red-finned pufferfish by existing phenotypes, and the potential for germplasm confusion due to inadequate screening, the purpose of this invention is to provide a method for identifying dark-spotted pufferfish, red-finned pufferfish, and their hybrid offspring (dark-spotted pufferfish ♀ × red-finned pufferfish ♂). This identification method identifies two conserved genetic sequences among the aforementioned species based on differences in their genetic information and designs and constructs specific primers for precise species identification. To improve accuracy and readability, two conserved genes with genetic differences, ptprn2 (SEO ID NO.1) and rnf139 (SEO ID NO.2), were selected and a multi-primer identification method was constructed. This allows for simultaneous species identification and cross-validation through a single multiplex PCR, improving accuracy while avoiding the problem of identification failure due to missing genetic information at a certain template locus. The identification gene rnf139 selected during the identification process is a housekeeping gene with a highly conserved genetic sequence across different species, exhibiting stable genetic characteristics and making it suitable for the identification of the aforementioned species in various regions. Compared to traditional methods such as AFLP molecular markers and SNP molecular markers, this method does not require additional enzyme digestion, sequencing to detect SNPs, or fragment length determination. Preliminary identification of the aforementioned species can be achieved solely through the number of amplified products from specific primers and DNA templates. It boasts advantages such as simple operation, low cost, and accurate detection.

[0030] This invention utilizes the genomic genetic differences among *Pueraria lobata*, *Pueraria rubra*, and hybrid pufferfish (*Pueraria lobata* ♂ × *Pueraria rubra* ♀), the conserved inheritance of housekeeping genes, the simplicity and low cost of PCR operation, and the advantages of primer binding specificity and landing PCR. Based on traditional PCR amplification, primers were designed for two conserved InDel markers to construct a multi-species detection system. This allows for simultaneous species identification and result cross-validation through a single multiplex PCR, effectively improving detection accuracy while significantly reducing detection costs. The primers include DF1 (SEOID NO.3): CTCCGACTTCAGGACCGTATCA; DR1 (SEO ID NO.4): GGCGACGCTGACACAAGAGA for the detection of the pt prn2 region, and IF1 (SEO ID NO.5): GGCAAGGCAGGAGAGCAGTA; IR1 (SEO ID NO.6): GCTTCCAC AATTACAATTATTATACACA for the detection of the rnf139 region. Based on the conservation of the ptprn2 and rnf139 housekeeping genes, and the differences in conserved sequences among *Pueraria lobata*, *Pueraria rubra*, and hybrid pufferfish, species identification was performed by examining the differences in the number of DNA fragments or the length of amplified sequences in multiplex PCR products after binding conserved sequences with specific primers. First, based on the binding characteristics of polymerase chain reaction (PCR), a 3bp (18-20bp) specific binding base was designed at the 3' end of the DR1 specific primer within the ptprn2 gene, using InDel marker characteristics. In *Pueraria lobata*, DR1 pairing errors occurred, preventing binding to the target genome sequence; therefore, the specific primer DF1 DR1 failed to amplify the PCR product in *Pueraria lobata*. In *Pueraria rubra*, DF1 DR1 produced a 320bp specific amplified product. In hybrid pufferfish, influenced by InDel markers, only a 320bp specific amplified product was produced. Within the rnf139 gene, based on InDel marker characteristics, the IF1 IR1 specific primers produced a 275bp specific amplification product in the *Pueraria lobata* species; a 246bp specific amplification product in the *Pueraria rubra* species; and hybrid pufferfish, influenced by parental genetics, produced both 275bp and 246bp specific amplification products. Subsequently, considering the multi-primer binding efficiency, optimal annealing differential designs were performed on the two primer pairs based on the principle of falling polymerase chain reaction (LPCR). The optimal annealing temperature for DF1 DR1 was designed to be 61℃, and for IF1 IR1, it was designed to be 55℃. A falling LCR reaction program was then designed and completed.The two primer pairs mentioned above have cross-validation capabilities. Even when the genetic information of the DNA template is incomplete or some sites are missing, the other primer pair can still be used for testing, which greatly improves the detection rate of species identification results. The final result only needs to be analyzed by 2-3% agarose gel to quickly determine the species category of the sample. This enables rapid and accurate identification of individuals that are difficult to distinguish with the naked eye in germplasm conservation, species research, and hybridization breeding.

