Primer group, composition, kit and method for identifying apple edge rot germs based on qPCR (quantitative polymerase chain reaction)

Abstract

The invention belongs to the technical field of pathogen detection, and particularly relates to a primer group, a composition, a kit and a method for identifying apple edge rot pathogen based on qPCR (quantitative polymerase chain reaction). Comprising the following steps: constructing a polygene phylogenetic tree based on an ITS-LSU-TEF-TUB sequence, designing an apple edge rot pathogen sample and a primer probe, constructing a standard curve, carrying out PCR (Polymerase Chain Reaction) amplification detection on the apple edge rot pathogen, and judging a result according to the amplification curve after the reaction is finished. The detection method has good repeatability and stability, and compared with other detection technologies, fluorescent quantitative PCR has the advantages of being short in detection time, higher in detection sensitivity, higher in specificity, small in needed template amount, capable of effectively solving the PCR pollution problem, high in automation degree and the like.

Description

Technical Field

[0001] The invention belongs to the technical field of pathogen detection, and in particular relates to a PCR amplification primer set, a composition, a kit and a method for identifying apple edge rot pathogens. Background Art

[0002] At present, the apple industry has become an important industry in various countries around the world, but the occurrence of diseases has seriously restricted its development. Apple edge rot is an important plant pathogenic fungus and is listed as a quarantine object by various countries around the world.

[0003] The classification status of apple edge rot fungus (Cadophora malorum): Fungi, Ascomycota, Pezizomycotina, Leotiomycetes, Helotiales, Cadophora. The pathogen of apple edge rot fungus is Cadophora malorum (synonymous with Phialophora malorum and Sporotrichum malorum), which is mainly distributed in the United States, the United Kingdom, the Netherlands, Italy and other countries. Apple edge rot caused by apple edge rot fungus will cause a large number of apples and pears to rot during storage, causing huge losses in production. The pathogen is a soil-borne fungus that can not only survive the winter in the surface soil, but also on the bark of trees. Its spread mainly depends on human activities.

[0004] It is difficult to identify the pathogen using traditional methods, but the fluorescent quantitative PCR method is rapid, sensitive, specific and accurate. Therefore, the use of fluorescent quantitative PCR to detect apple edge rot has high practical value.

[0005] The specification of Chinese invention CN200910236111.1 records primers and probes for detecting apple edge rot and their detection method. The nucleotide sequences of the primers are shown in SEQ ID No.1&2, and the nucleotide sequence of the probe is shown in SEQ ID No.3. The method in the invention uses the total DNA of the sample as a template, and uses the above primers and probes to perform real-time fluorescent PCR amplification. Data is collected at the end of each cycle, and the result is determined according to the amplification curve after the reaction. The probe has good specificity, the detection method is fast and simple, and has high accuracy and sensitivity, which provides a guarantee for import and export safety.

[0006] However, this patent and existing research lack a complete classification system as a basis, and the specific primer design and verification work is completed based on a limited number of species sequences. The screening scope is limited, and there may be technical problems such as insufficient specificity or coverage. Summary of the invention

[0007] In order to solve the above technical problems, the present invention provides a PCR amplification primer set and a specific probe, a composition, a kit and a method for identifying apple edge rot pathogens based on qPCR, which overcome the above-mentioned shortcomings in the prior art. The detection method has good repeatability and stability. Compared with other detection technologies, fluorescent quantitative PCR has the characteristics of short detection time, higher detection sensitivity, stronger specificity, trace amount of required template, effective solution to PCR contamination problem, high degree of automation, etc.; and in particular, the detection time of a single sample can be shortened to 1 hour, and a large number of sample analyses can be performed at the same time, with good specificity, repeatability and stability, and is suitable for qualitative detection of apple edge rot pathogens, and can also be used for quantitative detection.

[0008] A PCR amplification primer set for identifying apple edge rot pathogen that solves the above technical problems, wherein the nucleotide sequence of the forward primer PHMA-F is shown in SEQ ID No.1, and the nucleotide sequence of the reverse primer PHMA-R is shown in SEQ ID No.2.

[0009] Specifically, the nucleotide sequence of PHMA-F is ATACACGAACGCGACACAAAGAAT.

[0010] The nucleotide sequence of PHMA-R is ACCGTGCTCTCCTGAGATTGTT.

[0011] A composition for identifying apple edge rot pathogens, comprising a primer probe for detection, wherein the primer probe is composed of the primer set according to claim 1 and a specific probe, the forward primer sequence of the primer set is shown as SEQ ID No. 1, and the reverse primer sequence is shown as SEQ ID No. 2.

