Molecular marker for detecting functional variation of wheat pre-harvest sprouting resistance gene TaPI4K-2A and application of molecular marker in breeding

Abstract

The invention discloses a molecular marker for detecting functional variation of a wheat pre-harvest sprouting resistance gene TaPI4K-2A and application of the molecular marker in breeding, and relates to the technical field of wheat breeding, the molecular marker can correctly distinguish functional variation sites having remarkable influence on wheat pre-harvest sprouting resistance, marker-assisted selection is carried out according to a result in combination with pre-harvest sprouting phenotypes, and the wheat pre-harvest sprouting resistance gene TaPI4K-2A functional variation can be detected. The excellent germplasm containing the pre-harvest sprouting resistant site is screened for wheat pre-harvest sprouting resistant breeding, the breeding efficiency is improved, and the wheat pre-harvest sprouting resistant breeding process is accelerated.

Description

Technical Field

[0001] The present invention relates to the technical field of wheat breeding, and in particular to a molecular marker for detecting functional variation of a wheat ear sprout resistance gene TaPI4K-2A and an application thereof in breeding. Background Art

[0002] Wheat is one of the three major grain crops in my country and has made important contributions to ensuring national food security. Ensuring high and stable wheat yields is the key to ensuring national food security. Pre-harvest Sprouting (PHS) can lead to reduced wheat yield and deterioration of quality. It occurs in major wheat-producing areas around the world, causing losses of about US$1 billion each year, posing a serious threat to wheat production. The harm of pre-harvest sprouting to crops is mainly reflected in three aspects: first, after pre-harvest sprouting, the stored materials in the grains are continuously hydrolyzed and consumed, resulting in a decrease in bulk density and thousand-grain weight, which seriously affects crop yields; second, pre-harvest sprouting weakens seed germination potential, resulting in small and weak seedlings, and even causing a serious decrease in germination rate, causing significant economic losses to farmers and seed operators; third, pre-harvest sprouting reduces the content of nutrients in seeds, resulting in reduced dough extensibility, elasticity and water retention capacity, and changes in starch gelatinization, gelatinization and regeneration properties, which significantly affects the quality of rice noodles, noodles, cakes and bread.

[0003] Exploring ear sprout resistance genes / sites, developing functional markers for rapid and high-throughput detection of ear sprout resistance genes / sites, screening excellent germplasm with excellent ear sprout resistance genes / sites, cultivating ear sprout-resistant wheat varieties and promoting their planting are effective means to alleviate the harm caused by wheat ear sprout. The anti-ear sprouting gene TaPI4K-2A is an anti-ear sprouting gene reported by Tai et al. in 2024. This gene affects the wheat ear sprouting resistance by responding to the plant hormone abscisic acid (ABA) signal. The single nucleotide polymorphism site (SNP718, G / A) at 718bp in the coding region of the gene is located in the conserved kinase domain of TaPI4K-2A, which can cause a non-synonymous mutation replacement of alanine (Ala) / threonine (Thr) at position 240 in the amino acid sequence of TaPI4K-2A, resulting in the inability of the anti-ear sprouting gene TaPI4K-2A to autophosphorylate, thereby reducing its protein stability and weakening its interaction with TaSnRK2.1, an important kinase in ABA signaling, ultimately reducing the wheat ear sprouting resistance. Refer to Figure 1 . Summary of the invention

[0004] The present invention aims to provide a molecular marker for detecting the functional variation of wheat ear sprout resistance gene TaPI4K-2A and its application in breeding.

[0005] The present invention protects a molecular marker PI4K_CDS718 for detecting functional allelic variation of wheat anti-ear sprouting gene TaPI4K-2A. The molecular marker is designed based on the G / A single nucleotide polymorphism site at 718bp in the coding region of the anti-ear sprouting gene TaPI4K-2A. The physical position information is based on the reference genome Chinese Spring sequence. The marker is used to distinguish the SNP located at 718bp in the coding region of the TaPI4K-2A gene and detect the genotype of the SNP in different wheat varieties, wherein the anti-ear sprouting genotype is G / G, and the ear sprouting sensitive genotype is A / A.

[0006] The present invention also protects a primer pair for amplifying the above molecular marker, which is a KASP high-throughput SNP marker, including 2 forward primers and 1 reverse primer; the primer sequences are as follows:

[0007] PI4K_CDS718-FAM:

[0008] 5'GACAGGGTTCAGGGAGGTCG3', the nucleotide sequence of which is shown in SEQ ID NO.1;

[0009] PI4K_CDS718-HEX:

[0010] 5'GACAGGGTTCAGGGAGGTCA3', the nucleotide sequence of which is shown in SEQ ID NO.2;

[0011] PI4K_CDS718-R:

[0012] 5'CACAGATGAGGAGCCCTTCG 3', the nucleotide sequence of which is shown in SEQ ID NO.3.