[0031] This invention designs a total of four specific amplification primers, including two specific primers for ptprn2:

[0032] DF1(SEO ID NO.3): CTCCGACTTCAGGACCGTATCA;

[0033] DR1(SEO ID NO.4):GGCGACGCTGACACAAGAGA;

[0034] And two specific primers inside rnf139:

[0035] IF1 (SEO ID NO.5): GGCAAGGCAGGAGAGCAGTA;

[0036] IR1(SEO ID NO.6):GCTTCCACAATTACAATTATTATACACA;

[0037] DNA was extracted from the sample to be tested using specific primers. Identification was performed at concentrations ranging from 10 to 100 ng / μl. The multiplex primer reaction system is characterized by the following: a 20 μl system containing 10 μl of 2×Rapid Taq Master Mix (purchased from Nanjing Novizan Biotechnology Co., Ltd., catalog number: P222-01); 11 μl (50 ng) of DF; 11 μl (50 ng) of DR; 11 μl (50 ng) of IF; 11 μl (50 ng) of IR; 5 μl of ddH2O; and 1 μl (10-100 ng) of genomic DNA from the sample. After the reaction system is premixed, the multiplex primer PCR amplification reaction program is characterized by the following steps: first, pre-denaturation at 95℃ for 5 min; then denaturation at 95℃ for 30 s, annealing at 61℃ for 30 s, and extension at 72℃ for 30 s, for 15 amplification cycles; then denaturation at 95℃ for 30 s, annealing at 55℃ for 30 s, and extension at 72℃ for 30 s, for 15 amplification cycles; finally, extension at 72℃ for 5 min to end the amplification program.

[0038] After the multiplex primer PCR amplification was completed, 3-5 μl of the product was analyzed by electrophoresis on a 2-3% agarose gel at a constant voltage of 120-180V for 20-40 min. The results showed one specific DNA amplification band of 275 bp for the *Pueraria lobata* species; two specific DNA amplification bands of 320 bp and 246 bp for the *Pueraria rubra* species; and three specific amplification bands of 320 bp, 275 bp, and 246 bp for the hybrid pufferfish species. Individual species can be rapidly identified based on the number and type of DNA amplification bands.

[0039] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages:

[0040] The specific primers of this invention can achieve multiplex testing results with just one PCR when phenotypes cannot distinguish species. This allows for the rapid identification of three species simultaneously: dark-spotted pufferfish, red-finned pufferfish, and hybrid pufferfish (dark-spotted pufferfish ♀ × red-finned pufferfish ♂), significantly improving the accuracy of identification based solely on measurable traits.

[0041] Based on the binding characteristics of polymerase chain reaction (PCR), this invention designs specific primers for binding to the genetic sequences of different species within the conserved gene ptprn2. Furthermore, based on the specific primers for the landing PCR and the housekeeping gene rnf139, a multiplex polymerase reaction program with two pairs of primers was specifically designed. This enhances the readability of agarose gel results, enabling species identification solely through the number or length of DNA amplification products. The two results mutually verify each other, improving overall accuracy.

[0042] This invention provides a method for identifying pufferfish species by using gel electrophoresis bands amplified by multiplex PCR in a single fusion amplification. It offers a rapid and accurate identification method for pufferfish species, solving problems such as difficulty in distinguishing by the naked eye and low accuracy in distinguishing by morphological characteristics. The method achieves results that are easy to interpret, highly conservative, and highly accurate. Attached Figure Description

[0043] Figure 1 These are real-life images of typical pufferfish (Pueraria lobata), redfin pufferfish, and hybrid pufferfish. Image A shows a real-life example of a pufferfish (Pueraria lobata); Image B shows a real-life example of a hybrid pufferfish (hybrid offspring); and Image C shows a real-life example of a redfin pufferfish.

