Reporting system capable of being used for screening drugs aiming at RNA repetitive sequences

Abstract

The invention provides a reporting system for screening drugs aiming at pathogenic RNA repetitive sequences, and particularly relates to a reporting system simultaneously containing RNA repetitive sequences with different lengths, which can be used for screening drugs aiming at pathogenic RNA repetitive sequences and related basic research and development work. The invention provides a nucleic acid construct group for screening drugs for treating diseases related to long RNA repetitive sequences, and a carrier and a screening system based on the nucleic acid construct group.

Description

A reporter system for screening drugs targeting RNA repeat sequences Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a reporter system that can be used to screen drugs targeting RNA repeat sequences. Background Art

[0002] RNA repeats refer to repetitive sequences found in RNA molecules and are widely present in the human transcriptome. In some cases, the length of these repeats can reach a certain level and lead to the development of specific RNA repeat-related diseases. Such diseases are usually caused by discrepancies in the length of the RNA repeats carried by two alleles in the human body, resulting from abnormal expansion of microsatellite sequences in the genome. One of the genes with the short repeat sequence is a normal gene, while the other gene with the abnormal repeat sequence length may cause disease.

[0003] Huntington's disease is an inherited neurodegenerative disease whose onset is associated with the expansion of long CAG repeat sequences in the HTT gene. The length of CAG repeats in the human population varies, with 35 CAGs being the critical value. When the length is greater than 35 CAGs, the disease is more likely to develop. This disease not only leads to deterioration in multiple aspects such as intelligence, movement, and mental health, but there is currently no cure. Myotonic Dystrophy Type 1 (DM1) is an inherited muscle disease caused by the presence of abnormally long CUG repeat sequences in the 3'UTR region of the DMPK gene. DM1 patients have severe abnormalities in the muscles, heart, endocrine system, and nervous system, making treatment extremely challenging. However, there is currently no effective treatment for this type of RNA repeat-related disease, which brings great distress to patients.

[0004] The pathogenesis of these RNA repeat sequence-related diseases has some commonalities, including corresponding RNA protein complexes, ribosomes and other elements. At the same time, there are also some specific mechanisms that require more in-depth research and understanding.

[0005] Current drug screening systems for these diseases only consider the clearance of long pathogenic RNA repeats, without also considering off-target effects on short normal RNA repeats. An optimal system would simultaneously characterize and screen for drugs with strong clearance of long pathogenic RNA repeats while also identifying off-target effects on short normal RNA repeats. This would accelerate the screening process and make the resulting candidate drugs or molecules more selective, ultimately resulting in better therapeutic outcomes for patients.

[0006] Therefore, there is an urgent need in this field to develop a screening or reporting system that can quickly and accurately screen potential drugs for treating RNA repeat sequence-related diseases.

[0007] Summary of the Invention

[0008] The present invention aims to provide a screening or reporting system that can quickly and accurately screen out potential drugs for treating diseases associated with RNA repeat sequences.

[0009] In a first aspect of the present invention, a nucleic acid construct set is provided, comprising: a first nucleic acid construct and a second nucleic acid construct;

[0010] Furthermore, the first nucleic acid construct contains a first expression cassette, wherein the first expression cassette expresses a long RNA repeat sequence, and the first expression cassette comprises a repeat sequence unit of 3-6 nucleotides, wherein the repeat sequence is repeated 41-2000 times, preferably 45-1500 times, and more preferably 50-1000 times;

[0011] The second nucleic acid construct contains a second expression cassette, which expresses a short RNA repeat sequence, and the second expression cassette contains a repeat sequence unit of 3-6 nucleotides corresponding to the first expression cassette, and the repeat sequence is repeated 2-40 times, preferably 5-40 times.

[0012] In another preferred example, the first expression cassette further comprises a first promoter and a coding sequence of a first detectable marker.

[0013] In another preferred example, the second expression cassette further comprises a second promoter and a coding sequence of a second detectable marker.

[0014] In another preferred embodiment, the repeating sequence unit is selected from the following group: CAG, GCG, CGG, CTG, CCG, GAA, CCCCGCCCCGCG, ATTCT / ATTGT, CCTG, TGGAA, GGCCTG, GGGGCC, CCCTCT, ATTTC, AAGGG, GCA, and different equivalent sequences (for example, CAG repeats and AGC repeats, CTG repeats and TGC repeats, etc. are equivalent sequences), or a combination thereof.