[0012] In the optimized scheme, the nucleotide sequence of the probe PHMA-FAM is shown as SEQ ID No.3.

[0013] Specifically, the nucleotide sequence of the probe PHMA-FAM is AGTACTGATAAACATGCAGGC.

[0014] The PCR primer set described in the present invention can be used in the preparation of products for detecting or assisting the detection of apple edge rot pathogen, in the preparation of products for identifying or assisting the identification of apple edge rot pathogen, in the preparation of products for quantitatively detecting apple edge rot pathogen, in the preparation of products for predicting plant infection with apple edge rot pathogen, in detecting or assisting the detection of apple edge rot pathogen, in identifying or assisting the identification of apple edge rot pathogen, in quantitatively detecting apple edge rot pathogen, or in predicting plant infection with apple edge rot pathogen.

[0015] The present invention discloses a kit for detecting apple edge rot pathogen based on qPCR technology, comprising the above-mentioned composition for identifying apple edge rot pathogen.

[0016] The kit for identifying apple edge rot pathogens of the present invention further comprises MIX (2×) for qPCR probe method, the specific primer pair and probe thereof as described in claims 2 and 3, and deionized water.

[0017] Furthermore, the kit is used in identifying apple edge rot pathogens.

[0018] A method for identifying apple edge rot pathogens based on qPCR technology in the present invention comprises the following steps:

[0019] (1) Using serially diluted DNA extracted from apple edge rot pathogen as a template, using the primers and probes described in claim 1 and claim 2 to perform fluorescent quantitative PCR, and establishing a standard curve between edge rot pathogen DNA and Ct value;

[0020] (2) extracting total DNA or microbial DNA from the sample to be tested;

[0021] (3) using the DNA of the sample to be tested as a template and using the primers and probes described in claim 1 and claim 2 to perform fluorescent quantitative PCR to obtain a Ct value;

[0022] (4) The Ct value obtained by the test is compared with the maximum Ct value of the standard curve established in step (1). If the sample detection Ct is greater than the Ct corresponding to the minimum detection template concentration, that is, the sample Ct is greater than the maximum Ct of the standard curve, the sample can be judged as undetected; if the sample detection Ct is less than the Ct corresponding to the minimum detection template concentration, that is, the sample Ct is less than the maximum Ct of the standard curve, the sample can be judged as detected, and the detected Ct can be substituted into the established standard curve to calculate the concentration of apple edge rot fungi in the sample (ng / μL).

[0023] In the optimization scheme, the standard curve is y=-3.4027x+28.407, where y is the Ct value and x is the lgDNA concentration ng / μL. The standard curve in qPCR is fitted based on the template and ct.

[0024] The qPCR reaction system and conditions in step (2) are as follows: a two-step TaqMan fluorescent probe method is used to perform real-time fluorescent quantitative PCR reaction, and the total system is 20 μL, including 10 μL of Pro Taq HS Probe Premix (2X), 0.5 μL of each of the specific primers PHMA-F / PHMA-R (both 10 μM), 0.5 μL of the fluorescent probe PHMA-FAM (10uM), 7.5 μL of ddH2O, and 1 μL of DNA template.

[0025] The composition of the present invention performs qPCR detection on the sample to be tested, and judges or assists in judging whether the sample to be tested is apple edge rot fungus, or whether the sample to be tested contains apple edge rot fungus, or whether the sample to be tested is infected with apple edge rot fungus according to the qPCR detection result.

[0026] The present invention adopts the fluorescent quantitative PCR method to specifically detect apple edge rot, has good specificity, can quickly detect with only a small amount of DNA, and has a high detection success rate. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 This is a multi-gene phylogenetic tree diagram of the Cadophora genus based on ITS, TEF, TUB and LSU sequences in the present invention.

[0028] (Bootstrap support rate (≥70%), outgroup is Xylaria hypoxylon (CBS120.16), T represents type strain (Type)).

[0029] Figure 2 This is a specific test of the real-time fluorescence PCR of apple edge rot pathogen in the present invention.

[0030] (Among them, A. Cadophora malorum (QYF344) B. blank control and other test strains).

[0031] Figure 3 This is a standard curve diagram for real-time fluorescence detection of apple edge rot pathogens in the present invention.

[0032] Figure 4 This is a repeatability test of the TaqMan probe fluorescent quantitative PCR detection method for apple edge rot pathogens in the present invention.

