Bean lectin extraction equipment and microfluidic detection method thereof

Abstract

The invention provides a bean agglutinin extraction device and a microfluidic detection method thereof.The device comprises a sample bin, an eluent bin, a pretreatment module and a detection module, bean agglutinin is efficiently captured by fixing a first nucleic acid aptamer capable of being combined with bean agglutinin on a thin-layer plate of the pretreatment module, and after elution with an eluent, the first nucleic acid aptamer can be used for detecting the bean agglutinin; the content of various bean lectins in legume vegetables is accurately detected through the detection module, a test strip or an electrochemical detection part containing a second aptamer probe is arranged in the detection module, and an eluent formula and sequences of a first aptamer and a second aptamer are optimized respectively; the device can respectively realize qualitative and quantitative detection of various bean lectins, is simple in structure and convenient and efficient in detection, and can ensure the accuracy of a detection result.

Description

Technical Field

[0001] The invention relates to the technical field of lectin detection, and in particular to a bean lectin extraction device and a microfluidic detection method thereof. Background Art

[0002] Legumes contain a variety of allergens, including a variety of lectins. Lectins in legumes are proteins that have the ability to bind to specific sugars. Some types of lectins may cause discomfort during digestion or have other health effects.

[0003] Existing methods for detecting lectins include hemagglutination, antibody and liquid chromatography, but all of these methods have limitations. For example, the main problems with the hemagglutination method are limited specificity, background agglutination and susceptibility to operating conditions. Antibody methods, such as "A simple and rapid method for the detection of lectins in seeds using dot-blot analysis", provide a dot hybridization analysis method to detect lectins in legume vegetables based on the principle of antigen-antibody specific binding. First, the sample containing potential lectins is spotted onto a nitrocellulose membrane or other suitable solid support, and then incubated with specific antibodies (antibodies against lectins). If the sample contains lectins, they will bind to the antibodies. Finally, the presence of antibody-antigen complexes is detected by color reaction or fluorescent labeling. However, the main problems with antibody detection are that it is easy to cross-react, is not sensitive enough to target molecule detection, has quality differences between different batches of antibodies, and is easily affected by operation. Liquid chromatography has obvious disadvantages, such as high cost, long time required, and high sample processing requirements. In order to obtain higher economic benefits, it is necessary to develop a fast, simple and cost-effective method.

[0004] Existing detection technologies usually require more complex equipment and longer time costs, and cannot achieve the quantification of multiple lectins in legumes. Different lectins have different toxicities, and how to effectively distinguish toxic and non-toxic lectins in legumes is the key to safety evaluation.

[0005] Therefore, there is an urgent need to find a method and equipment that can quickly and efficiently enrich and detect lectins in legume vegetables. The equipment needs to have the advantages of portability and field application, high throughput, high sensitivity, and low cost. It can also shorten the detection time, reduce the detection cost and improve the detection accuracy. Summary of the invention

[0006] To solve the above problems, the present invention provides a bean lectin extraction device and a microfluidic detection method thereof. The device comprises a sample chamber, an eluent chamber, a pretreatment module and a detection module. The first nucleic acid aptamer capable of binding to the bean lectin is fixed on a thin layer plate of the pretreatment module to efficiently capture the bean lectin. After elution with the eluent, the detection module accurately detects the contents of various bean lectins in bean vegetables. The test strip in the detection module or the electrochemical detection component containing the second nucleic acid aptamer probe, and the eluent formula, the sequence of the first nucleic acid aptamer and the second nucleic acid aptamer are optimized respectively, so that the device can respectively realize the qualitative and quantitative detection of various bean lectins. The device has a simple structure, convenient and efficient detection, and can ensure the accuracy of the detection results.

[0007] On the one hand, the present invention provides a detection device, which includes a pretreatment module and a detection module. The pretreatment module includes an enrichment medium, in which a nucleic acid aptamer capable of adsorbing a target analyte is fixed, and is used to enrich the target analyte to obtain a sample liquid to be tested; the detection module is used to detect the target analyte in the sample liquid to be tested.

[0008] The enrichment medium described in the present invention refers to a solid phase medium that can intercept, adsorb or capture the target object to be detected from the sample, including thin layer plates, filter plates, resins, etc. For liquid samples with good fluidity, any material of thin layer plates, filter plates, and resins can be selected as the enrichment medium; for samples with relatively viscous and poor fluidity, thin layer plates are preferably used as the enrichment medium, which can more efficiently attach the target object to be detected.

[0009] The present invention ingeniously utilizes the property that nucleic acid aptamers can bind to target substances with high specificity and selectivity, and fixes the nucleic acid aptamers of the target analyte on the enrichment medium, thereby significantly improving the ability of the enrichment medium to intercept and adsorb the target analyte, so that the target analyte can be specifically captured by the nucleic acid aptamer, and retained on the surface of the enrichment medium, and the target analyte can be adsorbed from the sample as much as possible, so as to achieve the purpose of efficiently separating the target analyte from other impurities in the sample, achieve the enrichment effect of the target analyte, and obtain a sample solution containing a high concentration of the target analyte after elution.

[0010] It is understandable that the method provided by the present invention can be applied to any target to be detected. It only needs to screen a suitable nucleic acid aptamer for the target to be detected and fix it on an enrichment medium, so that it can be used to enrich and detect the target to be detected.

[0011] Furthermore, the enrichment medium comprises a thin layer plate, and the thin layer plate comprises a first end and a second end; the thin layer plate is placed with one end tilted downward, and the downward end can automatically switch between the first end and the second end.

[0012] In some embodiments, the thin layer plate is a thin layer plate used in thin layer chromatography, which is made of polyester film and coated with a uniform layer of adsorbent, and the adsorbent is a nucleic acid aptamer capable of adsorbing the target analyte. For example, when the target analyte is bean lectin, since its sample liquid is very viscous, it is preferred to use a thin layer plate, which is more conducive to the adsorption of bean lectin protein.

[0013] In some methods, the thin layer plate is fixed with a plastic material such as silicone resin, so that the thin layer plate is fixed in the detection device, and the left and right ends of the thin layer plate can be moved up and down by a motor to change the tilt angle, and the tilt angle is 20-30 degrees. This range of tilt angles is more conducive to the enrichment and elution of legume lectins. The thin layer plate can be reused and can also be replaced and updated.

[0014] Furthermore, a waste liquid bin is provided below the first end of the thin layer plate, and when the first end is facing downward, the waste liquid after adsorption is collected through the waste liquid bin; a collecting bin is provided below the second end of the thin layer plate, and when the second end is facing downward, the sample liquid to be tested is collected through the collecting bin; a waste liquid bin one-way valve is provided at the entrance of the waste liquid bin, and a collecting bin one-way valve is provided at the entrance of the collecting bin.

[0015] The one-way valve can allow liquid to flow into the collection chamber and the waste liquid chamber in one direction, while prohibiting the liquid from leaving to avoid contamination of the sample.

[0016] In some embodiments, the waste liquid bin is used to collect the waste liquid after the crude extract is filtered through the thin layer plate, and is located at the lower left of the thin layer plate. After the process is completed, the waste liquid bin can be drawn out and the waste liquid can be poured out. The collection bin is connected to the detection module, and the collected sample liquid to be tested is sent to the detection module for detection.

[0017] Furthermore, the pre-treatment module also includes a sample bin and an eluent bin, the eluent bin elutes the sample to be tested from the thin layer plate by releasing eluent to obtain the sample liquid to be tested; a sample bin valve is provided below the sample bin, and an eluent bin valve is provided below the eluent bin; the sample bin valve and the waste liquid bin one-way valve are opened at the same time; the eluent bin valve and the collection bin one-way valve are opened at the same time.

[0018] The sample chamber and the eluent chamber are both located above the detection device and are troughs that can hold liquids. They are located in two places, for example, the sample chamber is located at one end and the eluent chamber is located at the other end.

[0019] The sample chamber can be filled with a crude extract of a sample to be tested, such as a crude extract liquid sample obtained by preliminary pretreatment of the sample to be tested. The eluent chamber can be pre-stored with an eluent for eluting the target analyte from the thin layer plate.

[0020] In some embodiments, the method for obtaining a crude sample extract is as follows: grinding and crushing the sample and then sieving it, defatting it twice with petroleum ether and then air-drying it, extracting it three times with ice-cold brine in a low-temperature environment, mixing the extracts and adding ammonium sulfate and ammonia water to the supernatant in turn and letting it stand, and collecting the precipitate after centrifugation to obtain a crude sample solution.

[0021] In some methods, the sample chamber and the eluent chamber are made of opaque materials and are used to store crude sample extracts and quantitative eluents to prevent the surfactant components from being decomposed by light. At the same time, valves are provided under the sample chamber and the eluent chamber, respectively, and the flow of the sample liquid and the eluent is controlled by a control device to complete the adsorption and elution of the target analyte on the thin layer plate, respectively, to obtain the sample liquid to be tested.