[0015] In another preferred embodiment, the corresponding means:

[0016] The first expression cassette contains a repetitive sequence unit CTG, and the second expression cassette contains a repetitive sequence unit CTG;

[0017] The first expression cassette contains a repeating sequence unit CCTG, and the second expression cassette contains a repeating sequence unit CCTG;

[0018] The first expression cassette contains a repeating sequence unit CAG, and the second expression cassette contains a repeating sequence unit CAG;

[0019] The first expression cassette contains a repeating sequence unit TGGAA, and the second expression cassette contains a repeating sequence unit TGGAA;

[0020] The first expression cassette contains the repeating sequence unit GGGGCC, and the second expression cassette contains the repeating sequence unit GGGGCC;

[0021] The first expression cassette contains a repeating sequence unit CGG, and the second expression cassette contains a repeating sequence unit CGG;

[0022] The first expression cassette contains a repeating sequence unit GCG, and the second expression cassette contains a repeating sequence unit GCG;

[0023] The first expression cassette contains a repeating sequence unit CCG, and the second expression cassette contains a repeating sequence unit CCG;

[0024] The first expression cassette contains a repeating sequence unit GAA, and the second expression cassette contains a repeating sequence unit GAA;

[0025] The first expression cassette contains the repeating sequence unit GGCCTG, and the second expression cassette contains the repeating sequence unit GGCCTG;

[0026] The first expression cassette contains a repeating sequence unit ATTTC, and the second expression cassette contains a repeating sequence unit ATTTC;

[0027] The first expression cassette contains the repeating sequence unit AAGGG, and the second expression cassette contains the repeating sequence unit AAGGG;

[0028] The first expression cassette contains the repeating sequence unit GCA, and the second expression cassette contains the repeating sequence unit GCA;

[0029] The first expression cassette contains the repeating sequence unit ATTCT / ATTGT, and the second expression cassette contains the repeating sequence unit ATTCT / ATTGT;

[0030] The first expression cassette contains the repeating sequence unit CCCCGCCCCGCG, and the second expression cassette contains the repeating sequence unit CCCCGCCCCGCG.

[0031] In another preferred embodiment, the first promoter and the second promoter each independently include a eukaryotic promoter or a prokaryotic promoter.

[0032] In another preferred embodiment, the first promoter and the second promoter each independently include a constitutive promoter or an inducible promoter.

[0033] In another preferred embodiment, the first promoter and the second promoter are each independently selected from the following group: CMV promoter, CAG promoter, PGK promoter, EF-1α promoter, SV40 promoter, chicken beta-actin promoter, HSV-TK promoter, Ubc promoter, TRE promoter, UAS promoter, Ac5 promoter, Polyhedrin promoter, CaMKIIa promoter, IL-2 promoter, RSV promoter, GAL1 promoter, TEF1 promoter, TDH3 promoter, ADH1 promoter, T7 promoter, T3 promoter, Sp6 promoter, araBAD promoter, trp promoter, lac promoter, pL promoter, or a combination thereof.

[0034] In another preferred embodiment, the first detectable label and the second detectable label are independently selected from the following group: fluorescent groups, luciferase, luminescent markers, quantum dots, β-galactosidase LacZ, or a combination thereof.

[0035] In another preferred embodiment, the fluorescent group is selected from the following group: mCherry, GFP and its derivative EGFP, dTomato, BFP, YFP, or other fluorescent protein combinations.

[0036] In another preferred embodiment, the luciferase is selected from the following group: Firefly luciferase (FLuc), Renilla luciferase (RLuc), Gaussia luciferase (GLuc), Nano-Glo luciferase (NLuc), Cypridina luciferase (CLuc), or other luciferase combinations.

[0037] In another preferred embodiment, the first detectable marker and the second detectable marker are different.

[0038] In another preferred embodiment, the first nucleic acid construct and the second nucleic acid construct are connected via a connecting element.

[0039] In another preferred embodiment, the first expression cassette and the second expression cassette are located on the expression vector of the same nucleic acid construct.