[0013] The present invention also protects a detection kit containing the primer pair for identifying KASP molecular markers related to wheat ear sprout resistance traits.

[0014] The present invention also protects the use of the above primer pair or the above detection kit in molecular marker-assisted wheat ear sprout resistance selection breeding, and the specific operation is:

[0015] Using the DNA of the wheat sample to be tested as a template, PCR amplification is performed on the template using the primers shown in SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3 respectively;

[0016] Leveraging Applied Biosystems TM QuantStudio TMThe 1Plus real-time fluorescence quantitative PCR system performed genotyping on the amplified PCR products and collected the distribution results of SNPs in wheat. The judgment criteria were the color of the points and the position of the points on the horizontal or vertical axis: the signal was blue, clustered near the vertical axis and clustered together with the anti-ear sprouting control parent, and was judged to be the anti-ear sprouting genotype G / G; the signal was red, clustered together with the horizontal axis and the susceptible ear sprouting control parent, and was judged to be the susceptible ear sprouting genotype A / A.

[0017] The molecular marker PI4K_CDS718 provided by the present invention can correctly distinguish the functional variation site SNP718 that has a significant impact on the ear sprouting resistance of wheat. According to the result, marker-assisted selection is performed in combination with the ear sprouting phenotype to screen excellent germplasm containing the ear sprouting resistance site for wheat ear sprouting resistance breeding, thereby improving breeding efficiency and accelerating the wheat ear sprouting resistance breeding process. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 To identify the functional allelic variation in the coding region of the ear sprout resistance gene TaPI4K-2A;

[0019] Figure 2 This is the genotyping map of the molecular marker PI4K_CDS718 in 94 wheat varieties;

[0020] Figure 3 The results of detecting the molecular marker PI4K_CDS718 in 140 wheat varieties. DETAILED DESCRIPTION

[0021] In order to facilitate the understanding of the present invention, the present invention will be described more comprehensively below in conjunction with the accompanying drawings and specific embodiments. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the disclosure of the present invention more thoroughly understood.

[0022] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art of the present invention. The terms used in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention. The technical scheme of the present invention is described more clearly and completely below in conjunction with specific embodiments and comparative examples.

[0023] Note: The wheat varieties (lines) used in the embodiments of the present invention are all parent groups or varieties (lines) constructed from conventional parent varieties, and can be obtained from the market or other public channels.

[0024] 1. Extraction of wheat genomic DNA

[0025] 1) At the three-leaf stage of wheat, young wheat leaves were selected, numbered, and placed in corresponding 2 mL 96-well plates. They were dried using a freeze dryer and ground into powder using a high-throughput tissue grinder.

[0026] 2) Add 800 μL CTAB solution and place in a 65°C water bath for 60 minutes, shaking gently 3-5 times to fully lyse the DNA;

[0027] 3) Add 800 μL of chloroform-isoamyl alcohol (volume ratio 24:1) and shake gently for 10 minutes (operate in a fume hood);

[0028] 4) Centrifuge at 12000 rpm for 10 min, extract 600 μL of supernatant and place in a new 96-well plate with the corresponding serial number, add an equal volume of isopropanol and 1 / 10 volume of 3M sodium acetate to the supernatant;

[0029] 5) Centrifuge at 12000 rpm for 10 min in a high-speed refrigerated centrifuge, discard the supernatant, and wash twice with ice ethanol (70%);

[0030] 6) After drying until there is no ethanol smell, add 200 μL of double distilled water, and store in a -20℃ refrigerator after it is completely dissolved.

[0031] 2. Primer Design

[0032] According to the allelic variation at 718 bp in the coding region of the anti-ear sprouting gene TaPI4K-2A, Figure 1 KASP marker was designed using PolyMarker: the marker primers included 2 forward primers and 1 reverse primer, which were shown as SEQ NO.1, SEQ NO.2 and SEQ NO.3 respectively.

[0033] 3. Primer Dilution and Assay Primer Mixing

[0034] The three primers were diluted to 100 μM with ultrapure water and then mixed in a volume ratio of FAM:HEX:R:ultrapure water = 6:6:15:23. The mixed assay primers were stored in a -20°C refrigerator for later use.