[0022] The valve and the one-way valve are used to control the flow direction of the liquid after filtration or elution. In the initial state, the sample chamber valve and the waste liquid chamber one-way valve are opened at the same time, and the liquid flows into the waste liquid chamber after being enriched by the thin layer plate; in the start-up state, the elution chamber valve and the collection chamber one-way valve are opened at the same time, and the eluted liquid flows into the collection chamber.

[0023] The collection chamber is used to collect the eluted sample liquid to be tested, and is located at the lower right of the thin layer plate, parallel to the waste liquid chamber, and the connection between the sample liquid to be tested and the detection module is achieved through the detection port at the bottom.

[0024] Furthermore, the detection module includes electrochemical detection components, the number of which is one or more groups, each group of electrochemical detection components is used to detect a target analyte; each group of electrochemical detection components includes a working electrode and a probe, and the probe includes a second nucleic acid aptamer that captures the target analyte.

[0025] Furthermore, the detection module also includes a microfluidic channel and a test strip, wherein the microfluidic channel is used to divert the sample liquid to be tested; and the test strip is a multiple detection test strip coated with antibodies of the target object to be tested.

[0026] In some embodiments, the detection module includes a detection port, a camera, a detection chip, and an electrochemical socket.

[0027] The detection port is tightly connected to the collection chamber and the detection chip, and its diameter matches the sample addition port of the detection chip, so that the sample liquid to be tested is completely transferred into the chip to complete the detection process.

[0028] The detection chip includes a chip top plate, a sample adding port, a microfluidic channel, a test strip, an electrochemical detection component and a chip bottom plate. The test strip is a multiple detection test strip that can detect 5 different target objects to be tested at the same time. In addition, the detection chip also includes a chip top plate, a sample adding port, a test strip slot, an electrochemical detection slot, a screen-printed electrode and a chip bottom plate. Among them, the chip top plate includes a top plate and a detection window; the top plate is a hard transparent plastic plate for sealing the chip to prevent aerosol contamination; the detection window is a transparent plastic sheet, the size of which is the area containing the T line and C line of the test strip, which is used for camera scanning; the microfluidic channel is an F-shaped micron-level groove for diverting the sample liquid to be tested, and its straight end is connected to the sample adding port, and the bifurcated end is respectively connected to the corresponding test strip slot and the electrochemical detection slot. The test strip slot is a groove for placing multiple detection test strips, connected to the microfluidic channel, and the multiple detection test strips can be replaced through the slot after the detection is completed, so as to realize the multiple use of a single detection chip; the electrochemical detection slot is used to place the electrochemical detection component.

[0029] In some embodiments, the multiple detection test strip is used to complete the preliminary detection of the sample liquid to be tested. The multiple detection test strip is composed of a sample pad, a marking pad, a chromatography membrane, and a water-absorbing pad; the sample pad and the marking pad are mainly made of glass fiber material, non-woven fabric or filter paper; the water-absorbing pad is filter paper; the chromatography membrane is an NC nitrocellulose membrane pre-embedded with five detection lines (T lines) and one quality control line (C line); five kinds of target test artificial antigens are used as detection lines, and goat anti-mouse secondary antibodies are used as quality control lines; the upper end of the chromatography membrane is attached to the sample pad and the marking pad, and the lower end is attached to the water-absorbing pad, and the various parts are connected to complete the connection.

[0030] In some embodiments, the C-line and the T-line are 30 mm apart, each T-line is 10 mm apart, and the width of the C-line and the T-line is 5 mm.

[0031] The camera is used to scan the color changes of the test line (T line) and the quality control line (C line) on the test strip in the test window, and transmit the color value back to the mobile terminal through Bluetooth or wireless network for data processing and result analysis, so as to complete the qualitative and semi-quantitative judgment of the sample liquid to be tested and realize preliminary detection. A color value detection threshold is set for the five target analytes. If the color value of a certain target analyte in the sample liquid to be tested exceeds the detection threshold, an electrochemical quantitative detection of the target analyte is performed for accurate analysis. The camera is located below the motor and above the chip detection window.

[0032] The electrochemical detection tank is provided with a solenoid valve and a groove for placing screen-printed electrodes to complete quantitative detection. The solenoid valve is used to control the flow of the sample liquid to be tested. The groove is five parallel grooves connected to the microchannel, and the solenoid valve controls the liquid to enter to complete the quantitative detection of the sample liquid to be tested.

[0033] The screen-printed electrode provides a portable, high-precision three-electrode system, which can complete the quantitative detection of the target analyte by plugging and unplugging the electrochemical socket, and is composed of a working electrode, a counter electrode, a reference electrode and a probe.

[0034] The working electrode is a working electrode with graphene having special electrical properties coated on the surface by deposition, coating, etc., and the substrate material can be glass fiber material, non-woven fabric or filter paper. By detecting the change in the electrical properties of the working electrode, the non-quantifiable biological reaction is converted into a quantifiable electrical signal.

[0035] The counter electrode forms a loop with the working electrode through the solution, providing a channel for electron transfer during electrochemical detection. The substrate material is the same as that of the working electrode.

[0036] The reference electrode is an Ag / AgCl reference electrode, which forms a loop with the working electrode through the solution to provide calibration for the electrode potential and improve the accuracy of electrochemical detection.

[0037] The probe is a nucleic acid aptamer, which captures the target object to be detected on the surface of the working electrode, causing the electrical properties of the working electrode to change.

[0038] The chip base plate includes a base plate and an electrode interface. The base plate is a PVC base plate that supports the chip, and each part is assembled on the base plate. The electrode interface is located in the base plate area below the screen-printed electrode, and there are 15 electrode interfaces (each target object to be tested is a set of three-electrode system) for connecting the electrochemical socket. The electrochemical socket completes quantitative detection through the electrode interface.

[0039] Furthermore, the target analyte is a legume lectin, including any one or more of soybean lectin, concanavalin A agglutinin, adzuki bean lectin, phaseolus vulgaris lectin, and red bean lectin.

[0040] Furthermore, the nucleic acid aptamer fixed on the thin layer plate is a first nucleic acid aptamer, which includes a first nucleic acid aptamer that binds to any one or more of soybean lectin, jack bean agglutinin, adzuki bean agglutinin, phaseolus vulgaris lectin, and red bean agglutinin; the first nucleic acid aptamers that bind to soybean lectin, jack bean agglutinin, adzuki bean agglutinin, phaseolus vulgaris lectin, and red bean agglutinin respectively have nucleotide sequences shown in sequence table Seq ID NO.1 to 5; the first nucleic acid aptamer also has a (TTTTTTTTTT)-(CCCCCCCCCCCCCCCC)-sequence at the 5' end.

[0041] The first nucleic acid aptamer and the second nucleic acid aptamer described in the present invention are both nucleic acid aptamers that can bind to the target substance with high specificity and selectivity, and are named separately only to distinguish the two nucleic acid aptamers. Since the two nucleic acid aptamers are used in different environments, the required nucleic acid aptamer is also screened out according to the environmental characteristics to obtain a more suitable sequence.

[0042] The nucleic acid aptamers of five kinds of legume lectins are fixed on the thin layer plate in advance, and after recognizing and binding with the corresponding lectins, they are adsorbed on the thin layer plate to achieve effective separation from other substances. This structure can achieve the enrichment of lectins by specifically capturing the lectins through the nucleic acid aptamers and retaining them on the surface of the thin layer plate. The final beneficial result is that the solvent passes through the thin layer plate while retaining the lectins, and a high-concentration lectin sample solution is obtained after elution.

[0043] Among them, the sequence of the nucleic acid aptamer is different from the previously reported literature. First, a repeated T sequence is added to use the hydroxyl and other functional groups of thymine to achieve chemical adsorption with the surface of the thin layer plate. Then a repeated C sequence is used to create a distance between the nucleic acid aptamer sequence and the thin layer plate to avoid the thin layer plate and the nucleic acid aptamer sequence being too close to each other, resulting in reduced binding efficiency. Finally, the sequence of the nucleic acid aptamer was also modified for individual bases. Experiments have confirmed that the modified aptamer sequence has better binding efficiency with lectins on the thin layer plate than the free state.

[0044] The first nucleic acid aptamer sequence of the soybean lectin: 5'(TTTTTTTTTT)-(CCCCCCCCCCCCCCC)-GGTTGTGGAGGTTCTGGTTGTGGAGGTTC TGGTTGTGGAGGTTCT-3'(Seq ID NO.1); the first nucleic acid aptamer sequence of the concanavalin A lectin: 5'(TTTTTTTTTT)-(CCCCCCCCCCCCCCC)-GTTGGTTGTGGTTGTGGTTGTGGTTGTGG TTGTGGTTGTGGTTCT-3'(Seq ID NO.2); the first nucleic acid aptamer sequence of the adzuki bean lectin: 5'(TTTTTTTTTT)-(CCCCCCCCCCCCCCC)-GTTGGTTGTGGTTGTGGTTCTGGTTGTGCT TGTGGTTGTGGTTGT-3'(Seq ID NO.3); the first nucleic acid aptamer sequence of the Phaseolus vulgaris lectin: 5'(TTTTTTTTTT)-(CCCCCCCCCCCCCCCC)-GTTCGTAGTGGTTGTGGTTGTGGTTGTGGT TGTGGTTGTGGTTGT-3'(Seq ID NO.4); the first nucleic acid aptamer sequence of the red bean lectin: 5'(TTTTTTTTTT)-(CCCCCCCCCCCCCCC)-GTTGGTTGTCGTTGTGGTTGTGCTTGAGG TTGTGGTTGTGGTTGT-3'(Seq ID NO.5).

