Specific detection primer combination for watermelon spot blight and application of specific detection primer combination

Abstract

The invention relates to the technical field of molecular detection, in particular to a watermelon spot blight specific detection primer combination and application thereof, and the primer combination comprises an upstream primer SEQ1 and a downstream primer SEQ2; wherein the primer sequence of SEQ1 is as shown in SEQ ID NO.01, the sequence length is 19 bp, and the GC content is 74%; a primer sequence of SEQ2 is shown as SEQ ID NO.02, the sequence length is 21bp, the melting temperature is 58.3 DEG C, and the GC content is 74%; the primer combination SEQ1 and SEQ2 can effectively distinguish watermelon spot blight from leaf blight caused by fusarium, alternaria alternata, bacteria and anthracnose, has the capability of specifically detecting watermelon spot blight, is high in sensitivity, can detect existence of the watermelon spot blight even in the early stage of diseases and when the number of pathogens is small, and is helpful for timely and accurate taking of prevention and control measures.

Description

Technical Field

[0001] The invention relates to the technical field of molecular detection, in particular to a watermelon leaf spot pathogen-specific detection primer combination and application thereof. Background Art

[0002] Watermelon is an annual vine herb of the Cucurbitaceae family, the genus Citrullus, native to tropical Africa, with a long history of cultivation and a wide distribution area. In my country, watermelon has a short growth cycle, wide adaptability, strong drought resistance, high returns and quick results, and has become one of the important economic crops for rural prosperity. With the continuous domestication of watermelon, the susceptibility of cultivated varieties of watermelon to diseases has become stronger during the planting process. The leaf spot caused by the genus Cercospora on watermelon is one of them. Investigations and studies have found that it can not only cause diseases on the leaves of watermelon, but also infect vines, cotyledons and fruits, resulting in necrotic spots and even death of cotyledons, leaves and vines, and rot of fruits, which seriously endangers the production, storage and transportation of watermelon. Since the leaf disease symptoms caused by watermelon leaf blight on watermelon are very similar to those caused by Fusarium, Alternaria, bacteria and anthracnose, it is difficult to distinguish between watermelon leaf blight and watermelon anthracnose, and the ordinary separation and identification methods are relatively slow, which will limit the precise prevention and control of the disease. In view of this, we proposed a specific detection primer combination for watermelon leaf blight pathogen and its application. Summary of the invention

[0003] The object of the present invention is to provide a watermelon leaf spot pathogen-specific detection primer combination and application thereof, so as to solve the problems raised in the above-mentioned background technology.

[0004] To achieve the above object, the present invention provides a specific detection primer combination for watermelon leaf spot pathogen, the primer combination comprising an upstream primer SEQ1 and a downstream primer SEQ2; Among them, the primer sequence of SEQ1 is GGGCGACCCTGCCGTTTCG (SEQ ID NO.01), the sequence length is 19 bp, the melting temperature is 59.7 °C, and the GC content is 74%; The primer sequence of SEQ2 is GACTTTGAGGCGCGCGGAACA (SEQ ID NO. 02), with a sequence length of 21 bp, a melting temperature of 58.3° C., and a GC content of 74%.

[0005] Preferably, the method for obtaining the specific detection primer combination for watermelon leaf spot is as follows: by analyzing the ribosome internal transcribed spacer region, translation elongation factor gene, histone gene and actin gene sequence of 30 Cercospora fungi and Alternaria, Botrytis, Cladosporium, Cladosporium, Botrytis cinerea, Fusarium, and Cercospora fungi, specific primers for detecting watermelon leaf spot are designed according to the ITS sequence of Cercospora fungi.

[0006] The ITS sequence of the Cercospora fungus is shown in SEQ ID NO.03, specifically: TGGGCTGATGATTCGGGCTCGACCTCCACCCTTTGTGAACACAACTTGTTGCTTCGGGGGCGACCCTGCCGTTTCGACGGCGAGCGCCCCCGGAGGCCTTCAAACACTGCATCTTTGCGTCGGAGTTTAAGTAAATTAAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAAT CTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCGCCGGTGTTCCGCGCGCCTCAAAGTCTCCGGCTGAGCTGTCCGTCTCTAAGCGTTGTGATTTCATTAATCGCTTCGGAGCGCGGGCGGTCGCGGCCGTTAAATCTTTCACAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAAC; Preferably, the watermelon leaf blight pathogen-specific detection primer combination is used in the early diagnosis and identification of watermelon leaf blight pathogen.