[0044] Figure 2The results of the species identification method using multiple primer PCR in Example 1 are shown in Figure A, which shows the specific amplification results of multiple primer PCR for *Putra maculatus*, with a specific amplification product of 275 bp; Figure B shows the specific amplification results of multiple primer PCR for *Putra rubrotinctum*, with two specific amplification products of 320 bp and 246 bp; Figure C shows the specific amplification results of multiple primer PCR for hybrid pufferfish, with three specific amplification products of 320 bp, 275 bp, and 246 bp; Figure D compares the specific amplification results of multiple primer PCR for *Putra maculatus*, *Putra rubrotinctum*, and hybrid pufferfish. *Putra maculatus* has a specific amplification product of 275 bp, *Putra rubrotinctum* has two specific amplification products of 320 bp and 246 bp, and hybrid pufferfish has three specific amplification products of 320 bp, 275 bp, and 246 bp.

[0045] Figure 3 The results of 3% agarose gel electrophoresis analysis after species-specific amplification using multiple primer PCR for species identification of *Putra macranthum*, *Putra hybrid*, and *Putra rubrotinctum* in Example 2 are shown. The leftmost band is the Mark control band. Bands 1-72 are *Putra macranthum* amplification bands with a specific amplification band of 275 bp. Bands 73-144 are *Putra hybrid* amplification bands with three specific amplification bands of 320 bp, 275 bp, and 246 bp, respectively. Bands 145-152 are *Putra macranthum* amplification bands with a single 275 bp specific amplification product. Bands 153-160 are *Putra rubrotinctum* amplification bands of 320 bp and 246 bp, respectively. Bands 161-168 are *Putra hybrid* amplification bands with three specific amplification products of 320 bp, 275 bp, and 246 bp.

[0046] Figure 4 The results of 3% agarose gel electrophoresis analysis of species-specific amplification of red-finned pufferfish using multiple primer PCR in Example 3 are shown. The leftmost band is the Maker control band, and bands 1-96 are red-finned pufferfish with two specific amplification products of 320bp and 246bp.

[0047] Figure 5 The results of the DF1 DR1 test used in Example 4 are shown. The leftmost band is the Maker control band. Bands 1-24 are dark-spotted pufferfish without specific products, bands 25-48 are red-finned pufferfish with 320bp specific amplification products, and bands 49-72 are hybrid pufferfish with 320bp specific amplification products.

[0048] Figure 6The results of the IF1 IR1 test used in Example 4 are shown. The leftmost band is the Maker control band. Bands 1-24 are pufferfish with a specific amplification product of 275bp, bands 25-48 are pufferfish with a specific amplification product of 246bp, and bands 49-72 are hybrid pufferfish with two types of specific amplification products of 275bp and 246bp. Detailed Implementation

[0049] The technical solution of the present invention will be further described below with reference to the accompanying drawings.

[0050] Unless otherwise specified, all materials and reagents used in the following examples are commercially available. Experimental methods not specifically described in the examples are generally performed under standard conditions or as recommended by the manufacturer.

[0051] Example 1

[0052] The materials used in this embodiment, including the dark-spotted pufferfish, redfin pufferfish, and hybrid pufferfish, were all sourced from Nantong Zhongyang Seed Industry (Jiangsu) Co., Ltd.