[0033] (Among them, 1-3: 930 ng / μL; 4-6: 93 ng / μL; 7-9: 9.3 ng / μL; 10-12: 0.93 ng / μL). DETAILED DESCRIPTION

[0034] The present invention is further described below in conjunction with specific embodiments:

[0035] Example 1

[0036] According to the technical solution provided by the invention, the detection method mainly includes: composition design, construction of standard curve, sample collection and quantitative detection of apple edge rot fungi in soil samples, etc. The specific steps are as follows:

[0037] 1. Construction of a multi-gene phylogenetic tree based on ITS-LSU-TEF-TUB sequences:

[0038] To clarify the phylogenetic relationship for subsequent primer design, different gene fragments were selected for analysis, including ITS, TEF, TUB and LSU. Multi-gene sequences of closely related species of apple edge rot pathogens were collected from GenBank for analysis. MAFFT was used to align the different gene sequences obtained, and the alignment results were edited by MEGA v.7. The separate alignment files were then connected for the next phylogenetic analysis. For further accurate identification, a multi-gene phylogenetic tree based on ITS-LSU-TEF-TUB sequences was constructed.

[0039] According to multigene phylogenetic analysis, QYF339, QYF344, QYF333, and the model strain of apple edge rot CBS 165.42 were clustered together, e.g. Figure 1 shown.

[0040] 2. Samples and primer probe design of apple edge rot pathogen;

[0041] According to the published related research, multi-gene sequences of closely related species of apple edge rot were collected from GenBank for analysis. According to the differences in gene sequences of apple edge rot and its similar species, MEGA 7.0 software was used for alignment and differential site analysis. Specific primers and probes were designed using Primer Express 3.0 based on the differences between TEF / TUB genes.

[0042] The invention compares the TUB gene sequences of apple edge rot pathogen and its similar genera and species, designs a specific primer pair for rapid detection of apple edge rot pathogen, and designs a 21 bp MGB probe due to its poor specificity and easy interference by similar species.

[0043] The nucleotide sequence of PHMA-F is ATACACGAACGCGACACAAAGAAT;

[0044] The nucleotide sequence of PHMA-R is ACCGTGCTCTCCTGAGATTGTT;

[0045] The nucleotide sequence of PHMA-FAM is AGTACTGATAAACATGCAGGC.

[0046] 3. Construction of standard curve;

[0047] (1) Template preparation: Scrape an appropriate amount of apple edge rot pathogens in a sterile environment, and use the optimized CTAB (Cetyltrimethylammonium Bromide) method to extract the genome of the fungal strain. Use the Thermo Fisher Nanodrop 2000 spectrophotometer to determine the concentration of template DNA, and dilute the above DNA in a 10-fold gradient, using 930ng / μL, 93ng / μL, 9.3ng / μL, and 0.93ng / μL as templates, respectively. Store the above dilutions in a -20℃ refrigerator for later use;

[0048] (2) Fluorescence quantitative PCR reaction system: The total system is 20 μL, including 10 μL Pro Taq HS Probe Premix (2X), 0.5 μL each of specific primers PHMA-F / PHMA-R (both 10 μM), 0.5 μL of fluorescent probe PHMA-FAM (10 uM), 7.5 μL of ddH2O, and 1 μL of DNA template;

[0049] (3) Reaction procedure: Real-time fluorescence quantitative PCR adopts a two-step method. The instrument used is the German analyticJenaqTOWER 2.0. The reaction includes 95°C pre-denaturation for 1 min, 1 cycle, and then 45 cycles, each cycle includes 95°C for 15 s and 60°C for 30 s;

[0050] (4) Standard curve: Using the 930 ng / μL, 93 ng / μL, 9.3 ng / μL, and 0.93 ng / μL dilutions in step (1) as templates, the reaction system in step (2) and the reaction procedure in step (3) were used to construct a standard curve, y = -3.4027x + 28.407, Note: y is the Ct value, and x is the lgDNA concentration in ng / μL.

[0051] 4. Detailed steps for collecting soil samples and extracting apple edge rot pathogen strains from soil samples:

[0052] About 50 g of soil samples were collected from the 15-20 cm tillage layer using the "W"-shaped random sampling method. The collected samples were marked and temporarily placed in a ziplock bag, away from direct sunlight, and stored at 4°C. 0.5 g of soil DNA was extracted using the QIAamp DNA Micro kit as a template. Pure strain DNA extraction was performed according to the method described in 3 Standard Curve Preparation.