[0007] Preferably, the method for specific detection of watermelon leaf spot pathogen using the primer combination comprises the following specific steps: S1: Extract the genomic DNA to be tested as a template; S2: using SEQ1 and SEQ2 as primers, adopting PCR amplification method to obtain PCR amplification products, and performing gel electrophoresis detection using electrophoresis detection method; S3: If a DNA band with a molecular weight of 300 bp is present, it indicates that the sample to be tested contains watermelon leaf spot pathogen.

[0008] Preferably, the CTAB method is used to extract the genomic DNA to be tested, and the specific steps are as follows: S1.1. Scrape 0.5 g of the sample to be extracted into a 2 mL centrifuge tube, add 600 μL of CTAB extraction buffer to each tube, put in 2 steel beads, and use Tissuelyser-192 to break it, setting the frequency to 60.00 Hz and the time to 240 s; S1.2. After crushing, place in a 65℃ water bath for 60 minutes, invert and mix every 15 minutes; S1.3, after water bath, add 600 mL of a mixture of chloroform and isoamyl alcohol, wherein the volume ratio of chloroform to isoamyl alcohol is 24:1, mix thoroughly, and centrifuge at 12000 rpm for 10 min; S1.4, take 600 μL of supernatant, add pre-cooled isopropanol of equal volume to the supernatant, mix well and place at -20°C for 30 min; S1.5, centrifuge at 12000rpm for 10min, discard the supernatant, wash the precipitate once with 70% ethanol, and air-dry at room temperature until there is no ethanol smell; S1.6, add 200 μL ddHO 2 O and placed in a 65°C water bath for 20 min with ddHO 2 3. Add 1 μL of 10 mg / mL RNase D to obtain genomic DNA.

[0009] Preferably, the PCR reaction system of the PCR amplification method is: 1 μL of 50 ng / μL genomic DNA, 5 μL of Taq Mix, 0.4 μL of SEQ1 (10 μM), 0.4 μL of SEQ2 (10 μM), ddH 2 2 μL of HO, for a total of 10 μL.

[0010] Preferably, the PCR reaction procedure of the PCR amplification method is: stage 1: pre-denaturation at 94°C for 5 min; stage 2: denaturation at 94°C for 30 s, annealing at 68-72.5°C for 30 s, extension at 72°C for 30 s, for a total of 35 cycles; stage 3: extension at 72°C for 5 min; stage 4: hold at 4°C.

[0011] Preferably, the electrophoresis detection method is specifically: Use 1×TAE to prepare 1.5% agarose gel, heat it in a microwave oven to completely dissolve it, then cool it slightly to 45-55℃, add nucleic acid dye at a ratio of 1:10000 and shake well, then pour it into the gel slot with the comb inserted, and remove the comb after the gel is completely solidified, take 4μL of PCR amplification product, add 1μL 10×loading buffer, mix well and add it to the spotting well, run electrophoresis at 130V for 20min, take pictures with a gel imager after the electrophoresis, and determine the size of the target fragment by comparing with the DL2000 DNA Marker.

[0012] Preferably, the minimum detection limit of the primer combination for watermelon leaf spot pathogen is 100 pg / μL.

[0013] Preferably, the primer combination has a detection rate of 100% for watermelon leaf spot pathogenic fungus samples.