[0040] In another preferred embodiment, the first nucleic acid construct has a structure of Formula I or I':

[0041] Z1-P1-Z2-pA1 (I)

[0042] pA1-Z2-P1-Z1 (I')

[0043] in,

[0044] Z1 is the first promoter;

[0045] P1 is the coding sequence of the first detectable marker;

[0046] Z2 is a repeating sequence unit of 3-6 nucleotides, and the number of repetitions of the repeating sequence is 41-2000 times, preferably 45-1500 times, and more preferably 50-1000 times;

[0047] pA1 is one or more nucleic acid fragments containing poly(A) signal elements or other nucleic acid fragments for transcription termination, preferably, selected from the group consisting of CaMV poly(A) signal element, EF-1α poly(A) signal element, BGH (bovine growth hormone)-poly(A) signal element, hGH poly(A) signal, SV40-poly(A) signal element, human β-globin poly(A) signal element, or a combination thereof;

[0048] Each “-” represents no or no nucleotide linking sequence.

[0049] In another preferred embodiment, the second nucleic acid construct has a structure of Formula II or Formula II':

[0050] Z3-P2-Z4-pA2 (II)

[0051] pA2-Z4-P2-Z3 (II')

[0052] in,

[0053] Z3 is the second promoter;

[0054] P2 is the coding sequence of the second detectable marker;

[0055] Z4 is a repeating sequence unit of 3-6 nucleotides corresponding to Z2, and the repeating sequence is repeated 2-40 times, preferably 5-40 times;

[0056] pA2 is one or more nucleic acid fragments containing poly(A) signal elements or other nucleic acid fragments for transcription termination, preferably selected from the group consisting of CaMV poly(A) signal element, EF-1α poly(A) signal element, BGH (bovine growth hormone)-poly(A) signal element, hGH poly(A) signal, SV40-poly(A) signal element, human β-globin polyadenylation signal element, or a combination thereof;

[0057] Each “-” represents no or no nucleotide linking sequence.

[0058] In another preferred embodiment, pA1 and pA2 may be the same or different.

[0059] In another preferred embodiment, the first promoter and the second promoter are the same or their expression strengths are similar.

[0060] In another preferred embodiment, the close expression intensity means that the ratio (T1 / T2) of the expression intensity T1 of the first promoter to the expression intensity T2 of the second promoter is 0.8-1.2.

[0061] In another preferred embodiment, the first promoter is selected from the following group: CMV promoter, CAG promoter, PGK promoter, EF-1α promoter, SV40 promoter, chicken beta-actin promoter, HSV-TK promoter, Ubc promoter, TRE promoter, UAS promoter, Ac5 promoter, Polyhedrin promoter, CaMKIIa promoter, IL-2 promoter, RSV promoter, GAL1 promoter, TEF1 promoter, TDH3 promoter, ADH1 promoter, T7 promoter, T3 promoter, Sp6 promoter, araBAD promoter, trp promoter, lac promoter, pL promoter, or a combination thereof.

[0062] In another preferred embodiment, the second promoter is selected from the following group: CMV promoter, CAG promoter, PGK promoter, EF-1α promoter, SV40 promoter, chicken beta-actin promoter, HSV-TK promoter, Ubc promoter, TRE promoter, UAS promoter, Ac5 promoter, Polyhedrin promoter, CaMKIIa promoter, IL-2 promoter, RSV promoter, GAL1 promoter, TEF1 promoter, TDH3 promoter, ADH1 promoter, T7 promoter, T3 promoter, Sp6 promoter, araBAD promoter, trp promoter, lac promoter, pL promoter, or a combination thereof.

[0063] In another preferred embodiment, the first detectable marker and the second detectable marker are different.

[0064] In another preferred embodiment, the first detectable marker and the second detectable marker can be excited by lasers of different excitation wavelengths to emit fluorescence of different colors.

[0065] In another preferred embodiment, the first detectable marker and the second detectable marker can emit light of different colors by adding different substrates.

[0066] In another preferred embodiment, the repeating sequence unit of Z2 is CTG, and the repeating sequence unit of Z4 is CTG; or

[0067] The repeating sequence unit of Z2 is CCTG, and the repeating sequence unit of Z4 is CCTG; or

[0068] The repeating sequence unit of Z2 is CAG and the repeating sequence unit of Z4 is CAG; or

[0069] The repeating sequence unit of Z2 is TGGAA, and the repeating sequence unit of Z4 is TGGAA; or

[0070] The repeating sequence unit of Z2 is GGGGCC, and the repeating sequence unit of Z4 is GGGGCC; or

[0071] The repeating sequence unit of Z2 is CGG, and the repeating sequence unit of Z4 is CGG.