[0053] A total of 96 specimens of known species, including the dark-spotted pufferfish, the red-finned pufferfish, and the hybrid pufferfish, were randomly selected from different groups. These included 32 dark-spotted pufferfish, 32 hybrid pufferfish, and 32 red-finned pufferfish. Figure 1DNA was extracted from randomly selected individuals using a commercial kit (purchased from Nanjing Novizan Biotechnology Co., Ltd., catalog number: DC102-01). After extraction, the DNA concentration was measured to be 100-300 ng / μl, and the concentration was diluted to 50 ng / μl. Forty DNA samples each from *Putrachea obtusifolia* and *Putrachea hybrida* were randomly selected and their genomes were sequenced using the Illumina platform at Guangzhou GeneDio Biotechnology Co., Ltd. Sequencing results were quality controlled and assembled using FASTP (Version 0.18.0). The assembled results were analyzed using BWA (Version 0.7.12) software based on the *Putrachea rubiginosa* genome (GCA_901000725.2) in the NCBI database to identify interspecies genomic differences, and differentially expressed sites were marked using a reference genome. Deletion and insertion differential sites within genetically stable and highly conserved housekeeping genes were selected from InDel molecular markers across three species for validation analysis. To improve identification accuracy and readability, two genetically differentially conserved genes, ptprn2 (SEO ID NO.1) and rnf139 (SEO ID NO.2), were designed. DF1 DR1 (sequences shown in SEO ID NO.1) specific primers were then designed based on InDel marker characteristics for the ptprn2 gene (sequence shown in SEO ID NO.1). The DR1 primer contained 3 bp (18-20 bp) of specific binding bases at its 3' end. In the *Pueraria lobata* genome sequence, a pairing error occurred with DR1, preventing binding to the target genome sequence. Therefore, the specific primer DF1 DR1 failed to amplify PCR products in *Pueraria lobata*. In *Pueraria rubra*, the DF1 DR1 (sequence shown in SEO ID NO.1) sequence failed to amplify PCR products. Primers NO.3-4 (as shown in SEO ID NO.2) produced a 320bp specific amplification product; hybrid pufferfish species, influenced by hybrid genetics, also produced only the same 320bp specific amplification product. Subsequently, within the rnf139 gene (sequence shown in SEO ID NO.2), IF1 IR1 specific primers (sequence shown in SEO ID NO.5-6) ​​were designed based on InDel marker characteristics, producing a 275bp specific amplification product in *Pueraria lobata*; a 246bp specific amplification product in *Pueraria rubra*; and hybrid pufferfish, influenced by hybrid genetics, produced both 275bp and 246bp specific amplification products. Considering the issue of multiple primer binding efficiency, optimal annealing differential design was then performed on the two primer pairs based on the principle of falling polymerase chain reaction.The PCR system consisted of 20 μl of one type of sample DNA (1 μl, 50 ng / sample), DF (11 μl, 50 ng), DR (11 μl, 50 ng), IF (11 μl, 50 ng), IR (11 μl, 50 ng), ddH2O (5 μl), and 2×RapidTaq MasterMix (10 μl, purchased from Nanjing Novizan Biotechnology Co., Ltd., catalog number: P222-01). The following multiplex primer PCR reaction program was then set: 95℃ pre-denaturation for 5 min; followed by 95℃ denaturation for 30 s, 61℃ annealing for 30 s, and 72℃ extension for 30 s, for 15 amplification cycles; then 95℃ denaturation for 30 s, 55℃ annealing for 30 s, and 72℃ extension for 30 s, for 15 amplification cycles; finally, a 72℃ extension for 5 min was performed to end the amplification program. Four microliters of the specific amplification product were aliquoted into a 3% agarose gel for electrophoresis analysis. The electrophoresis program was 120 V (5.5 V / cm) for 40 min. Gel imaging analysis of the electrophoresis results showed the following: Figure 2 As shown in A, the results of PCR specific amplification of Pufferfish obscurus using multiple primers show a 275bp specific amplification product. Figure 2 As shown in B, the results of multiple primer PCR specific amplification of redfin pufferfish are shown, with two specific amplification products of 320bp and 246bp. Figure 2 As shown in C, the results of multiple primer PCR specific amplification of the progeny hybrid pufferfish are shown, with three specific amplification products of 320bp, 275bp and 246bp. Figure 2 As shown in D, the results of multiple primer PCR specific amplification of pufferfish (Dark-spotted pufferfish), red-finned pufferfish, and hybrid pufferfish are compared. pufferfish (Dark-spotted pufferfish) has a specific amplification product of 275 bp, red-finned pufferfish has two specific amplification products of 320 bp and 246 bp, and hybrid pufferfish has three specific amplification products of 320 bp, 275 bp, and 246 bp.