[0014] Compared with the prior art, the present invention has the following beneficial effects: In the watermelon leaf blight pathogen-specific detection primer combination and application thereof, the primer combination SEQ1 and SEQ2 are used to specifically detect Cercospora strains through common PCR, thereby achieving qualitative detection of the pathogen of watermelon leaf blight, and at the same time, diseases caused by Cercospora in watermelon can be quickly detected, and the presence of the pathogen can be detected in the early stage of leaf blight inoculation. The detection rate of diseased samples is as high as 100%, the detection accuracy is high, and the specificity is good, which is very important for timely and accurate prevention and control measures. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 It is a schematic diagram of primer combination annealing temperature and specific amplification test results; Figure 2 It is a schematic diagram of the experimental results of primer combination specific amplification detection; Figure 3 It is a schematic diagram of the results of the primer combination sensitivity detection experiment; Figure 4 This is a schematic diagram of the test results of primer combinations for diseased samples inoculated with watermelon leaf spot pathogen at different times; Figure 5 Schematic diagram of photos of watermelon leaves cultured for 1d, 2d, and 3d after inoculation; Figure 6 This is a schematic diagram of the symptoms of watermelon leaf spot disease; Figure 7 This is the microscopic observation result of watermelon leaf spot pathogen; Figure 8 This is a picture of the colony morphology of watermelon leaf spot pathogen.

[0016] Illustration Description: Figure 1In the figure, 1: Alternaria; 2: Botrytis cinerea; 3: Cladosporium; 4: Cladosporium; 5: Botrytis cinerea; 6: Fusarium; 7: Cyperus rotundus; 8: Citronella leaf spot; M: DL2000 DNA Marker; Figure 2 Middle, 1: watermelon leaf spot pathogen; 2: healthy diseased leaves of watermelon; N: negative control; Figure 3 Medium, stock solution: 15 ng / μL; 5×: 3 ng / μL; 10×: 1.5 ng / μL; 50×: 0.3 ng / μL; 100×: 0.15 ng / μL; 150×: 0.1 ng / μL; 200×: 0.05 ng / μL; N: negative control; Figure 4 In the middle, 1-3: 1-day-old diseased leaves; 4-6: 2-day-old diseased leaves; 7-9: 3-day-old diseased leaves; 10, 11: DNA of watermelon leaf spot pathogen; CK1, CK2: healthy leaves of watermelon; N: negative control; Figure 6 Middle, A: leaf lesions; B: leaf symptoms; CF: fruit symptoms; G: cotyledon symptoms; H, I: vine symptoms; Figure 7 Middle, A: conidiophore; BC: conidia DETAILED DESCRIPTION

[0017] The following will be combined with the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of the present invention.

[0018] The invention discloses a watermelon leaf spot pathogen-specific detection primer combination, comprising the following components: the primer combination comprises an upstream primer SEQ1 and a downstream primer SEQ2; Among them, the primer sequence of SEQ1 is GGGCGACCCTGCCGTTTCG (SEQ ID NO.01), the sequence length is 19 bp, the melting temperature is 59.7°C, and the GC content is 74%; The primer sequence of SEQ2 is GACTTTGAGGCGCGCGGAACA (SEQ ID NO. 02), with a sequence length of 21 bp, a melting temperature of 58.3°C, and a GC content of 74%.