[0045] In a specific medium environment, it is necessary to select a suitable nucleic acid aptamer to truly improve the specific adsorption effect of the nucleic acid aptamer in the medium environment. Therefore, for the thin layer plate, a nucleic acid aptamer suitable for the thin layer plate must be selected. The present invention improves the nucleic acid aptamer sequences of five kinds of legume lectins in view of the adsorption effect of the thin layer plate, so that it can not only ensure the binding effect on the surface of the thin layer plate, but also improve the ability to specifically adsorb specific legume lectins, and can effectively improve the enrichment effect of the thin layer plate, thereby improving the detection sensitivity of the five kinds of legume lectins.

[0046] Furthermore, the eluent includes ethylene glycol monomethyl ether, sodium dihydrogen phosphate dihydrate, NaCl and Tris buffer containing Tween 20.

[0047] In some embodiments, the eluent is a Tris buffer added with ethylene glycol monomethyl ether, sodium dihydrogen phosphate dihydrate, 1% NaCl, and 2% Tween20, and is prepared with ultrapure water. Ethylene glycol monomethyl ether, sodium dihydrogen phosphate dihydrate, and ultrapure water are used to elute the legume lectin adsorbed on the thin layer plate; 1% NaCl and 2% Tween20 are used to promote the running of the sample solution to be tested on the detection chip, and this ratio helps to control the elution speed.

[0048] The elution solution can significantly improve the effect of eluting legume lectin from the thin layer plate, destroy the connecting hydrogen bond between the legume lectin and the nucleic acid aptamer fixed in the thin layer plate, but will not destroy the chemical bond connecting the nucleic acid aptamer and the thin layer plate, and will not elute the nucleic acid aptamer from the thin layer plate. After the elution is completed, the thin layer plate can be reused.

[0049] Furthermore, the second nucleic acid aptamer includes a second nucleic acid aptamer that binds to any one or more of soybean lectin, jack bean agglutinin, adzuki bean agglutinin, phaseolus vulgaris agglutinin, and red bean agglutinin; the second nucleic acid aptamer that binds to soybean lectin, jack bean agglutinin, adzuki bean agglutinin, phaseolus vulgaris agglutinin, and red bean agglutinin respectively has the nucleotide sequence shown in the sequence table Seq ID NO.6~10.

[0050] The second nucleic acid aptamer sequence of the soybean lectin: GGAGGTTCTGGTTGTGGAGGTTCTGGTTGTGGAGGTTCTGGTTGT (Seq ID NO.6); the second nucleic acid aptamer sequence of the concanavalin A lectin: CGAGTA ACGCTGTCTCTTCCGAATCGGGGGAAGGCGGAGGG (Seq ID NO.7); the second nucleic acid aptamer sequence of the adzuki bean lectin: GTTGGTTGTGCTTGTGGTTGTGGTTGTGGTAGTGGTTGTGGT TGT (Seq ID NO.8); the second nucleic acid aptamer sequence of the Phaseolus vulgaris lectin: TGGATAATGCGCTGACAC TGTCGCCTCCGATCCCAG (Seq ID NO.9); the second nucleic acid aptamer sequence of the red bean lectin: GTT GGTTGTGGTTCTGGTTGTGGTAGTGGTTCTGGTTGTCGTTGT (SeqID NO.10).

[0051] The second nucleic acid aptamer in the electrochemical detection component is easily affected by the background of gold material on the affinity and specificity of the nucleic acid aptamer, and a more suitable nucleic acid aptamer needs to be selected to improve the effect of specific binding, thereby improving the detection sensitivity. The present invention optimizes the sequence of the second nucleic acid aptamer used to detect five kinds of bean lectins respectively, thereby improving the accuracy and sensitivity of electrochemical detection.

[0052] Furthermore, the multiple detection test strips are provided with detection lines of red bean agglutinin, concanavalin A agglutinin, Phaseolus vulgaris agglutinin, soybean agglutinin and adzuki bean agglutinin in sequence.

[0053] Research has shown that the five test lines on the test strip are arranged in a specific order. After the sample enters the test strip, they are arranged from front to back in order of red bean agglutinin antigen, jack bean agglutinin antigen, phaseolus vulgaris agglutinin antigen, soybean agglutinin antigen, and adzuki bean agglutinin antigen. This can significantly reduce the mutual interference between the five legume lectins and improve the accuracy of detection.

[0054] In some embodiments, the detection device further includes a control module, and the control module includes a power supply device, a motor device, a control device, and a display device.

[0055] The power supply device is used to supply power, and when it is used in a fixed manner, a power plug with a ground wire is used, and when it is used in a mobile manner, a dry cell or a storage battery is used. The motor device is used to provide power, and the left and right ends of the thin layer plate are moved up and down by a stepper motor.

[0056] The control device controls the electric components or mechanical components in the sample processing module, the filtering module, and the detection module through the motor control device, the connecting rod, and the valve.

[0057] In some embodiments, the control device realizes linkage control of the eluent tank, sample loading tank, waste liquid tank and collection tank of the sample processing module through a connecting rod, so that the valves of the eluent tank and the collection tank or the valves of the sample loading tank and the waste liquid tank are in an open state or a closed state at the same time; and the flow state of the eluent or the bean vegetable lectin sample liquid is controlled by the valve.

[0058] The display device is used for operators to issue instructions and obtain execution results, including elution procedures, qualitative detection procedures, and quantitative detection procedures. The working status of each part is indicated by the color of the indicator light, indicating power on, standby, working, etc.

[0059] In another aspect, the present invention provides a method for detecting legume lectins, wherein the method uses the above-mentioned detection device for detection, and comprises the following steps:

[0060] (1) crushing, defatting and extracting the sample to be tested, and collecting the crude sample;

[0061] (2) adjusting the detection device to an initial state, wherein the second end of the thin layer plate is higher than the first end;

[0062] (3) Adding the crude sample into the sample chamber;

[0063] (4) Open the sample chamber and waste liquid chamber, and the analyte in the crude sample is adsorbed by the thin layer plate;

[0064] (5) adjusting the first end of the thin layer plate to be higher than the second end and opening the collection chamber;

[0065] (6) opening the eluent tank, allowing the eluent to elute the sample from the thin layer plate, and collecting the sample liquid in the collection tank;

[0066] (7) The sample liquid to be tested flows into the detection module for detection.

[0067] On the other hand, the present invention provides a use of an eluent for preparing a reagent for improving the elution rate of a legume lectin in a thin layer plate, wherein a nucleic acid aptamer is fixed in the thin layer plate, and the legume lectin is adsorbed by the thin layer plate through the nucleic acid aptamer; the eluent comprises ethylene glycol monomethyl ether, sodium dihydrogen phosphate dihydrate, NaCl and a Tris buffer containing Tween 20; the legume lectin comprises any one or more of soybean lectin, concanavalin A, adzuki bean lectin, phaseolus vulgaris lectin and red bean lectin.

[0068] Furthermore, the eluent is: 3% ethylene glycol monomethyl ether, 3% sodium dihydrogen phosphate dihydrate, 1% NaCl, 2% Tween20 Tris buffer, prepared with ultrapure water.

[0069] On the other hand, the present invention provides a method for adsorbing legume lectins based on a thin layer plate, wherein a nucleic acid aptamer of the legume lectin is fixed on a thin layer plate and then used to adsorb the legume lectin in a sample to be tested, wherein the legume lectin includes any one or more of soybean lectin, jack bean agglutinin, adzuki bean agglutinin, phaseolus vulgaris agglutinin, and red bean agglutinin; and the nucleic acid aptamer includes a first nucleic acid aptamer that binds to any one or more of soybean lectin, jack bean agglutinin, adzuki bean agglutinin, phaseolus vulgaris agglutinin, and red bean agglutinin.

[0070] On the other hand, the present invention provides a use of a nucleic acid aptamer for preparing a reagent for improving the adsorption effect of a thin layer plate on a filter element, wherein the legume lectin includes any one or more of soybean lectin, concanavalin A, adzuki bean lectin, phaseolus vulgaris lectin, and red bean lectin; and the nucleic acid aptamer has a nucleotide sequence as shown in any one or more of Seq ID NO.1 to 5 in the sequence table.