[0072] The repeating sequence unit of Z2 is GCG, and the repeating sequence unit of Z4 is GCG;

[0073] The repeating sequence unit of Z2 is CCG, and the repeating sequence unit of Z4 is CCG;

[0074] The repeating sequence unit of Z2 is GAA, and the repeating sequence unit of Z4 is GAA;

[0075] The repeating sequence unit of Z2 is GGCCTG, and the repeating sequence unit of Z4 is GGCCTG;

[0076] The repeating sequence unit of Z2 is ATTTC, and the repeating sequence unit of Z4 is ATTTC;

[0077] The repeating sequence unit of Z2 is AAGGG, and the repeating sequence unit of Z4 is AAGGG;

[0078] The repeating sequence unit of Z2 is GCA, and the repeating sequence unit of Z4 is GCA;

[0079] The repeating sequence unit of Z2 is ATTCT / ATTGT, and the repeating sequence unit of Z4 is ATTCT / ATTGT;

[0080] The repeating sequence unit of Z2 is CCCCGCCCCGCG, and the repeating sequence unit of Z4 is CCCCGCCCCGCG.

[0081] In another preferred embodiment, the length of the first nucleic acid construct and the second nucleic acid construct independently comprises 10 repeating units to 1000 repeating units, preferably, 15 repeating units to 500 repeating units, and more preferably, 20 repeating units to 500 repeating units.

[0082] In another preferred embodiment, the construct group has the structure of formula III (or III' or III" or IIII"' or III"" or III""' or III""" or III"""'):

[0083] Z1-P1-Z2-pA1-Z3-P2-Z4-pA2 (III);

[0084] Z3-P2-Z4-pA2-Z1-P1-Z2-pA1 (III');

[0085] Z1-P1-Z2-pA1-pA2-Z4-P2-Z3 (III”);

[0086] Z3-P2-Z4-pA2-pA1-Z2-P1-Z1 (III”’);

[0087] pA1-Z2-P1-Z1-Z3-P2-Z4-pA2 (III””);

[0088] pA2-Z4-P2-Z3-Z1-P1-Z2-pA1 (III””’);

[0089] pA1-Z2-P1-Z1-pA2-Z4-P2-Z3 (III ” ” ” );

[0090] pA2-Z4-P2-Z3-pA1-Z2-P1-Z1 (III”””’).

[0091] In the formula, the definitions of the various elements are as described above.

[0092] In another preferred embodiment, the nucleic acid construct group comprises 10 repeating units to 1000 repeating units, preferably, 15 repeating units to 500 repeating units, more preferably, 20 repeating units to 500 repeating units.

[0093] The second aspect of the present invention provides a recombinant vector, which comprises the nucleic acid construct group as described in the first aspect of the present invention.

[0094] In another preferred embodiment, the vector includes a DNA vector, an RNA vector, a viral vector, a plasmid, a transposon, other gene transfer systems, or a combination thereof; preferably, the vector is a plasmid or a viral vector.

[0095] In another preferred embodiment, the vector is circular or linear.

[0096] The third aspect of the present invention provides a genetically engineered cell, which contains the nucleic acid construct group described in the first aspect of the present invention, or contains the recombinant vector described in the second aspect of the present invention.

[0097] In another preferred embodiment, the genetically engineered cells include eukaryotic cells.

[0098] In another preferred embodiment, the genetically engineered cells include mammalian cells.

[0099] In another preferred embodiment, the genetically engineered cells include human embryonic kidney HEK293 cells, human skeletal muscle cells, human HeLa cells, human corneal endothelial cells, mouse NIH 3T3 cell line, monkey COS-7 cell line and other commonly used mammalian cell lines.

[0100] The fourth aspect of the present invention provides a kit, comprising: a container and the nucleic acid construct set according to the first aspect of the present invention located in the container.

[0101] In another preferred embodiment, the kit is used to screen drugs for treating diseases associated with long RNA repeat sequences.

[0102] A fifth aspect of the present invention provides a method for screening drugs for treating diseases associated with long RNA repeat sequences, comprising the steps of:

[0103] (a) introducing the nucleic acid construct set described in the first aspect of the present invention and the drug to be screened into cells,

[0104] (b) determining whether the drug to be tested is a drug for treating a disease associated with long RNA repeat sequences based on the changes in the intensities of the first detectable marker and the second detectable marker in the nucleic acid construct group.