[0019] Example 1: Annealing temperature and specific amplification test of a primer combination for specific detection of watermelon leaf spot pathogen: S1: Extract the genomic DNA to be tested as a template, and use the CTAB method to extract the genomic DNA of Alternaria, Botrytis cinerea, Cladosporium, Cladosporium, Botrytis cinerea, Fusarium, Phyllosporium solani, and Phyllosporium solani, respectively. The specific steps of genomic DNA extraction are as follows: S1.1. Scrape 0.5 g of the sample to be extracted into a 2 mL centrifuge tube, add 600 μL of CTAB extraction buffer to each tube, put in 2 steel beads, and use Tissuelyser-192 to break it, setting the frequency to 60.00 Hz and the time to 240 s; S1.2. After crushing, place in a 65℃ water bath for 60 minutes, invert and mix every 15 minutes; S1.3, after water bath, add 600 mL of a mixture of chloroform and isoamyl alcohol, wherein the volume ratio of chloroform to isoamyl alcohol is 24:1, mix thoroughly, and centrifuge at 12000 rpm for 10 min; S1.4, take 600 μL of supernatant, add pre-cooled isopropanol of equal volume to the supernatant, mix well and place at -20°C for 30 min; S1.5, centrifuge at 12000rpm for 10min, discard the supernatant, wash the precipitate once with 70% ethanol, and air-dry at room temperature until there is no ethanol smell; S1.6, add 200 μL ddHO 2 O and placed in a 65°C water bath for 20 min with ddHO 2 O containing 1 μL of 10 mg / mL RNase, to obtain genomic DNA of Alternaria, Botrytis cinerea, Cladosporium sporeans, Cladosporium sporeans, Botrytis cinerea, Fusarium sporeans, Psoralea corylifolia and Psoralea cinerea, and to detect the concentration of fungal DNA on NanoPhotometer® N50, respectively. The sampling volume during the detection was 1 μL, and the concentration of fungal DNA was adjusted to be consistent; S2: Using SEQ1 and SEQ2 as primers, adopting PCR amplification method, obtaining PCR amplification products, and performing gel electrophoresis detection by electrophoresis detection method; wherein, 6 groups of PCR amplification experiments were performed, and the annealing temperatures were 65°C, 66.5°C, 68°C, 69.5°C, 71°C, and 72.5°C respectively; The PCR reaction system was: 50 ng / μL genomic DNA 1 μL, Taq Mix 5 μL, SEQ1 (10 μM) 0.4 μL, SEQ2 (10 μM) 0.4 μL, ddH 2O 3.2μL, a total of 10μL, PCR reaction program is: stage 1: 94℃ pre-denaturation for 5min; stage 2: 94℃ denaturation for 30s, annealing at 65℃, 66.5℃, 68℃, 69.5℃, 71℃ and 72.5℃ for 30s, extension at 72℃ for 30s, a total of 35 cycles; stage 3: 72℃ extension for 5min; stage 4: 4℃ hold; The specific electrophoresis detection method is: Prepare 1.5% agarose gel with 1×TAE, heat it in a microwave oven to completely dissolve it, cool it down to 45-55℃, add nucleic acid dye at a ratio of 1:10000 and shake well, then pour it into the gel tank with the comb inserted. After the gel is completely solidified, pull out the comb, take 4μL of PCR amplification product, add 1μL 10×loading buffer, mix well and add it to the spotting well, run electrophoresis at 130V for 20min, take pictures with a gel imager after the electrophoresis is completed, and determine the size of the target fragment by comparing it with the DL2000 DNA Marker; S3: If there is a DNA band with a molecular weight of 300 bp, it proves that the sample to be tested contains watermelon leaf spot pathogen; Test results: Figure 1 The results showed that when the annealing temperature was in the range of 65-66.5°C, the primer combination had non-specific amplification in the reference strains (Alternaria, Botrytis, Cladosporium, Cladosporium, Botrytis cinerea, Fusarium, and Psoralea corylifolia). When the annealing temperature reached above 68°C, the primer combination could only specifically amplify a 300bp fragment in the genomic DNA of Psoralea corylifolia.