[0071] The present invention has the following beneficial effects:

[0072] 1. By fixing specific nucleic acid aptamers on the thin layer plate, the function of specific adsorption of multiple target analytes is achieved, ensuring that the target analytes in the liquid sample can be fully extracted and the reliability of subsequent detection is improved;

[0073] 2. It can simultaneously detect five kinds of legume lectins in legume vegetables, including soybean lectin, sword bean agglutinin, adzuki bean agglutinin, phaseolus vulgaris agglutinin and red bean agglutinin;

[0074] 3. A -(TTTTTTTTTT)-(CCCCCCCCCCCCCCC)- sequence is added to the 5' end of the five nucleic acid aptamers. The sequence does not recognize any target analyte and does not generate a self-folding secondary structure;

[0075] -(TTTTTTTTTT)-The nucleic acid aptamer is physically adsorbed and fixed in the thin layer plate, and can be eluted by the elution solution;

[0076] -(CCCCCCCCCCCCCCCC)- creates a distance from the filter element surface to avoid the effective sequence being destroyed;

[0077] 4. The sequence of the nucleic acid aptamer fixed on the thin layer plate was optimized to enable it to more efficiently and specifically adsorb and enrich the five legume lectins in the sample solution;

[0078] 5. The most suitable elution solution formula was screened, which can significantly improve the effect of eluting the target to be detected from the thin layer plate, destroy the hydrogen bond between the target to be detected and the nucleic acid aptamer, but will not destroy the chemical bond between the nucleic acid aptamer and the thin layer plate, and will not elute the nucleic acid aptamer from the thin layer plate. After elution, the thin layer plate can be reused;

[0079] 6. The aptamer sequence for electrochemical detection of bean lectin was optimized to improve the accuracy and sensitivity of detection;

[0080] 7. Multi-channel detection chip, using the same sample solution to detect five kinds of bean lectins at the same time, shortening the detection time, saving test samples, and improving the rigor of the results;

[0081] 8. By combining test strips and electrochemical technology, the target object is first tested qualitatively and semi-quantitatively, and then quantitatively tested according to the test results to avoid blindness of the test;

[0082] 9. The structure is simple, the detection is convenient and efficient, and the accuracy of the test results can be guaranteed. BRIEF DESCRIPTION OF THE DRAWINGS

[0083] Figure 1 This is a schematic diagram of the appearance of the testing equipment;

[0084] Figure 2 is a cross-sectional view of the testing equipment;

[0085] Figure 3 It is a top view of the testing equipment;

[0086] Figure 4 This is a schematic diagram of the process of using the detection equipment;

[0087] Figure 5 Schematic diagram of the process of nucleic acid aptamer intercepting legume lectin in thin layer plate;

[0088] Figure 6 This is a schematic diagram of the detection chip structure;

[0089] Figure 7 It is a schematic diagram of the structure of a multiplex test strip;

[0090] Figure 8 Schematic diagram of the structure of electrochemical detection components. DETAILED DESCRIPTION

[0091] The preferred embodiments of the present invention are further described in detail below in conjunction with the accompanying drawings. It should be noted that the embodiments described below are intended to facilitate the understanding of the present invention and do not have any limiting effect on it. The raw materials and equipment used in the specific embodiments of the present invention are all known products and are obtained by purchasing commercially available products.

[0092] In the description of the present invention, it should be understood that the terms "upper", "lower", "front", "back", "left", "right", "vertical", "horizontal", "top", "bottom", "inside", "outside" and the like indicate positions or positional relationships based on the positions or positional relationships shown in the accompanying drawings, and are only for the convenience of describing the present invention and simplifying the description, rather than indicating or implying that the device or element referred to must have a specific orientation, be constructed and operated in a specific orientation, and therefore cannot be understood as limiting the present invention. In addition, the terms "first", "second", etc. are only used for descriptive purposes, and cannot be understood as indicating or implying relative importance or implicitly indicating the number of technical features indicated. Thus, features defined as "first", "second", etc. may explicitly or implicitly include one or more of the features. In the description of the present invention, unless otherwise specified, "multiple" means two or more.

[0093] In the description of the present invention, it should be noted that, unless otherwise clearly specified and limited, the terms "connected" and "connection" should be understood in a broad sense, for example, it can be a fixed connection, a detachable connection, or an integral connection; it can be a mechanical connection or an electrical connection; it can be a direct connection, or it can be indirectly connected through an intermediate medium, or it can be the internal communication of two components. For ordinary technicians in this field, the specific meanings of the above terms in the present invention can be understood by specific circumstances.

[0094] Embodiment 1, the detection device provided by the present invention

[0095] The detection device 1 provided in this embodiment is as follows Figure 1 to Figure 3 As shown, Figure 1 This is a schematic diagram of the appearance of the testing equipment. Figure 2 This is a cross-sectional view of the testing equipment. Figure 3 It is a top view of the detection device. The detection device 1 includes a pre-treatment module 2 and a detection module 3. The pre-treatment module 2 includes an enrichment medium 4. The enrichment medium 4 is fixed with a nucleic acid aptamer 5 capable of adsorbing the target analyte, which is used to enrich the target analyte and obtain the sample liquid to be tested; the detection module 3 is used to detect the target analyte in the sample liquid to be tested. The enrichment medium 4 refers to a solid phase medium that can intercept, adsorb or capture the target analyte from the sample, including a thin layer plate, a filter plate, a resin, and the like. For liquid samples with good fluidity, any material of a thin layer plate, a filter plate, and a resin can be selected as the enrichment medium; for samples with a relatively viscous and poor fluidity, a thin layer plate is preferably used as the enrichment medium, which can more efficiently attach the target analyte. In this embodiment, the enrichment medium 4 preferably adopts a thin layer plate 6.

[0096] like Figure 4 , the thin layer plate 6 includes a first end 7 and a second end 8; the thin layer plate 6 is placed with one end tilted downward, and the downward end can automatically switch between the first end 7 and the second end 8. The thin layer plate 6 is a thin layer plate used in thin layer chromatography, which is made of a polyester film evenly coated on a 2mm thick acrylic plate, and is coated with a nucleic acid aptamer that can adsorb the target analyte. The target analytes in this embodiment are 5 kinds of bean lectins, and the thin layer plate 6 is more conducive to the adsorption of bean lectin protein. However, it can be understood that the detection device 1 provided in this embodiment can be applied to any target to be detected. It only needs to screen a suitable nucleic acid aptamer for the target to be detected and fix it on the enrichment medium 4, so that it can be used to enrich and detect the target to be detected. The thin layer plate 6 is fixed with a plastic material such as silicone resin, so that the thin layer plate 6 is fixed in the detection device 1, and the left and right ends of the thin layer plate 6 can be moved up and down by a motor to change the tilt angle, and the tilt angle is 20-30 degrees. This range of tilt angles is more conducive to the enrichment and elution of bean lectins. The thin layer plate 6 can be reused and can also be replaced and updated. A waste liquid bin 9 is provided below the first end 7 of the thin layer plate 6. When the first end 7 is facing downward, the waste liquid after adsorption is collected through the waste liquid bin 9; a collecting bin 10 is provided below the second end 8 of the thin layer plate 6. When the second end 8 is facing downward, the sample liquid to be tested is collected through the collecting bin 10; a waste liquid bin check valve 11 is provided at the entrance of the waste liquid bin 9, and a collecting bin check valve 12 is provided at the entrance of the collecting bin 10. The check valve allows liquid to flow into the collecting bin 10 and the waste liquid bin 9 in one direction, while prohibiting the liquid from leaving to avoid contaminating the sample. The waste liquid bin 9 is used to collect the waste liquid after the crude extract is filtered through the thin layer plate. It is located at the lower left of the thin layer plate 6. After the process is completed, the waste liquid bin 9 can be drawn out and the waste liquid can be poured out. The collecting bin 10 is connected to the detection module 3, and the collected sample liquid to be tested is sent to the detection module 3 for detection.

[0097] The pre-treatment module 2 also includes a sample bin 13 and an eluent bin 14. The eluent bin 14 releases the eluent to elute the sample to be tested from the thin layer plate 6 to obtain the sample liquid to be tested; a sample bin valve 15 is provided below the sample bin 13, and an eluent bin valve 16 is provided below the eluent bin 14; the sample bin valve 15 and the waste liquid bin check valve 11 are opened at the same time; the eluent bin valve 16 and the collection bin check valve 12 are opened at the same time. The sample bin 13 and the eluent bin 14 are both located above the detection device 1, and are troughs that can hold liquids, and are located in two places, such as the sample bin 13 is located at one end, and the eluent bin 14 is located at the other end. The sample bin 13 can be added with a crude extract of the sample to be tested, such as a crude liquid sample liquid obtained by preliminary pretreatment of the sample to be tested. The eluent eluted from the thin layer plate 6 can be pre-stored in the eluent bin 13. The sample crude extract can select a suitable crude extraction method according to different samples. In this embodiment, for bean vegetables, the method for obtaining the crude sample extract can be: grind and crush the bean vegetables and then sieve them, defat them twice with petroleum ether and then air-dry them, extract them three times with ice-cold brine in a low-temperature environment, mix the extracts, take the supernatant and add ammonium sulfate and ammonia water in turn, let it stand, centrifuge and collect the precipitate to obtain the crude sample solution.