[0035] 4. PCR Amplification

[0036] The PCR amplification system was prepared with the following ratios: 5 μL DNA template, 5 μL 2× Master Mix (LGC group UK) and 0.14 μL KASP primer mixture (synthesized by Shanghai Sangon Biotechnology Co., Ltd.).

[0037] The KASP marker PCR amplification procedure is:

[0038] 1) 94°C for 15 min;

[0039] 2) 94℃ for 20s;

[0040] 3) 61°C-55°C for 1 min; step 2) to step 3) for 10 cycles;

[0041] 4) 94℃ for 20s;

[0042] 5) 57°C for 1 min s, step 4) to step 5) for 30 cycles;

[0043] 6) Store at 4℃.

[0044] V. Results Analysis

[0045] Leveraging Applied Biosystems TM QuantStudio TM 1Plus real-time fluorescence quantitative PCR system was used to perform genotyping on the amplified PCR products and collect the distribution results of SNPs in wheat (such as Figure 2 ), the judgment criteria are the color of the points and the position on the horizontal or vertical axis: the signal is blue, clustered near the vertical axis and clustered together with the anti-ear sprout control parent, and judged as the anti-ear sprout genotype G / G; the signal is red, clustered with the horizontal axis and the susceptible ear sprout control parent, and judged as the susceptible ear sprout genotype A / A.

[0046] VI. Verification of the effect of ear sprout resistance gene TaPI4K-2A / molecular marker PI4K_CDS718 in wheat ear sprout resistance breeding

[0047] 140 wheat varieties were tested using the molecular markers provided by the present invention, and 131 wheat varieties with ear sprout resistance genotypes (genotype G / G) and 10 wheat varieties with ear sprout sensitivity genotypes (genotype A / A) were obtained. The ear germination rate of the wheat varieties containing the ear sprout resistance genotype was significantly lower than that of the wheat varieties containing the ear sprout sensitivity genotype, indicating that the functional variation SNP718 in the coding region of the ear sprout resistance gene TaPI4K-2A has a significant effect on the ear sprout resistance of wheat ( Figure 3 ). Based on the results and combined with the ear sprout phenotype, marker-assisted selection is performed to screen excellent germplasm containing ear sprout resistance loci for wheat ear sprout resistance breeding, improve breeding efficiency, and accelerate the wheat ear sprout resistance breeding process.

[0048] The above-mentioned embodiments only express several implementation methods of the present invention, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. A molecular marker for detecting functional variation of wheat anti-ear sprouting base TaPI4K-2A, characterized in that: This molecular marker is designed based on the G / A single nucleotide polymorphism site at 718bp in the coding region of the TaPI4K-2A gene for ear sprout resistance. It is used to distinguish the SNP located at 718bp in the coding region of the TaPI4K-2A gene and detect the genotype of this SNP in different wheat varieties, among which the ear sprout resistance genotype is G / G and the ear sprout sensitive genotype is A / A.

2. A primer pair for amplifying the molecular marker according to claim 1, characterized in that: The molecular marker is a high-throughput KASP marker, including 2 forward primers and 1 reverse primer; the primer sequences are as follows: PI4K_CDS718-FAM: 5'GACAGGGTTCAGGGAGGTCG3', the nucleotide sequence of which is shown in SEQ ID NO.1; PI4K_CDS718-HEX: 5'GACAGGGTTCAGGGAGGTCA3', the nucleotide sequence of which is shown in SEQ ID NO.2; PI4K_CDS718-R: 5'CACAGATGAGGAGCCCTTCG3', the nucleotide sequence of which is shown in SEQ ID NO.

3.

3. A detection kit containing the primer pair according to claim 2 for identifying KASP molecular markers related to wheat ear sprout resistance traits.

4. Use of the primer pair according to claim 2 or the detection kit according to claim 3 in molecular marker-assisted wheat ear sprout resistance selection breeding.

5. The use according to claim 5, characterized in that: The specific operations are: Using the DNA of the wheat sample to be tested as a template, PCR amplification is performed on the template using the primers shown in SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3 respectively; Leveraging Applied Biosystems TM QuantStudio TM The 1Plus real-time fluorescence quantitative PCR system performs genotyping on the amplified PCR products and collects the distribution results of SNPs in wheat. The judgment criteria are the color of the points and the position of the points on the horizontal or vertical axis: the signal is blue, clustered near the vertical axis and clustered together with the anti-ear sprout control parent, and is judged as the anti-ear sprout genotype G / G; The signal is red, clustered with the horizontal axis and the susceptible ear germination control parent, and determined to be the susceptible ear germination genotype A / A.

Images