[0020] Example 2: A specific amplification detection experiment of a specific detection primer combination for watermelon leaf spot pathogen: S1: Extract the genomic DNA to be tested as a template, select watermelon leaves containing watermelon leaf spot pathogen and healthy watermelon leaves as samples for genome extraction, use the genomic DNA of healthy watermelon leaves as a reference, and use the CTAB method to extract the genomic DNA of watermelon leaves containing watermelon leaf spot pathogen and healthy watermelon leaves respectively. The specific steps of genomic DNA extraction are as follows: S1.1. Scrape 0.5 g of the sample to be extracted into a 2 mL centrifuge tube, add 600 μL of CTAB extraction buffer to each tube, put in 2 steel beads, and use Tissuelyser-192 to break it, setting the frequency to 60.00 Hz and the time to 240 s; S1.2. After crushing, place in a 65℃ water bath for 60 minutes, invert and mix every 15 minutes; S1.3, after water bath, add 600 mL of a mixture of chloroform and isoamyl alcohol, wherein the volume ratio of chloroform to isoamyl alcohol is 24:1, mix thoroughly, and centrifuge at 12000 rpm for 10 min; S1.4, take 600 μL of supernatant, add pre-cooled isopropanol of equal volume to the supernatant, mix well and place at -20°C for 30 min; S1.5, centrifuge at 12000rpm for 10min, discard the supernatant, wash the precipitate once with 70% ethanol, and air-dry at room temperature until there is no ethanol smell; S1.6, add 200 μL ddHO 2 O and placed in a 65°C water bath for 20 min with ddHO 2 O containing 1 μL of 10 mg / mL RNase, to obtain genomic DNA of watermelon leaves containing watermelon leaf spot pathogen and genomic DNA of healthy watermelon leaves; S2: using SEQ1 and SEQ2 as primers, adopting PCR amplification method to obtain PCR amplification products, and performing gel electrophoresis detection using electrophoresis detection method; The PCR reaction system was: 50 ng / μL genomic DNA 1 μL, Taq Mix 5 μL, SEQ1 (10 μM) 0.4 μL, SEQ2 (10 μM) 0.4 μL, ddH 2 O 3.2μL, a total of 10μL, PCR reaction program is: stage 1: 94℃ pre-denaturation for 5min; stage 2: 94℃ denaturation for 30s, 68℃ annealing for 30s, 72℃ extension for 30s, a total of 35 cycles; stage 3: 72℃ extension for 5min; stage 4: 4℃ hold; The specific electrophoresis detection method is: Prepare 1.5% agarose gel with 1×TAE, heat it in a microwave oven to completely dissolve it, cool it down to 45-55℃, add nucleic acid dye at a ratio of 1:10000 and shake well, then pour it into the gel tank with the comb inserted. After the gel is completely solidified, pull out the comb, take 4μL of PCR amplification product, add 1μL 10×loading buffer, mix well and add it to the spotting well, run electrophoresis at 130V for 20min, take pictures with a gel imager after the electrophoresis is completed, and determine the size of the target fragment by comparing it with the DL2000 DNA Marker; S3: If there is a DNA band with a molecular weight of 300 bp, it proves that the sample to be tested contains watermelon leaf spot pathogen; Test results: Figure 2The results showed that the primer combination could only specifically amplify a 300bp fragment within the genome of the pathogenic bacteria, but no fragment was amplified in the host (i.e., healthy diseased leaves of watermelon). Therefore, the primer combination can be used to specifically detect the presence of the pathogenic bacteria in watermelon.

[0021] Example 3: Sensitivity test experiment of a specific primer combination for detecting watermelon leaf spot pathogen: S1: Extract the genomic DNA to be tested as a template, select watermelon leaves containing watermelon leaf spot pathogen as the sample to be extracted, and use the CTAB method to extract the genomic DNA of watermelon leaves containing watermelon leaf spot pathogen and healthy watermelon leaves respectively. The specific steps of genomic DNA extraction are as follows: S1.1. Scrape 0.5 g of the sample to be extracted into a 2 mL centrifuge tube, add 600 μL of CTAB extraction buffer to each tube, put in 2 steel beads, and use Tissuelyser-192 to break it, setting the frequency to 60.00 Hz and the time to 240 s; S1.2. After crushing, place in a 65℃ water bath for 60 minutes, invert and mix every 15 minutes; S1.3, after water bath, add 600 mL of a mixture of chloroform and isoamyl alcohol, wherein the volume ratio of chloroform to isoamyl alcohol is 24:1, mix thoroughly, and centrifuge at 12000 rpm for 10 min; S1.4, take 600 μL of supernatant, add pre-cooled isopropanol of equal volume to the supernatant, mix well and place at -20°C for 30 min; S1.5, centrifuge at 12000rpm for 10min, discard the supernatant, wash the precipitate once with 70% ethanol, and air-dry at room temperature until there is no ethanol smell; S1.6, add 200 μL ddHO 2 O and placed in a 65°C water bath for 20 min with ddHO 2 O containing 1 μL of 10 mg / mL RNase to obtain genomic DNA of watermelon leaf spot pathogen; S2: Take 15 ng / μL of genomic DNA of watermelon leaf spot pathogen, dilute the genomic DNA of watermelon leaf spot pathogen by 5, 10, 50, 100, 150, and 200 times to 3 ng / μL, 1.5 ng / μL, 0.3 ng / μL, 0.15 ng / μL, 0.1 ng / μL, and 0.075 ng / μL, then use SEQ1 and SEQ2 as primers, adopt PCR amplification method, obtain PCR amplification product, and perform gel electrophoresis detection by electrophoresis detection method; The PCR reaction system was: 50 ng / μL genomic DNA 1 μL, Taq Mix 5 μL, SEQ1 (10 μM) 0.4 μL, SEQ2 (10 μM) 0.4 μL, ddH 2 O 3.2μL, a total of 10μL, PCR reaction program is: stage 1: 94℃ pre-denaturation for 5min; stage 2: 94℃ denaturation for 30s, 68℃ annealing for 30s, 72℃ extension for 30s, a total of 35 cycles; stage 3: 72℃ extension for 5min; stage 4: 4℃ hold; The specific electrophoresis detection method is: Prepare 1.5% agarose gel with 1×TAE, heat it in a microwave oven to completely dissolve it, cool it down to 45-55℃, add nucleic acid dye at a ratio of 1:10000 and shake well, then pour it into the gel tank with the comb inserted. After the gel is completely solidified, pull out the comb, take 4μL of PCR amplification product, add 1μL 10×loading buffer, mix well and add it to the spotting well, run electrophoresis at 130V for 20min, take pictures with a gel imager after the electrophoresis is completed, and determine the size of the target fragment by comparing it with the DL2000 DNA Marker; S3: If there is a DNA band with a molecular weight of 300 bp, it proves that the sample to be tested contains watermelon leaf spot pathogen; Test results: Figure 3 The results showed that the primer combination was sensitive to watermelon leaf spot pathogen and could detect DNA samples with a minimum concentration of 100 pg / μL (i.e. 0.1 ng / μL).