[0098] Preferably, the sample bin 13 and the eluent bin 14 are made of opaque materials, which are used to store the crude sample extract and the quantitative eluent to prevent the surfactant components from being decomposed by light. At the same time, valves are respectively provided below the sample bin 13 and the eluent bin 14, and the flow of the sample liquid and the eluent is controlled by the control device, which are respectively used to complete the adsorption and elution of the target analyte on the thin layer plate 6 to obtain the sample liquid to be tested. The valve and the one-way valve are used to control the flow direction of the liquid after filtration or elution. In the initial state, the sample bin valve 15 and the waste liquid bin one-way valve 11 are opened at the same time, and the liquid flows into the waste liquid bin 9 after being enriched by the thin layer plate; in the start-up state, the eluent bin valve 16 and the collection bin one-way valve 12 are opened at the same time, and the eluted liquid flows into the collection bin 10. The collection bin 10 is used to collect the sample liquid to be tested after elution, and is located at the lower right of the thin layer plate 6, parallel to the waste liquid bin 9, and the connection between the sample liquid to be tested and the detection module 3 is realized through the detection port 17 at the bottom.

[0099] like Figure 6 to Figure 8, the detection module 3 includes an electrochemical detection component 18, the number of the electrochemical detection components 18 is one or more groups (five groups in this example), each group of electrochemical detection components 18 is used to detect a target analyte; each group of electrochemical detection components 18 includes a working electrode 19 and a probe, and the probe includes a second nucleic acid aptamer that captures the target analyte. The detection module 3 also includes a microfluidic channel 22 and a test strip 23, the microfluidic channel 22 is used to divert the sample liquid to be tested; the test strip 23 is a multiple detection test strip, which is coated with antibodies of the target analyte. Preferably, the detection module 3 is provided with a detection port 17, a camera 24, a detection chip 25, and an electrochemical socket 26. The detection port 17 is tightly connected to the collection bin 10 and the detection chip 25, and the diameter size is consistent with the sample addition port 27 of the detection chip 25, so that the sample liquid to be tested is completely transferred to the detection chip 25 to complete the detection process.

[0100] like Figure 6 , the detection chip 25 includes a chip top plate 28, a sample injection port 27, a microfluidic channel 22, a test strip 23, an electrochemical detection component 18 and a chip bottom plate 29. The test strip 23 is a multiple detection test strip that can detect 5 different target test objects at the same time. In addition, the detection chip 25 also includes a test strip slot 30, an electrochemical detection slot 31, and a screen-printed electrode 32. Among them, the chip top plate 28 includes a top plate 33 and a detection window 34; the top plate 33 is a hard transparent plastic plate, which is used to seal the detection chip 25 to prevent aerosol contamination; the detection window 34 is a transparent plastic sheet, the size of which is the area containing the test strip T line 35 and C line 36, which is used for camera 24 scanning; the microfluidic channel 22 is an F-shaped micron-level groove, which is used to divert the sample liquid to be tested, and its straight end is connected to the sample injection port 27, and the bifurcated end is respectively connected to the corresponding test strip slot 30 and electrochemical detection slot 31. The test strip slot 30 is a groove for placing the test strip 23, connected to the microfluidic channel 22. After the test is completed, the test strip 23 can be replaced through the slot to realize the multiple use of a single test chip 25; the electrochemical detection slot 31 is used to place the electrochemical detection component 18. The test strip 23 is used to complete the preliminary detection of the sample liquid to be tested. The test strip 23 is composed of a sample pad 37, a marking pad 38, a chromatographic membrane 39, and a water-absorbing pad 40; the materials of the sample pad 37 and the marking pad 38 are mainly selected from glass fiber materials, non-woven fabrics or filter paper; the water-absorbing pad 40 is filter paper; the chromatographic membrane 39 is an NC nitrocellulose membrane pre-embedded with five test lines (T lines) 35 and a quality control line (C line) 36; five kinds of target test objects artificial antigens are used as test lines 35, and goat anti-mouse secondary antibodies are used as quality control lines 36; the upper end of the chromatographic membrane is attached to the sample pad 37 and the marking pad 38, and the lower end is attached to the water-absorbing pad 40, and each part is connected to complete the connection. Preferably, the C line 36 and the T line 35 are spaced 30 mm apart, each T line 35 is spaced 10 mm apart, and the width of the C line 36 and the T line 35 is 5 mm.

[0101] The camera 24 is used to scan the color changes of the test line (T line) 35 and the quality control line (C line) 36 on the test strip 23 in the detection window 34, and transmit the color value back to the mobile terminal through Bluetooth or wireless network for data processing and result analysis, so as to complete the qualitative and semi-quantitative judgment of the sample liquid to be tested and realize preliminary detection. A color value detection threshold is set for the five target analytes. If the color value of a certain target analyte in the sample liquid to be tested exceeds the detection threshold, an electrochemical quantitative detection of the target analyte is performed for accurate analysis. The camera 24 is located below the motor and above the chip detection window 34.

[0102] Electromagnetic valve 41 and groove 42 are provided in electrochemical detection tank 31 for placing screen-printed electrode 32 to complete quantitative detection. Electromagnetic valve 41 is used to control the flow of sample liquid to be tested. Groove 42 is five parallel grooves connected to microchannel 22, and liquid is controlled by electromagnetic valve 41 to complete quantitative detection of sample liquid to be tested. Screen-printed electrode 32 provides a portable, high-precision three-electrode system, which can complete quantitative detection of target analyte by plugging and unplugging electrochemical socket 43, and is composed of working electrode 19, counter electrode 44, reference electrode 45 and probe. Working electrode 19 is a working electrode on which graphene with special electrical properties is coated on the surface by deposition, coating, etc., and the substrate material can be selected from glass fiber material, non-woven fabric or filter paper. By detecting the change of electrical properties of working electrode 19, non-quantifiable biological reaction is converted into quantifiable electrical signal. Counter electrode 44 forms a loop with working electrode 19 through solution, providing a channel for electron transfer in electrochemical detection process, and the substrate material is the same as working electrode 19. The reference electrode 45 is an Ag / AgCl reference electrode, which forms a circuit with the working electrode 19 through the solution to calibrate the electrode potential and improve the accuracy of electrochemical detection. The probe is a nucleic acid aptamer, which captures the target analyte on the surface of the working electrode 19, causing the electrical properties of the working electrode 19 to change.

[0103] The chip base plate 29 includes a base plate 46 and an electrode interface 47. The base plate 46 is a PVC base plate that supports the chip, and each part is assembled on the base plate 46. The electrode interface 47 is located in the base plate 46 area below the screen-printed electrode 32. There are 15 electrode interfaces 47 for connecting the electrochemical socket 26. The electrochemical socket 26 completes quantitative detection through the electrode interface 47.

[0104] The target in this example is (CCCCCCCCCC)-GTTGGTTGTGGTTGTGGTTGTGGTTGTGGTTGTGGTTGTGGTTCT-3' (Seq ID NO.2); the first nucleic acid aptamer sequence of the adzuki bean lectin is: 5'(TTTTTTTTTT)-(CCCCCCCCCCCCCCC)-GTTGGTTGTGGTTGTGGTTCTGGTTGTGCTTGTGGTTGTGGTTGT-3' (Seq ID NO.3); the first nucleic acid aptamer sequence of the phaseolus vulgaris lectin is: 5'(TTTTTTTTTT)-(CCCCCCCCCCCCCCC)-GTTCGTAGTGGTTGTGGTTGTGGTTGTGGTTGTGGTTGTGGTTGTGGTTGT-3' (Seq ID NO.4); the first nucleic acid aptamer sequence of the adzuki bean lectin is: 5'(TTTTTTTTTT)-(CCCCCCCCCCCCCCC)-GTTGGTTGTCGTTGTGGTTGTGCTTGAGGTTGTGGTTGTGGTTGT-3' (Seq ID NO.5).

[0105] like Figure 5 , nucleic acid aptamers 5 of five kinds of legume lectins are fixed on the thin layer plate 6 in advance, and after recognizing and binding with the corresponding lectin 48, they are adsorbed on the thin layer plate 6 to achieve effective separation from other substances. This structure can achieve the enrichment of lectin by nucleic acid aptamer 5 specifically capturing lectin 48 and retaining it on the surface of thin layer plate 6. The final beneficial result is that the solvent passes through the thin layer plate 6 while retaining the lectin, and a high concentration of lectin sample solution is obtained after elution. The sequence of nucleic acid aptamer 5 is different from that of previously reported literature. First, a repeated T sequence is added to achieve chemical adsorption with the surface of thin layer plate 6 by using functional groups such as hydroxyl groups carried by thymine, followed by a repeated C sequence to create a distance between the nucleic acid aptamer sequence and the thin layer plate 6, so as to avoid the thin layer plate 6 and the nucleic acid aptamer sequence being too close to each other, resulting in a decrease in binding efficiency. Finally, the sequence of aptamer 5 was also modified by some bases, and the experiment confirmed that the modified aptamer sequence had better binding efficiency with lectin on thin layer plate 6 than the free state. For a specific medium environment, it is necessary to select a suitable aptamer to truly improve the specific adsorption effect of the aptamer in the medium environment. Therefore, for thin layer plate 6, a suitable aptamer for thin layer plate 6 must be selected. For the adsorption effect of thin layer plate 6, the aptamer sequences of five kinds of legume lectins were improved, so that they can not only ensure the binding effect on the surface of thin layer plate 6, but also improve the ability to specifically adsorb specific legume lectins, which can effectively improve the enrichment effect of thin layer plate 6, thereby improving the detection sensitivity of the five legume lectins.