[0054] This method can quickly identify species such as the dark-spotted pufferfish, the red-finned pufferfish, and hybrid pufferfish, with an accuracy rate of 100%.

[0055] Example 2

[0056] The materials used in this embodiment, including the dark-spotted pufferfish, redfin pufferfish, and hybrid pufferfish, were all sourced from Nantong Zhongyang Seed Industry (Jiangsu) Co., Ltd.

[0057] A total of 168 samples of known species of pufferfish (including *Pueraria lobata*, *Pueraria rubra*, and hybrid pufferfish) from different populations were randomly selected, including 80 *Pueraria lobata*, 80 hybrid pufferfish, and 8 *Pueraria rubra*. DNA was extracted from these randomly selected individuals using a commercial kit (purchased from Nanjing Novizan Biotechnology Co., Ltd., catalog number: DC102-01). After DNA extraction, the sample DNA concentration was measured to be 100-300 ng / μl, and the sample DNA concentration was diluted to 50 ng / μl. A 20 μl PCR system was prepared, containing 1 μl (50 ng / sample) of the target DNA, 11 μl (50 ng) of DF, 11 μl (50 ng) of DR, 11 μl (50 ng) of IF, 11 μl (50 ng) of IR, 5 μl of ddH2O, and 10 μl of 2×Rapid Taq Master Mix (purchased from Nanjing Novizan Biotechnology Co., Ltd., catalog number: P222-01). The following multiplex primer PCR reaction program was then set: 95℃ pre-denaturation for 5 min; followed by 95℃ denaturation for 30 s, 61℃ annealing for 30 s, and 72℃ extension for 30 s, for 15 amplification cycles; then 95℃ denaturation for 30 s, 55℃ annealing for 30 s, and 72℃ extension for 30 s, for 15 amplification cycles; finally, a final extension at 72℃ for 5 min to end the amplification program. 4 μl of the specific amplification product was analyzed by electrophoresis on a 3% agarose gel at 120 V (5.5 V / cm) for 40 min. Figure 3 As shown, the leftmost band is the Maker control band. Bands 1-72 are amplification bands of *Putra asiaticus* with a specific amplification band of 275 bp. Bands 73-144 are amplification bands of hybrid pufferfish with three specific amplification bands of 320 bp, 275 bp, and 246 bp, respectively. Bands 145-152 are *Putra asiaticus* with one specific amplification product of 275 bp. Bands 153-160 are *Putra erythropterus* with two specific amplification products of 320 bp and 246 bp. Bands 161-168 are hybrid pufferfish with three specific amplification products of 320 bp, 275 bp, and 246 bp. Electrophoresis results, analyzed by gel imaging, showed that among the 168 samples analyzed, 80 were *Putra asiaticus*, 80 were hybrid pufferfish, and 8 were *Putra erythropterus*, indicating a 100% species identification rate.

[0058] Example 3

[0059] In this embodiment, the redfin pufferfish were obtained from Dalian Tianzheng Industry Co., Ltd., and 96 redfin pufferfish samples were randomly selected from the Dalian Daheishi Modern Fishery Base (Tianzheng Industry Co., Ltd. breeding base).