[0105] In another preferred embodiment, the cells include mammalian cells.

[0106] In another preferred embodiment, the cells include human skeletal muscle cells, human neural stem cells, human fibroblast stem cells, human myoblasts, human heart cells, human renal epithelial cells, human corneal endothelial cells, human tumor cells, human lung cells, human liver cells, human spleen cells, human colon cells, human embryonic stem cells, human bone marrow cells, human thyroid cells, human pancreatic cells, human lymphocytes, human T cells, human colon gland cells, human retinal cells, human gastric cells or other human cells.

[0107] In another preferred embodiment, the cells include HEK293T, Hela, u2os, N2a, U87, NIH3T3, B4G12, COS-7, SY5Y, A549 or other human stable cell lines.

[0108] In another preferred embodiment, the cells are cells cultured in vitro.

[0109] In another preferred example, when the expression level or intensity of the first detectable marker is significantly reduced and the expression level or intensity of the second detectable marker changes slightly or remains essentially unchanged, it indicates that the drug to be screened can be used as a candidate drug for treating long RNA repeat sequence-related diseases.

[0110] In another preferred embodiment, when the decrease in the expression level or intensity of the first detectable marker is small, it indicates that the drug to be screened is not suitable for treating long RNA repeat sequence-related diseases.

[0111] In another preferred embodiment, the significant decrease in the expression level or intensity of the first detectable marker means that the decrease in the expression level or intensity of the first detectable marker is ≥25%, preferably ≥50%, and more preferably ≥75%.

[0112] In another preferred embodiment, the small decrease in the expression level or intensity of the first detectable marker means that the decrease in the expression level or intensity of the first detectable marker is ≤25%, preferably ≤20%, and more preferably ≤15%.

[0113] In another preferred embodiment, the expression level or intensity of the second detectable marker changes slightly or remains essentially unchanged, which means that the decrease in the expression level or intensity of the second detectable marker is ≤25%, preferably ≤15%, more preferably ≤5%, and more preferably 0.

[0114] In another preferred embodiment, the introduction method includes one or more methods selected from the following group: calcium phosphate-mediated transfection, nucleofection, electroporation, cationic polymer transfection, viral transduction, virosome transfection, viral particle transfection, liposome transfection, cationic liposome transfection, immunoliposome transfection, non-liposomal transfection, dendrimer transfection, heat shock transfection, magnetofection, lipofection, gene gun delivery, impalefection, sonoporation and optical transfection.

[0115] In another preferred embodiment, the drugs to be screened include drugs that can reduce the expression level or intensity of the first detectable marker but do not reduce the expression level or intensity of the second detectable marker.

[0116] In another preferred embodiment, the drug to be screened includes CRISPR reagents.

[0117] In another preferred embodiment, the CRISPR reagent includes a gene editing protein and an optional guide RNA.

[0118] In another preferred embodiment, the gene editing protein is capable of recognizing long RNA repeat sequences and cutting the recognized long RNA repeat sequences.

[0119] In another preferred embodiment, the guide RNA guides the gene editing protein to specifically bind to the DNA portion that can express the long RNA repeat sequence.

[0120] In another preferred embodiment, the gene editing protein is selected from the group consisting of Cas13a, Cas13b, Cas13d, Cas13x, Cas13y, RNA-targeting Cas9 (RCas9, dead Cas9 from Streptococcus pyogenes), dSaCas9 (dead Cas9 from Staphylococcus aureus), or a combination thereof.

[0121] In another preferred embodiment, the drug to be screened includes an artificial RNA degrading enzyme.

[0122] In another preferred embodiment, the RNA degrading enzyme has a structure shown in Formula IV or IV' from the NC end of the protein:

[0123] D1-A-L1-B-D2 (IV);

[0124] D1-B-L1-A-D2 (IV')

[0125] In the formula, each “-” is independently a connecting peptide or a peptide bond;

[0126] A is the PUF protein fragment;

[0127] B is the full length or active fragment of RNase or RNA helicase;

[0128] L1 is none or a linker peptide;

[0129] D1 is no or positioned peptide;

[0130] D2 is absent or positioned peptide.