[0106] The eluent in this embodiment is a Tris buffer solution of 3% ethylene glycol monomethyl ether, 3% sodium dihydrogen phosphate dihydrate, 1% NaCl, and 2% Tween20, prepared with ultrapure water. The functions of ethylene glycol monomethyl ether, sodium dihydrogen phosphate dihydrate, and ultrapure water are to elute the bean lectin adsorbed on the thin layer plate; the functions of 1% NaCl and 2% Tween20 are to promote the operation of the sample liquid to be tested on the detection chip. The eluent can significantly improve the effect of eluting the bean lectin from the thin layer plate 6, destroy the hydrogen bond between the bean lectin and the nucleic acid aptamer 5 fixed in the thin layer plate 6, but will not destroy the chemical bond connecting the nucleic acid aptamer 5 and the thin layer plate 6, and will not elute the nucleic acid aptamer 5 from the thin layer plate 6. After the elution is completed, the thin layer plate 6 can be reused.

[0107] The second nucleic acid aptamer 21 in this embodiment includes a second nucleic acid aptamer that binds to any one or more of soybean lectin, jack bean lectin, adzuki bean lectin, phaseolus vulgaris lectin, and red bean lectin; wherein the second nucleic acid aptamer sequence of soybean lectin is: GGAGGTTCTGGTTGTGGAGGTTCTGGTTGT GGAGGTTCTGGTTGT (Seq ID NO.6); the second nucleic acid aptamer sequence of jack bean lectin is: CGAGTAACGCTGTCTCTTCCGAATCGGG GGAAGGCGGAGGG (Seq ID NO.7); the second nucleic acid aptamer sequence of adzuki bean lectin is: GTTGG TTGTGCTTGTGGTTGTGGTTGTGGTAGTGGTTGTGGT TGT (Seq ID NO.8); the second nucleic acid aptamer sequence of phaseolus vulgaris lectin is: TGGATAATGCGCTGACACTGTCGCCTCCGATCCCAG (Seq ID NO.9); the second nucleic acid aptamer sequence of the red bean lectin is: GTTGGTTGTGGTTCTGGTTGTGGTA GTGGTTCTGGTTGTCGTTGT (Seq ID NO.10). The second nucleic acid aptamer in the electrochemical detection component 18, the background of the gold material is easy to affect the affinity and specificity of the nucleic acid aptamer, and it is necessary to select a more suitable nucleic acid aptamer to improve the effect of specific binding, thereby improving the detection sensitivity. Therefore, the sequences of the second nucleic acid aptamers used to detect the five bean lectins are optimized, thereby improving the accuracy and sensitivity of electrochemical detection.

[0108] Preferably, the test strip 23 is provided with a red bean agglutinin detection line 49, a jack bean agglutinin detection line 50, a phaseolus bean agglutinin detection line 51, a soybean agglutinin detection line 52, and an adzuki bean agglutinin detection line 53. The five test lines on the test strip 23 are arranged in a specific order. After the sample enters the test strip 23, they are arranged from front to back in order of red bean agglutinin antigen, jack bean agglutinin antigen, phaseolus bean agglutinin antigen, soybean agglutinin antigen, and adzuki bean agglutinin antigen, which can significantly reduce the mutual interference between the five legume lectins and improve the accuracy of detection.

[0109] In addition, the detection device 1 also includes a control module 54, which includes a power supply device 56, a motor device, a control device and a display device 55. The power supply device 56 is used for power supply, and a power plug with a ground wire is used when it is fixed, and a dry cell or storage battery is used when it is mobile. The motor device is used to provide power, and the left and right ends of the thin layer plate are moved up and down by a stepping motor. The control device controls the electric components or mechanical components in the sample processing module, the filtering module, and the detection module through the motor control device, the connecting rod, and the valve. The control device realizes the linkage control of the eluent tank, the sample loading tank, the waste liquid tank and the collection tank of the sample processing module through the connecting rod, so that the valves of the eluent tank and the collection tank or the valves of the sample loading tank and the waste liquid tank are in an open state or a closed state at the same time; the flow state of the eluent or the bean vegetable lectin sample liquid is controlled by the valve. The display device 55 is used for the operator to issue instructions and obtain execution results, including elution procedures, qualitative detection procedures, and quantitative detection procedures. The working status of each part is indicated by the color of the indicator light, such as power on, standby, working, etc.

[0110] Embodiment 2, detection method

[0111] This embodiment uses the detection device 1 provided in Example 1 to detect lectins in legume vegetables, which specifically includes the following steps:

[0112] 1) Sample pretreatment

[0113] 1. Turn on the switch of the power supply device in the control module 54 to power on the device, and wait for the indicator light of the display device 55 to light up to indicate that the detection device 1 has been turned on.

[0114] 2. Grind and crush a sample (e.g., 10 g of soybeans) and sieve it. Cover the powder with petroleum ether, defatted by filtering and centrifugation, defatted twice and air-dried, extracted three times with ice-cold saline (0.1-0.2 mol / L NaCl solution) at a low temperature (4°C), mixed the extracts, took all the supernatant, added 10 ml of 30% ammonium sulfate and 3 ml of 1 mol / L ammonia water in turn, and allowed to stand. After centrifugation, collect the precipitate to obtain about 1 g of a sticky lectin crude sample.

[0115] 3. The motors on both sides of the thin layer plate 6 start running so that the right end of the thin layer plate 6 is higher than the left end and tilted at 20 degrees. 1g of sticky lectin crude sample is added to the sample chamber 13, and then added to the thin layer plate 6 from the sample chamber 13. The valves of the sample chamber 13 and the waste liquid chamber 14 are opened, and the crude sample is enriched by the nucleic acid aptamer 5 on the thin layer plate 6 and then flows into the waste liquid chamber 9.

[0116] 4. Add the eluent into the eluent tank 14, and start the motors on the left and right sides of the thin layer plate 6 to make the left end of the thin layer plate 6 higher than the right end and tilt at a 20-degree angle. The valves of the eluent tank 14 and the collection tank 10 are opened, and the eluent flows through the thin layer plate 6, eluting the lectin attached to the nucleic acid aptamer, and flows into the collection tank 10 to obtain 2 ml of lectin detection sample liquid.

[0117] 2) Sample testing

[0118] 1. Qualitative testing

[0119] 1) Multiplex test strips 23 of five lectins to be tested are placed into the test strip slot 30 to complete the assembly of the test chip 25 , and the sample injection port 27 of the test chip 25 is fitted with the test port 17 at the bottom of the collection chamber 10 , and the chip bottom plate 29 is fitted with the electrochemical socket 43 .

[0120] 2) The 2 ml lectin detection sample liquid obtained in step 1) is stored in the collection chamber 10, and the "qualitative detection program" is started through the display device 55. The valve is opened, and the lectin sample liquid flows into the detection chip 25, and flows evenly to the test strip slot 30 and the electrochemical slot 31 through the microchannel 22, and 1 ml of the lectin sample liquid flows into the test strip 23.

[0121] 3) The camera 24 is powered on and turned on, and the scanning function is controlled by the mobile terminal. The color development time of the test strip 23 is 3-5 minutes. The camera 24 can directly observe whether the T line 35 and the C line 36 show color changes to complete the qualitative test. The simultaneous appearance of the T line 35 and the C line 36 indicates that the lectin to be tested is contained in the lectin sample solution; the appearance of only the C line 36 indicates that the lectin is not contained in the lectin sample solution; the absence of the C line 36 indicates that the test result of the test strip 23 is invalid. After the test results show the T line 35 and the C line 36, use the camera 24 to scan, and the scanned chromaticity value results are transmitted to the mobile terminal via Bluetooth or wireless network. The data is analyzed according to the chromaticity-concentration standard curve to complete the semi-quantitative test.

[0122] 2. Quantitative detection

[0123] 1) After completing the semi-quantitative detection, if the colorimetric value of a certain bean lectin exceeds the threshold range, the electrochemical quantitative detection of the bean lectin is performed.

[0124] 2) Start the "quantitative detection program" through the display device 55, open the electromagnetic valve 41 corresponding to the bean lectin, and 1 ml of the sample solution to be tested flows into the electrochemical detection tank 31 for electrochemical analysis to complete the quantitative detection of the sample solution to be tested.