[0060] DNA was extracted from randomly selected individuals using a commercial kit (purchased from Nanjing Novizan Biotechnology Co., Ltd., catalog number: DC102-01). After DNA extraction, the sample DNA concentration was measured to be 300-500 ng / μl, and the sample DNA concentration was diluted to 50 ng / μl. A 20 μl PCR system was prepared, containing 1 μl (50 ng / sample) of one type of DNA to be tested, 11 μl (50 ng) of DF, 11 μl (50 ng) of DR, 11 μl (50 ng) of IF, 11 μl (50 ng) of IR, 5 μl of ddH2O, and 10 μl of 2×RapidTaq Master Mix (purchased from Nanjing Novizan Biotechnology Co., Ltd., catalog number: P222-01). The following multiplex primer PCR reaction program was then set: 95℃ pre-denaturation for 5 min; followed by 95℃ denaturation for 30 s, 61℃ annealing for 30 s, and 72℃ extension for 30 s, for 15 amplification cycles; then 95℃ denaturation for 30 s, 55℃ annealing for 30 s, and 72℃ extension for 30 s, for 15 amplification cycles; finally, a final extension at 72℃ for 5 min to end the amplification program. 3 μl of the specific amplification product was analyzed by electrophoresis on a 3% agarose gel at 180 V (8.2 V / cm) for 25 min. Figure 4 As shown, the leftmost band is the Maker control band, and bands 1-96 are red-finned pufferfish with two specific amplification products of 320bp and 246bp. Electrophoresis results and gel imaging analysis showed that all 96 samples analyzed exhibited red-finned pufferfish amplification products, indicating a 100% identification rate. Although this method has been used to verify a large number of dark-spotted pufferfish and hybrid pufferfish individuals in Examples 1 and 2, the limited number of red-finned pufferfish populations at Nantong Zhongyang Seed Industry (Jiangsu) Co., Ltd. necessitated a separate verification of red-finned pufferfish individuals to validate the accuracy of this method.

[0061] Example 4

[0062] The materials used in this embodiment include the dark-spotted pufferfish and hybrid pufferfish, both sourced from Nantong Zhongyang Seed Industry (Jiangsu) Co., Ltd. The redfin pufferfish came from Dalian Tianzheng Industry Co., Ltd., and the Dalian Daheishi Modern Fishery Base (Tianzheng Industry Co., Ltd.'s aquaculture base).

[0063] To explain in detail the working principle of this method involving multi-primer specific amplification, two pairs of primers (DF) are used. 1 DR 1Species identification was performed separately using IF1 and IR1. A total of 72 known species of pufferfish (including *Pueraria lobata*, *Pueraria rubra*, and hybrid pufferfish) from different populations were randomly selected, with 24 individuals of each species. DNA was extracted from the randomly selected individuals using a commercial kit (purchased from Nanjing Novizan Biotechnology Co., Ltd., catalog number: DC102-01). After DNA extraction, the sample DNA concentration was measured to be 200-500 ng / μl, and the sample DNA concentration was diluted to 50 ng / μl.

[0064] For comparative analysis of DF1 and DR1 primers, the following premixed samples were used: 1 μl (50 ng / sample) of sample DNA, 1 μl (50 ng) of DF1, 1 μl (50 ng) of DR1, 7 μl of ddH2O, and 10 μl of 2×Rapid Taq Master Mix (purchased from Nanjing Novizan Biotechnology Co., Ltd., catalog number: P222-01). The PCR reaction program was then set as follows: 95℃ pre-denaturation for 5 min; followed by 95℃ denaturation for 30 s, 61℃ annealing for 30 s, and 72℃ extension for 30 s, for 30 amplification cycles; finally, a final extension at 72℃ for 5 min was performed to end the amplification program. For comparative analysis of IF1 and IR1 primers, the following premixed samples were used: 1 μl (50 ng / sample) of sample DNA, 1 μl (50 ng) of IF1, 1 μl (50 ng) of IR1, 5 μl of ddH2O, and 10 μl of 2×RapidTaq Master Mix (purchased from Nanjing Novizan Biotechnology Co., Ltd., catalog number: P222-01). The PCR reaction program was then set as follows: 95℃ pre-denaturation for 5 min; followed by 95℃ denaturation for 30 s, 55℃ annealing for 30 s, and 72℃ extension for 30 s, for 30 amplification cycles; finally, a 72℃ extension for 5 min was performed to terminate the amplification program.