[0022] Example 4: An experiment on detecting diseased samples inoculated with watermelon leaf blight pathogen at different times using a combination of primers specific for detecting watermelon leaf blight pathogen: The watermelon leaf spot pathogen was inoculated on the PDA culture medium and cultured at 28°C for 15 days before use; the sterile watermelon seedlings grown in the laboratory were disinfected with 75% alcohol, rinsed with sterile water for 3 times, and then the surface moisture was dried with sterile absorbent paper; the watermelon leaves were stabbed with a disinfected inoculation needle, and a 6mm bacterial cake was taken from the edge of the watermelon leaf spot pathogen colony and inoculated into the wound, with the mycelium surface in contact with the leaf wound, and the treatment of inoculation with the PDA culture medium was used as a negative control; the inoculated watermelon leaves were placed in a fresh-keeping box for moisturizing culture for 1d, 2d, and 3d, and then samples were taken, quickly frozen with liquid nitrogen, and stored at -80°C; S1: Extract the genomic DNA to be tested as a template; use the CTAB method to extract three copies of DNA from diseased leaves inoculated with watermelon leaf spot pathogen for 1 day, marked as sample 1, sample 2, and sample 3; extract three copies of DNA from diseased leaves inoculated with watermelon leaf spot pathogen for 2 days, marked as sample 4, sample 5, and sample 6; extract three copies of DNA from diseased leaves inoculated with watermelon leaf spot pathogen for 3 days, marked as sample 7, sample 8, and sample 9; extract two copies of DNA from watermelon leaf spot pathogen inoculated with PDA medium as a positive control group, marked as samples 10 and 11; extract two copies of DNA from healthy watermelon leaves, marked as samples CK1 and CK2; and extract one copy of blank control group as sample N. The specific steps of genomic DNA extraction are as follows: S1.1. Scrape 0.5 g of the sample to be extracted into a 2 mL centrifuge tube, add 600 μL of CTAB extraction buffer to each tube, put in 2 steel beads, and use Tissuelyser-192 to break it, setting the frequency to 60.00 Hz and the time to 240 s; S1.2. After crushing, place in a 65℃ water bath for 60 minutes, invert and mix every 15 minutes; S1.3, after water bath, add 600 mL of a mixture of chloroform and isoamyl alcohol, wherein the volume ratio of chloroform to isoamyl alcohol is 24:1, mix thoroughly, and centrifuge at 12000 rpm for 10 min; S1.4, take 600 μL of supernatant, add pre-cooled isopropanol of equal volume to the supernatant, mix well and place at -20°C for 30 min; S1.5, centrifuge at 12000rpm for 10min, discard the supernatant, wash the precipitate once with 70% ethanol, and air-dry at room temperature until there is no ethanol smell; S1.6, add 200 μL ddHO 2 O and placed in a 65°C water bath for 20 min with ddHO 2 O containing 1 μL of 10 mg / mL RNase to obtain genomic DNA; S2: Samples 1-11, CK1-CK2 and N are amplified by PCR using SEQ1 and SEQ2 as primers to obtain PCR amplification products, which are then detected by gel electrophoresis using an electrophoresis detection method; The PCR reaction system was: 50 ng / μL genomic DNA 1 μL, Taq Mix 5 μL, SEQ1 (10 μM) 0.4 μL, SEQ2 (10 μM) 0.4 μL, ddH 2 O 3.2μL, a total of 10μL; PCR reaction program: stage 1: 94℃ pre-denaturation for 5min; stage 2: 94℃ denaturation for 30s, 68℃ annealing for 30s, 72℃ extension for 30s, a total of 35 cycles; stage 3: 72℃ extension for 5min; stage 4: 4℃ hold; The specific electrophoresis detection method is: Prepare 1.5% agarose gel with 1×TAE, heat it in a microwave oven to completely dissolve it, cool it down to 45-55℃, add nucleic acid dye at a ratio of 1:10000 and shake well, then pour it into the gel tank with the comb inserted. After the gel is completely solidified, pull out the comb, take 4μL of PCR amplification product, add 1μL 10×loading buffer, mix well and add it to the spotting well, run electrophoresis at 130V for 20min, take pictures with a gel imager after the electrophoresis is completed, and determine the size of the target fragment by comparing it with the DL2000 DNA Marker; S3: If there is a DNA band with a molecular weight of 300 bp, it proves that the sample to be tested contains watermelon leaf spot pathogen; Test results: Figure 5 These are photos of watermelon leaves cultured 1d, 2d, and 3d after inoculation. Figure 4 The results showed that the primer combination could reliably detect the presence of watermelon leaf blight pathogen at different time points (1 day, 2 days, and 3 days) after inoculation, and the detection rate of watermelon leaf blight pathogen disease samples was as high as 100%.