[0125] Example 3: Effects of different enrichment methods on detection results

[0126] Different enrichment methods will directly affect the extraction and detection effect of lectins in legumes. In this embodiment, 10g of soybeans were detected using the detection equipment provided in Example 1. The thin layer plates were treated in the following three ways: 1. Untreated thin layer plates were directly used; 2. Thin layer plates with five lectin antibodies fixed (20cm 2 The surface of the thin layer plate is uniformly coated with 0.5% to 2% glutaraldehyde, first coated on the thin layer plate and left for 2 hours, and then coated with 1mL of a solution with a total antibody concentration of 0.5mol / L to complete the glutaraldehyde cross-linking fixation, and the concentration of each antibody in the antibody solution is 0.1mol / L) thin layer plate; 3. The first nucleic acid aptamer (20cm2) with five lectins fixed is used 2 The surface of the thin layer plate is uniformly coated with 1 ml of nucleic acid aptamer solution, and the concentration of each nucleic acid aptamer in the nucleic acid aptamer solution is 20 μmol / L). Then, the thin layer plate is tested by the test strip and electrochemical detection component of the detection module respectively. The detection method is as in Example 2, and the detection results are shown in Table 1.

[0127] Table 1. Effects of different enrichment methods on detection results

[0128]

[0129] According to Table 1, comparing groups 1 to 3, compared with the untreated thin layer plate, fixing the antibody of the target analyte or fixing the first nucleic acid aptamer of the target analyte on the thin layer plate can significantly improve the effect of extracting the target analyte from the sample.

[0130] At the same time, by comparing the second and third methods, it can be seen that compared with the method of fixing antibodies on the thin layer plate, the method of fixing nucleic acid aptamers on the thin layer plate has a better extraction effect and can detect more types and contents of lectins. The reason may be that nucleic acid aptamers are smaller in size and can form neatly arranged nucleic acid aptamer tentacles to capture the target analyte after being fixed on the thin layer plate; while antibody protein molecules are larger and more disorderly after being fixed. Because when antibodies are fixed on the surface of the thin layer plate in a random arrangement, different antibodies will have different orientations after cross-linking and fixation. When the effective binding sites on the antibody surface face downward, the capture efficiency of the thin layer plate is reduced. The fixation of nucleic acid aptamers is physically repaired by arranging fixed bases at one end to ensure its fixed direction, so that it has better binding efficiency with the target, and the capture effect is significantly better than that of antibodies.

[0131] Example 4: Sequence Improvement of the First Aptamer Immobilized on the Thin Layer Plate

[0132] 1. Add a specific sequence

[0133] In order to make the first nucleic acid aptamer more firmly fixed on the thin layer plate (the material of the thin layer plate is polyester), a specific sequence is added to the 5' end of the nucleic acid aptamer to improve the fixing effect of the first nucleic acid aptamer, and at the same time, it is necessary to ensure that its adsorption of the target analyte is not affected. The first nucleic acid aptamer sequences used are shown in Table 2. Since the change trends of nucleic acid aptamers of different bean lectins are consistent, the first nucleic acid aptamer sequence of concanavalin A lectin is used for research in this embodiment, and it is fixed on the thin layer plate as described in Example 1. The sample used contains a concanavalin A lectin solution with a concentration of 60 (μg / mL), and the sample is pre-treated, eluted and detected by the method provided in Example 2. After elution, the same sample is pre-treated, eluted and detected again, and the test results of the filter element being reused twice are investigated. The results are shown in Table 2.

[0134] Table 2. First nucleic acid aptamer adds specific sequence

[0135]

[0136] According to Table 2, when there is no additional sequence at the 5' end of the first nucleic acid aptamer, its fixation effect is poor, resulting in poor adsorption and extraction efficiency. Moreover, when the thin layer plate is reused for the second time, since the first nucleic acid aptamer has been completely eluted, only part of the concanavalin A agglutinin remaining on the thin layer plate can be detected.

[0137] It is most preferred to add a (TTTTTTTTTT)-(CCCCCCCCCCCCCCC)-sequence to the 5' end of the first nucleic acid aptamer, which has the highest detection accuracy and the thin layer plate can be reused; compared with adding a (TTTTTTTTTT)-sequence or a (TTTTTTTTTT)-(CCCCCCCC)-sequence to the 5' end of the first nucleic acid aptamer, the adsorption and extraction effect of concanavalin A agglutinin can be improved, thereby improving the detection accuracy. When a (AAAAAAAAAA)-(CCCCCCCCCCCCCCC)-sequence is added to the 5' end or a (TTTTTTTTTT)-(GGGGGGGGGGGGGGGGG)-sequence is present at the 5' end, although the first detection result is also relatively accurate, the detection accuracy decreases when it is used repeatedly for the second time. The reason may be that the fixation effect of part of the first nucleic acid aptamer is poor and it is eluted together with the elution solution, resulting in a decrease in the enrichment effect.

[0138] 2. Optimization of the first aptamer sequence

[0139] In this embodiment, the first nucleic acid aptamer sequences of five kinds of legume lectins are optimized respectively so that they can improve the specific adsorption and extraction effect of legume lectins. The first nucleic acid aptamer sequences of the five legume lectins before and after optimization are shown in Tables 3 and 4, respectively, and they are fixed on the thin layer plate as described in Example 1, and the sample used contains 30 (μg / mL) soybean lectin, 30 (μg / mL) canadensis lectin, 30 (μg / mL) red bean lectin, 30 (μg / mL) phaseolus lectin, and 30 (μg / mL) red bean lectin at the same time, and the sample is filtered, eluted and detected by the method provided in Example 2, and the electrochemical detection results are converted into specific concentrations by preparing a standard curve, and the detection results are examined. The results are shown in Table 3.

[0140] Table 3. Optimization of the first nucleic acid aptamer sequence

[0141]

[0142] According to Table 3, the first nucleic acid aptamer sequences of five kinds of legume lectins are optimized in this embodiment. The optimized first nucleic acid aptamer can improve the specific adsorption and extraction effects of the five kinds of legume lectins and significantly improve the accuracy of the detection results.

[0143] Example 5: Effects of different eluents on test results

[0144] Different eluents will also directly affect the elution effect of bean lectins in the thin layer plate, and will also affect the reuse effect of the thin layer plate. This embodiment is aimed at 10g of soybeans, and the detection equipment provided in Example 1 is used for detection. The eluents are respectively eluted using the five eluents in Table 4, and then the test strips and electrochemical detection layers of the detection module are used for detection. The detection results take soybean lectin as an example. The detection method is as in Example 2, and the detection results are shown in Table 4.

[0145] Table 4. Effects of different eluents on test results

[0146]

[0147] According to Table 4, the elution effects of different elution solutions are significantly different. The most preferred is the elution solution of Group 3, which has the highest elution efficiency for legume lectin in the thin layer plate, and the thin layer plate can be reused after elution. It can be seen that it can elute legume lectin from the first nucleic acid aptamer without destroying the chemical bond between the first nucleic acid aptamer and the thin layer plate.

[0148] However, if a strong eluent is used to directly elute the first nucleic acid aptamer from the thin layer plate, the thin layer plate cannot be reused. The eluent provided in this embodiment facilitates the reuse of the thin layer plate, especially the third group, and can also improve the accuracy of the detection results.

[0149] Example 6: Effect of the order of test lines in a multiplex test strip on qualitative test results

[0150] In this example, the multiple detection test strips provided in Example 1 were used to perform qualitative detection on a sample containing five types of legume lectins, wherein the sample simultaneously contained 10 (μg / mL) of soybean lectin, 10 (μg / mL) of concanavalin A, 10 (μg / mL) of red bean lectin, 10 (μg / mL) of phaseolus vulgaris lectin, and 10 (μg / mL) of red bean lectin. The order of the test lines in the multiple detection test strips is shown in Table 5, and the test results when different orders are used in the multiple detection test strips are investigated.

[0151] Table 5. Impact of test line sorting on test results

[0152]

[0153]

[0154] According to Table 5, red bean agglutinin is most susceptible to the influence of the other four bean agglutinins. The red bean agglutinin test line must be ranked first. If it is ranked later, the test results of the test strip will directly change from positive to weak positive or negative. At the same time, if the concanavalina agglutinin test line is ranked later, it is also easy to have a weak positive phenomenon. Therefore, the order of the test lines in the multiple detection test strips must be red bean agglutinin test line, concanavalina agglutinin test line, phaseolus vulgaris agglutinin test line, soybean agglutinin test line, and adzuki bean agglutinin test line.

[0155] Example 7: Optimization of the second nucleic acid aptamer sequence in electrochemical detection

[0156] In this embodiment, the second nucleic acid aptamer sequences of five kinds of legume lectins are optimized respectively, so that the detection accuracy and sensitivity of the target legume lectin can be improved. The second nucleic acid aptamer sequences of the five legume lectins before and after optimization are shown in Table 6, respectively, and they are fixed on the thin layer plate as described in Example 1, and the sample used contains 30 (μg / mL) soybean lectin, 30 (μg / mL) canadensis lectin, 30 (μg / mL) red bean lectin, 30 (μg / mL) phaseolus vulgaris lectin, and 30 (μg / mL) red bean lectin at the same time. The electrochemical detection component provided in Example 1 is used for sample detection, and the electrochemical detection results are converted into specific concentrations by preparing a standard curve. The results are shown in Table 6.

[0157] Table 6. Optimization of the second nucleic acid aptamer sequence

[0158]

[0159]

[0160] It can be seen from Table 6 that, compared with the second nucleic acid aptamer before optimization, the optimized second nucleic acid aptamer can improve the detection accuracy of each bean lectin.