[0065] Subsequently, 4 μl of the above-mentioned specific amplification product was subjected to electrophoresis analysis on a 3% agarose gel. The electrophoresis program was 180 V (8.2 V / cm) for 25 min. The comparison results of DF1 and DR1 are as follows: Figure 5 As shown, the leftmost band represents the Maker control bands. Bands 1-24 represent *Putra maculatus* (dark-striped pufferfish) without specific products; bands 25-48 represent *Putra rubrotinctum* (red-finned pufferfish) with 320bp specific amplification products; and bands 49-72 represent hybrid pufferfish, also with 320bp specific amplification products. The IF1 and IR1 comparison results are shown below. Figure 6As shown, the leftmost band represents the Mark control. Bands 1-24 represent *Pueraria lobata* with a specific amplification product of 275 bp, bands 25-48 represent *Pueraria rubra* with a specific amplification product of 246 bp, and bands 49-72 represent hybrid pufferfish with both 275 bp and 246 bp specific amplification products. It is evident that both primers possess varying degrees of ability to differentiate these species. The multi-primer PCR system designed in this method effectively combines two different types of specific primers, resulting in species identification with advantages such as easy result interpretation, high accuracy of cross-validation, simple experimental operation, and low cost. This provides accurate theoretical basis and identification methods in fields such as germplasm conservation, species research, and hybridization breeding. In summary, while both primers can be used individually, each has certain disadvantages: although the *Pueraria lobata* population does not produce amplification products when the DF1 and DR1 primers are used alone, *Pueraria rubra* and hybrid pufferfish produce products of the same size, making them difficult to distinguish. Secondly, while the IF1 and IR1 primers can be used alone to distinguish hybrid pufferfish from the other two species by the number of amplified products, the amplified products of *Pueraria lobata* and *Pueraria rubra* are similar in length, which can easily lead to misjudgment. Therefore, when the two primers are combined, *Pueraria lobata* will have only one amplified product, *Pueraria rubra* will have two amplified products, and hybrid pufferfish will have three amplified products. This allows the advantages of the two primers to complement each other, making the results easier to interpret, and the results of the two primers can be used to verify the final result.

[0066] Example 5

[0067] The materials used in this embodiment include the dark-spotted pufferfish and hybrid pufferfish, both sourced from Nantong Zhongyang Seed Industry (Jiangsu) Co., Ltd. The redfin pufferfish came from Dalian Tianzheng Industry Co., Ltd., and the Dalian Daheishi Modern Fishery Base (Tianzheng Industry Co., Ltd.'s aquaculture base).

[0068] To improve the binding efficiency of specific primers, this method designed multiple pairs of specific primers using software based on their binding and amplification characteristics, followed by experimental screening. Six primer pairs were ultimately retained for further validation, including specific primers DF1 DR1, DF2 DR2, and DF3 DR3 designed for the ptprn2 gene; and specific primers IF1 IR1, IF2 IR2, and IF3 IR3 designed for the rnf139 gene.

[0069] The specific primer sequences are as follows:

[0070] DF1:CTCCGACTTCAGGACCGTATCA;

[0071] DR1:GGCGACGCTGACACAAGAGA;

[0072] DF2:CCGACTTCAGGACCGTATCACCG;

[0073] DR2:AGTCTGGCGACGCTGACACGAG;

[0074] DF3:CCTCCGAGCATCTGTTGA;

[0075] DR3:TTCGGTGTTTCCTTCTGTCT;

[0076] IF1:GGCAAGGCAGGAGAGCAGTA;

[0077] IR1:GCTTCCACAATTACAATTATTATACACA;

[0078] IF2:AAGTGGCAAGGCAGGAGA;

[0079] IR2:CACAATTACAATTATTATACACAAGTT;