[0023] In summary, by designing the primer combination SEQ1 and SEQ2, it is possible to effectively distinguish watermelon leaf blight from leaf blight caused by Fusarium, Alternaria, bacteria, and anthracnose. It has the ability to specifically detect watermelon leaf blight pathogen with high sensitivity. Even in the early stage of the disease, when the number of pathogens is small, its presence can be detected, which helps to take timely and accurate prevention and control measures.

[0024] The above shows and describes the basic principles, main features and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited by the above embodiments, and the above embodiments and descriptions are only preferred examples of the present invention, and are not intended to limit the present invention. Without departing from the spirit and scope of the present invention, the present invention may have various changes and improvements, and these changes and improvements all fall within the scope of the present invention to be protected.

Claims

1. A primer combination for specific detection of watermelon leaf spot pathogen, characterized in that: The primer combination includes an upstream primer SEQ1 and a downstream primer SEQ2; Among them, the primer sequence of SEQ1 is shown in SEQ ID NO.01, the sequence length is 19 bp, the melting temperature is 59.7°C, and the GC content is 74%; The primer sequence of SEQ2 is shown in SEQ ID NO.02, with a sequence length of 21 bp, a melting temperature of 58.3° C., and a GC content of 74%.

2. The watermelon leaf spot pathogen-specific detection primer combination according to claim 1, characterized in that: The watermelon leaf spot pathogen-specific detection primer combination is obtained by analyzing the ribosome internal transcribed spacer region, translation elongation factor gene, histone gene and actin gene sequence of 30 Cercospora fungi and Alternaria, Botrytis cinerea, Cladosporium, Cladosporium, Botrytis cinerea, Fusarium, and Psoralea corylifolia fungi, and designing specific primers for watermelon leaf spot pathogen detection according to the ITS sequence of Cercospora fungi.

3. Use of the watermelon leaf blight pathogen-specific detection primer combination according to any one of claims 1 to 2 in the early diagnosis and identification of watermelon leaf blight pathogen.