[0053] 5. Fluorescence quantitative PCR detection: The DNA template obtained in step 3 is subjected to concentration determination and diluted to 10 ng / μL as a positive control. ddH2O is used as a negative control. The DNA of the sample to be tested is used as a template. The fluorescence quantitative PCR reaction system and reaction procedure in step 3 are used to perform quantitative PCR detection. The Ct value obtained by the detection is compared with the maximum Ct value of the standard curve established in (1). If the sample detection Ct is greater than the Ct corresponding to the minimum detection template concentration, that is, the sample Ct is greater than the maximum Ct of the standard curve, the sample can be judged as undetected. If the sample detection Ct is less than the Ct corresponding to the minimum detection template concentration, that is, the sample Ct is less than the maximum Ct of the standard curve, the sample can be judged as detected. The detected Ct can be substituted into the established standard curve (y=-3.4027x+28.407, note: y is the Ct value, x is the lgDNA concentration ng / μL) to calculate the concentration of apple edge rot fungus in the sample (ng / μL).

[0054] Example 2

[0055] Results of renaturation test: Verification of specific primers and probes of TaqMan fluorescent quantitative PCR for apple edge rot pathogen:

[0056] Other contents are as in Example 1. Fluorescence quantitative PCR reaction system: the total system is 20 μL, including 10 μL of Pro Taq HSProbe Premix (2X), 0.5 μL of specific primers PHMA-F / PHMA-R (both 10 μM), 0.5 μL of fluorescent probe PHMA-FAM (10 uM), 7.5 μL of ddH2O, and 1 μL of DNA template;

[0057] Reaction procedure: Real-time fluorescence quantitative PCR adopted a two-step method. The instrument used was German analyticJena qTOWER2.0. The reaction included pre-denaturation at 95°C for 1 min, 1 cycle, and then 45 cycles, each cycle including 95°C for 15 s and 60°C for 30 s.

[0058] Two strains of apple edge rot pathogen (QYF333, QYF344) and 12 other test strains were selected as shown in Table 1 for specificity verification, and ultrapure water was used as a blank control. TaqMan real-time quantitative PCR amplification detection was performed using specific primers PHMA-F / PHMA-R and probe PHMA-FAM.

[0059] Table 1 Information of the tested strains

[0060]

[0061]

[0062] The test results show that Figure 2As shown: the primer probe only has specific amplification for apple edge rot pathogen, but has no specific amplification for any other genomic DNA and blank control.

[0063] Example 3

[0064] Sensitivity detection of apple edge rot pathogen and establishment of standard curve:

[0065] Other contents As in Example 1, the genomic DNA of the test strain (QYF344) of apple edge rot fungus was diluted according to multiples, and the TaqMan fluorescent quantitative PCR method was used for detection with 930ng / μL, 93ng / μL, 9.3ng / μL, and 0.93ng / μL as templates. A standard curve was established, with the X-axis corresponding to the lg DNA concentration and the Y-axis corresponding to the read Ct value.

[0066] The test results show that Figure 3 Shown: TaqMan fluorescence quantitative PCR amplification correlation coefficient R 2 =0.9997, the standard curve equation is y=-3.4027x+28.407, the amplification efficiency is 96%, and the Ct value is linearly correlated with the logarithm of the template concentration.

[0067] Example 4

[0068] Repeat of TaqMan fluorescence PCR detection method for apple edge rot pathogen:

[0069] Other contents As in Example 1, the genomic DNA of the test strain (QYF344) of apple edge rot fungus was diluted according to multiples, and the TaqMan fluorescent quantitative PCR method was used to perform intra-group repeatability detection using 4 dilutions of DNA as templates. Three repeated tests were set for each concentration, as shown in Table 2 below:

[0070] Table 2 Repeatability test results of the TaqMan probe fluorescence quantitative PCR detection method for apple edge rot

[0071]

[0072] As shown in Table 2 above, the test results show that Figure 4 As shown: the standard deviation (SD) value within the group is between 0.15 and 0.22, and the coefficient of variation (CV) value is between 0.70 and 0.90, which shows that the detection method of the present invention has good repeatability and stability.

[0073] The above implementation / test examples are merely examples for the purpose of clear explanation, and are not intended to limit the implementation methods. For those skilled in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the implementation methods here. The obvious changes or modifications derived therefrom are still within the scope of protection of the invention.