[0161] The technical features of the above-described embodiments can be combined arbitrarily. In order to make the description concise, all possible combinations of the technical features in the above-described embodiments are not described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification. Although the present invention is disclosed as above, the present invention is not limited thereto. For example, it can be expanded according to its scope of application in the field of microfluidics. Any person skilled in the art can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the scope defined by the claims.

[0162] The contents of the articles, patents, patent applications, and all other documents and electronically available information described or recorded herein are incorporated by reference in their entirety to the same extent as if each individual publication was specifically and individually indicated to be incorporated by reference. Applicants reserve the right to incorporate into this application any and all materials and information from any such article, patent, patent application, or other document.

[0163] Sequence Listing

[0164] Seq ID NO.1

[0165] The first nucleic acid aptamer sequence of soybean lectin: 5'(TTTTTTTTTT)-(CCCCCCCCCCCCCCC)-GGTTGTGGAGGTTCT GGTTGTGGAGGTTCTGGTTGTGGAGGT TCT-3'

[0166] Seq ID NO.2

[0167] The first nucleic acid aptamer sequence of Concanavalin A agglutinin: 5'(TTTTTTTTTT)-(CCCCCCCCCCCCCCC)-GTTGGTTGTGGTTG TGGTTGTGGTTGTGGTTGTGGTTGGTTCT-3'

[0168] Seq ID NO.3

[0169] The first nucleic acid aptamer sequence of adzuki bean lectin: 5'(TTTTTTTTTT)-(CCCCCCCCCCCCCCC)-GTTGGTTGTGGTTG TGGTTCTGGTTGTGCTTGTGGTTGTGGTTGT-3'

[0170] Seq ID NO.4

[0171] The first nucleic acid aptamer sequence of Phaseolus vulgaris lectin: 5'(TTTTTTTTTT)-(CCCCCCCCCCCCCCC)-GTTCGTAGTGGTTGTG GTTGTGGTTGTGGTTGTGGTTGTGGTTGT-3'

[0172] Seq ID NO.5

[0173] The first nucleic acid aptamer sequence of red bean agglutinin: 5'(TTTTTTTTTT)-(CCCCCCCCCCCCCCC)-GTTGGTTGTCGTTGTG GTTGTGCTTGAGGTTGTGGTTGTGGTTGT-3'

[0174] Seq ID NO.6

[0175] The second aptamer sequence of soybean lectin: GGAGGTTCTGGTTGTGGAGGTTCTGGTTGTGGAGGTTCTGG TTGT;

[0176] Seq ID NO.7

[0177] The second nucleic acid aptamer sequence of Concanavalin A lectin: CGAGTAACGCTGTCTCTTCCGAATCGGGGGAAGGCGGAGGG; Seq ID NO.8

[0178] The second nucleic acid aptamer sequence of adzuki bean lectin: GTTGGTTGTGCTTGTGGTTGTGGTTGTGGTAGTGGTTGTGGT TGT

[0179] Seq ID NO.9

[0180] The second nucleic acid aptamer sequence of Phaseolus vulgaris lectin: TGGATAATGCGCTGACACTGTCGCCTCCGATCCCAG SeqID NO.10

[0181] The second nucleic acid aptamer sequence of red bean agglutinin: GTTGGTTGTGGTTCTGGTTGTGGTAGTGGTTCTGGTTGTCG TTGT Seq ID NO.11

[0182] Soybean lectin aptamer sequence before optimization:

[0183] GGT TGT GGA GGT TAC GGT TGT GGA GGT TCT GGT TGT GGA GGT TCT Seq IDNO.12

[0184] The aptamer sequence of Concanavalin A agglutinin before optimization:

[0185] GTT GGT TGT GGT TGT CCT TGT GGT TGT GGT TGT GGT TGT GGT TCT Seq IDNO.13

[0186] The nucleic acid aptamer sequence of adzuki bean lectin before optimization:

[0187] GTT GGT TGT GGT TGT GGT ACT GGT TGT GCT TGT GGT TGT GGT TGT Seq IDNO.14

[0188] The nucleic acid aptamer sequence of Phaseolus vulgaris lectin before optimization:

[0189] GTT CGT AGT GGT TGT GGT TGC GGT TGT GGT TGT GGT TGT GGT TG Seq IDNO.15

[0190] The nucleic acid aptamer sequence of red bean agglutinin before optimization:

[0191] GTT GGT TGT CGT TGT GGA AGT GCT TGA GGT TGT GGT TGT GGT TGT

Claims

1. A detection device, characterized in that: It includes a pre-treatment module and a detection module, wherein the pre-treatment module includes an enrichment medium, in which a nucleic acid aptamer capable of adsorbing a target analyte is fixed, and is used to enrich the target analyte to obtain a sample liquid to be tested; The detection module is used to detect the target analyte in the sample liquid.

2. The detection device according to claim 1, characterized in that The enrichment medium comprises a thin layer plate, and the thin layer plate comprises a first end and a second end; the thin layer plate is placed with one end tilted downward, and the downward end can automatically switch between the first end and the second end.

3. The detection device according to claim 2, characterized in that A waste liquid bin is provided below the first end of the thin layer plate, and when the first end is facing downward, the waste liquid after adsorption is collected through the waste liquid bin; a collecting bin is provided below the second end of the thin layer plate, and when the second end is facing downward, the sample liquid to be tested is collected through the collecting bin; a waste liquid bin one-way valve is provided at the entrance of the waste liquid bin, and a collecting bin one-way valve is provided at the entrance of the collecting bin.

4. The detection device according to claim 3, characterized in that The pre-treatment module also includes a sample bin and an eluent bin. The eluent bin releases eluent to elute the sample to be tested from the thin layer plate to obtain the sample liquid to be tested. A sample bin valve is provided below the sample bin, and an eluent bin valve is provided below the eluent bin. The sample bin valve and the waste liquid bin one-way valve are opened at the same time. The eluent bin valve and the collection bin one-way valve are opened at the same time.

5. The detection device according to claim 3, characterized in that: The detection module includes electrochemical detection components, the number of which is one or more groups, each group of electrochemical detection components is used to detect a target analyte; each group of electrochemical detection components includes a working electrode and a probe, and the probe includes a second nucleic acid aptamer that captures the target analyte.

6. The detection device according to claim 4, characterized in that: The detection module also includes a microfluidic channel and a test strip, wherein the microfluidic channel is used to divert the sample liquid to be tested; the test strip is a multiple detection test strip, which is coated with antibodies of the target object to be tested.

7. The detection device according to claim 5, characterized in that: The target analyte is a bean agglutinin, including any one or more of soybean agglutinin, concanavalin A agglutinin, adzuki bean agglutinin, phaseolus vulgaris agglutinin and red bean agglutinin.

8. The detection device according to claim 6, characterized in that: The nucleic acid aptamer fixed on the thin layer plate is a first nucleic acid aptamer, and the first nucleic acid aptamer includes any one or more first nucleic acid aptamers that bind to soybean lectin, jack bean agglutinin, adzuki bean agglutinin, phaseolus vulgaris agglutinin, and red bean agglutinin; the first nucleic acid aptamers that bind to soybean lectin, jack bean agglutinin, adzuki bean agglutinin, phaseolus vulgaris agglutinin, and red bean agglutinin respectively have nucleotide sequences as shown in Seq ID NO.1-5 in the sequence table; the first nucleic acid aptamer also has a (TTTTTTTTTT)-(CCCCCCCCCCCCCCCC)-sequence at the 5' end; The second nucleic acid aptamer includes a second nucleic acid aptamer that binds to any one or more of soybean lectin, jack bean agglutinin, adzuki bean agglutinin, phaseolus vulgaris agglutinin, and red bean agglutinin; the second nucleic acid aptamer that binds to soybean lectin, jack bean agglutinin, adzuki bean agglutinin, phaseolus vulgaris agglutinin, and red bean agglutinin respectively has the nucleotide sequence shown in the sequence table Seq ID NO.6~10.

9. The detection device according to claim 7, characterized in that: The eluent comprises ethylene glycol monomethyl ether, sodium dihydrogen phosphate dihydrate, NaCl and Tris buffer containing Tween20; and the multiple detection test strips are provided with detection lines of red bean agglutinin, concanavalina agglutinin, phaseolus vulgaris agglutinin, soybean agglutinin and adzuki bean agglutinin in sequence.

10. A method for detecting legume lectins, characterized in that: The detection device according to any one of claims 1 to 9 is used for detection, comprising the following steps: (1) crushing, defatting and extracting the sample to be tested, and collecting the crude sample; (2) adjusting the detection device to an initial state, wherein the second end of the thin layer plate is higher than the first end; (3) Adding the crude sample into the sample chamber; (4) Open the sample chamber and waste liquid chamber, and the analyte in the crude sample is adsorbed by the thin layer plate; (5) adjusting the first end of the thin layer plate to be higher than the second end and opening the collection chamber; (6) opening the eluent tank, allowing the eluent to elute the sample from the thin layer plate, and collecting the sample liquid in the collection tank; (7) The sample liquid to be tested flows into the detection module for detection.

Images