4. The use of the watermelon spot blight pathogen-specific detection primer combination according to claim 3 in early diagnosis and identification of watermelon spot blight pathogen, comprising a method for specific detection of watermelon spot blight pathogen using the watermelon spot blight pathogen-specific detection primer combination, characterized in that: The specific steps include: S1: Extract the genomic DNA to be tested as a template; S2: using SEQ1 and SEQ2 as primers, adopting PCR amplification method to obtain PCR amplification products, and performing gel electrophoresis detection using electrophoresis detection method; S3: If a DNA band with a molecular weight of 300 bp is present, it indicates that the sample to be tested contains watermelon leaf spot pathogen.

5. The use of the watermelon leaf spot specific detection primer combination according to claim 4 in the early diagnosis and identification of watermelon leaf spot pathogen, characterized in that: The CTAB method is used to extract the genomic DNA to be tested, and the specific steps are as follows: S1.

1. Scrape 0.5 g of the sample to be extracted into a 2 mL centrifuge tube, add 600 μL of CTAB extraction buffer to each tube, put in 2 steel beads, and use Tissuelyser-192 to break it up, setting the frequency to 60.00 Hz and the time to 240 s; S1.

2. After crushing, place in a 65℃ water bath for 60 minutes, invert and mix every 15 minutes; S1.3, after water bath, add 600 mL of a mixture of chloroform and isoamyl alcohol, wherein the volume ratio of chloroform to isoamyl alcohol is 24:1, mix thoroughly, and centrifuge at 12000 rpm for 10 min; S1.4, take 600 μL of supernatant, add pre-cooled isopropanol of equal volume to the supernatant, mix well and place at -20℃ for 30 min; S1.5, centrifuge at 12000 rpm for 10 min, discard the supernatant, wash the precipitate once with 70% ethanol, and air-dry at room temperature until there is no ethanol smell; S1.

6. Add 200 μL ddH2O, and place in a 65°C water bath for 20 min. The ddH2O contains 1 μL 10 mg / mL RNase to obtain genomic DNA.

6. The use of the watermelon leaf spot specific detection primer combination according to claim 4 in the early diagnosis and identification of watermelon leaf spot pathogen, characterized in that: The PCR reaction system of the PCR amplification method is: 1 μL of 50 ng / μL genomic DNA, 5 μL of Taq Mix, 0.4 μL of SEQ1 (10 μM), 0.4 μL of SEQ2 (10 μM), 3.2 μL of ddH2O, a total of 10 μL.

7. The use of the watermelon leaf spot specific detection primer combination according to claim 4 in the early diagnosis and identification of watermelon leaf spot pathogen, characterized in that: The PCR reaction procedure of the PCR amplification method is as follows: stage 1: pre-denaturation at 94°C for 5 min; stage 2: denaturation at 94°C for 30 s, annealing at 68-72.5°C for 30 s, extension at 72°C for 30 s, for a total of 35 cycles; stage 3: extension at 72°C for 5 min; stage 4: holding at 4°C.

8. The use of the watermelon leaf spot specific detection primer combination according to claim 4 in the early diagnosis and identification of watermelon leaf spot pathogen, characterized in that: The electrophoresis detection method is specifically: Use 1×TAE to prepare 1.5% agarose gel, heat it in a microwave oven to completely dissolve it, then cool it slightly to 45-55℃, add nucleic acid dye at a ratio of 1:10000 and shake well, then pour it into the gel slot with the comb inserted, and remove the comb after the gel is completely solidified, take 4μL of PCR amplification product, add 1μL 10×loading buffer, mix well and add it to the spotting well, run electrophoresis at 130V for 20min, take pictures with a gel imager after the electrophoresis, and determine the size of the target fragment by comparing with the DL2000 DNA Marker.

9. The use of the watermelon leaf spot specific detection primer combination according to claim 4 in the early diagnosis and identification of watermelon leaf spot pathogen, characterized in that: The minimum detection limit of the primer combination for watermelon leaf spot pathogen is 100 pg / μL.

10. The use of the watermelon leaf spot specific detection primer combination according to claim 4 in the early diagnosis and identification of watermelon leaf spot pathogen, characterized in that: The detection rate of the primer combination for watermelon leaf spot pathogenic fungus samples reached 100%.

Images