[0080] IF3:AAGTGGCAAGGCAGGAGA;

[0081] IR3:CACCGCCCGTTACAAGTC;

[0082] Twenty-four fish from each of the different species were randomly selected for further verification. The results showed that in the ptprn2 gene, primer DF2 DR2 had weak specificity in *Pueraria lobata* at the optimal annealing temperature. Base mispairing made it difficult to terminate the DNA synthesis reaction, ultimately resulting in incorrect amplification products. Primer DF3 DR3 produced specific amplification products in both *Pueraria lobata* and *Pueraria rubra*, but the product fragment lengths were similar, leading to errors in result interpretation. Only primer DF1 DR1 showed the strongest specificity in *Pueraria lobata* compared to other primers. At the optimal annealing temperature, primer DR1 caused DNA synthesis to terminate in *Pueraria lobata* due to base mispairing, making amplification difficult and resulting in easily interpretable results, allowing for rapid identification of *Pueraria lobata* from the other two species. In the rnf139 gene, primer IF2 IR2 showed low specificity in *Pueraria lobata* and *Pueraria hybrida* at the optimal annealing temperature, producing numerous non-specific amplification products after base pairing, reducing the binding efficiency between the primer and the target site and making the results difficult to interpret. When primer IF3 IR3 was used in conjunction with primer DF1 DR1, the two primer pairs were prone to mispairing and mutual binding, further reducing the binding efficiency between the primers and the target site and making the results difficult to interpret. Only primer IF1 IR1, compared to the other primers, not only produced specific products with all three species but also exhibited lower binding efficiency with primer DF1 DR1 in the multi-primer system, with less mutual influence between the two primer pairs. Ultimately, this resulted in the multi-primer identification method having easily interpretable and highly accurate results.

Claims

1. The application of a specific primer pair or kit in the identification of *Pueraria lobata*, *Pueraria rubra*, and hybrid pufferfish, said kit comprising the specific primer pair; The specific primer pairs are primer pair 1 and primer pair 2. The base sequences of primer pair 1 are shown in SEO ID NO.3-4, and the base sequences of primer pair 2 are shown in SEO ID NO.5-6. SEO ID NO.3: DF1 CTCCGACTTCAGGACCGTATCA; SEO ID NO.4: DR1 GGCGACGCTGACACAAGAGA, SEO ID NO.5: IF1 GGCAAGGCAGGAGAGCAGTA; SEO ID NO.6: IR1 GCTTCCACAATTACAATTATTATACACA; The method for distinguishing between dark-spotted pufferfish, red-finned pufferfish, and hybrid pufferfish is as follows: DNA is extracted from the dark-spotted pufferfish, red-finned pufferfish, and hybrid pufferfish to be identified, respectively, and used as templates. Multiplex PCR amplification is performed with specific primer pairs 1 and 2. The identification is based on the difference in the number or length of the obtained product fragments. Agarose gel electrophoresis revealed that after amplification by specific primers, a 275bp specific amplification band was observed in the pufferfish (Tetraodon nigromaculata). Two specific amplification bands were observed in the redfin pufferfish, at 320bp and 246bp respectively; three specific amplification bands were observed in the hybrid pufferfish, at 320bp, 275bp and 246bp respectively.

2. The application according to claim 1, characterized in that, The multiplex PCR amplification reaction system consisted of 10 μl of 2×Rapid TaqMaster Mix, 4 μl of specific primers, 5 μl of ddH2O, and 1 μl of DNA template.

3. The application according to claim 1, characterized in that, The multiplex PCR amplification reaction program is as follows: pre-denaturation at 95℃ for 5 min; followed by denaturation at 95℃ for 30 s, annealing at 61℃ for 30 s, and extension at 72℃ for 30 s, for 15 amplification cycles; then denaturation at 95℃ for 30 s, annealing at 55℃ for 30 s, and extension at 72℃ for 30 s, for 15 amplification cycles; finally, extension at 72℃ for 5 min to end the amplification program.