[0074] Sequence Listing

[0075] <110> Institute of Microbiology, Chinese Academy of Sciences, Tibet Agricultural and Animal Husbandry College

[0076] <120> A primer set, composition, kit and method for identifying apple edge rot pathogen based on qPCR

[0077] <160> 3

[0078] <170> PatentIn version 3.3

[0079] <210> 1

[0080] <211> twenty four

[0081] <212> PHMA-F DNA

[0082] <213> Artificial sequence

[0083] <400> 1

[0084] ATACACGAACGCGACACAAAGAAT 24

[0085] <210> 2

[0086] <211> twenty four

[0087] <212> PHMA-R DNA

[0088] <213> Artificial sequence

[0089] <400> 12

[0090] ACCGTGCTCTCCTGAGATTGTT 22

[0091] <210> 3

[0092] <211> twenty four

[0093] <212> PHMA-FAM DNA

[0094] <213> Artificial sequence

[0095] <400> 3

[0096] AGTACTGATAAACATGCAGGC 21

Claims

1. A set of PCR amplification primers for identifying apple edge rot pathogens, characterized in that: The nucleotide sequence of the forward primer PHMA-F is shown in SEQ ID No.1, and the nucleotide sequence of the reverse primer PHMA-R is shown in SEQ ID No.

2.

2. A composition for identifying apple edge rot pathogens, characterized in that: The method comprises a primer probe for detection, wherein the primer probe is composed of the primer set according to claim 1 and a specific probe, the forward primer sequence of the primer set is shown as SEQ ID No.1, and the reverse primer sequence is shown as SEQ ID No.

2.

3. A composition for identifying apple edge rot pathogen according to claim 2, characterized in that: The nucleotide sequence of the probe PHMA-FAM is shown in SEQ ID No.

3.

4. The PCR primer set of claim 1, used in preparing a product for detecting or assisting in detecting apple edge rot, in preparing a product for identifying or assisting in identifying apple edge rot, in preparing a product for quantitatively detecting apple edge rot, in preparing a product for predicting plant infection with apple edge rot, in detecting or assisting in detecting apple edge rot, in identifying or assisting in identifying apple edge rot, in quantitatively detecting apple edge rot, or in predicting plant infection with apple edge rot.

5. A kit for detecting apple edge rot pathogen based on qPCR technology, characterized in that: The invention comprises the composition described in claims 2 and 3.

6. The apple edge rot fungus kit according to claim 2, characterized in that: The kit also includes MIX (2×) dedicated to the qPCR probe method, the specific primer pair and probe thereof as described in claims 2 and 3, and deionized water.

7. Use of the kit according to claim 5 or 6 in identifying apple edge rot pathogens.

8. A method for identifying apple edge rot pathogens based on qPCR technology, characterized in that: The following steps are involved: (1) Using serially diluted DNA extracted from apple edge rot pathogen as a template, using the primers and probes described in claim 1 and claim 2 to perform fluorescent quantitative PCR, and establishing a standard curve between the concentration of 1g DNA of edge rot pathogen and the Ct value; (2) extracting total DNA or microbial DNA from the sample to be tested; (3) using the DNA of the sample to be tested as a template and using the primers and probes described in claim 1 and claim 2 to perform fluorescent quantitative PCR to obtain a Ct value; (4) The Ct value obtained by the test is compared with the maximum Ct value of the standard curve established in (1). If the sample detection Ct is greater than the Ct corresponding to the minimum detection template concentration, that is, the sample Ct is greater than the maximum Ct of the standard curve, the sample can be judged as undetected. If the sample detection Ct is less than the Ct corresponding to the minimum detection template concentration, that is, the sample Ct is less than the maximum Ct of the standard curve, the sample can be judged as detected, and the detected Ct is substituted into the established standard curve to calculate the concentration of apple edge rot fungi in the sample.

9. The method for identifying apple edge rot pathogen based on qPCR technology according to claim 8, characterized in that: The standard curve is y=-3.4027x+28.407, wherein y is the Ct value and x is the lgDNA concentration ng / μL.

10. The method for identifying apple edge rot pathogen based on qPCR technology according to claim 8, characterized in that: The qPCR reaction system and conditions in step (2) are as follows: a two-step TaqMan fluorescent probe method is used for real-time fluorescence quantification. The total system for PCR reaction was 20 μL, including 10 μL of Pro Taq HS Probe Premix (2X), specific primers 0.5 μL each of PHMA-F / PHMA-R (both 10 μM), 0.5 μL of fluorescent probe PHMA-FAM (10 uM), 7.5 μL of ddH2O, and 1 μL of DNA template.

Images