[0131] In another preferred embodiment, the PUF protein fragment is a fragment of the PUF protein domain that can recognize and bind RNA.

[0132] In another preferred embodiment, the PUF protein includes PUF protein and homologous proteins thereof.

[0133] In another preferred embodiment, the PUF protein is from a mammal, preferably from a primate, and more preferably from a human.

[0134] In another preferred embodiment, the PUF protein fragment contains n recognition units, each of which is used to recognize an RNA base, wherein n is a positive integer of 5-30.

[0135] In another preferred embodiment, n is 6-24, more preferably 8-20, for example, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24.

[0136] In another preferred embodiment, each recognition unit is an α-helical repeat sequence, and three amino acids at specific positions on the repeat sequence are responsible for binding to RNA bases.

[0137] In another preferred embodiment, the n recognition units are connected in series to form an RNA base recognition region.

[0138] In another preferred embodiment, the PUF protein fragment further comprises optional protection zones located on both sides of the RNA base recognition region, for protecting the RNA base recognition region.

[0139] In another preferred embodiment, the PUF protein fragment includes a domain located upstream of the RNA base recognition region in the PUF protein (excluding the protection zone), but may or may not include a domain located downstream of the RNA base recognition region in the PUF protein (excluding the protection zone).

[0140] In another preferred embodiment, the protection zone is a non-functional repeat sequence at both ends of the RNA base recognition region.

[0141] In another preferred embodiment, the localization peptide sequence includes a nuclear localization signal sequence, a mitochondrial localization signal sequence or a nuclear export signal sequence.

[0142] In another preferred embodiment, the connecting peptide and / or positioning peptide signal are independently located between the PUF protein fragment and the RNA enzyme or RNA helicase.

[0143] In another preferred embodiment, the RNA is single-stranded.

[0144] In another preferred embodiment, the PUF protein fragment is selected from the following group:

[0145] (a) a polypeptide having the amino acid sequence shown in SEQ ID NO: 1;

[0146] (b) a polypeptide having ≥80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5% homology (or identity) to the amino acid sequence of SEQ ID NO: 1, and the polypeptide has the biological function of SEQ ID NO: 1;

[0147] (c) A derivative polypeptide formed by substituting, deleting or adding one or more (preferably 1-20, more preferably 1-10, and even more preferably 1-5) amino acid residues of the amino acid sequence shown in SEQ ID NO: 1 and retaining the biological function shown in SEQ ID NO: 1.

[0148] In another preferred embodiment, the PUF protein fragment has an amino acid sequence as shown in SEQ ID NO.1.

[0149] In another preferred embodiment, the full length or active fragment of the RNA enzyme or RNA helicase is selected from the following group: PIN (from SMG6, UNIPROT: Q86US8), ANG (UNIPROT: P03950), RNASEL (UNIPROT: Q05823), RRP44 (UNIPROT: Q9Y2L1), RNASE1 (UNIPROT: P07998), RNASET2 (UNIPROT: O00584) , SUPV3L1 (UNIPROT: Q8IYB8), PNPT1 (UNIPROT: Q8TCS8), REXO2 (UNIPROT: Q9Y3B8), MRPL44 (UNIPROT: Q9H9J2), LACTB2 (UNIPROT: Q53H82), TSEN15 (UNIPROT: Q8WW01), ZC3H12A (UNIPROT: Q5D1E8), or active regions and sequence combinations thereof.

[0150] In another preferred embodiment, the full length or active fragment of the RNA enzyme or RNA helicase is selected from the following group: ANG (UNIPROT: P03950), RNASE1 (UNIPROT: P07998), RNASET2 (UNIPROT: O00584), SUPV3L1 (UNIPROT: Q8IYB8), PNPT1 (UNIPROT: Q8TCS8), REXO2 (UNIPROT: Q9Y3B8), or a combination thereof.

[0151] In another preferred embodiment, the RNA enzyme or RNA helicase includes an RNA enzyme or RNA helicase having a homology of at least 80%, preferably at least 85% or 90%, more preferably at least 95%, and most preferably at least 98% or 99% to the above-mentioned RNA enzyme or RNA helicase.

[0152] In another preferred embodiment, the nucleotide sequence encoding the RNA degrading enzyme is a codon-optimized nucleotide sequence.

[0153] In another preferred embodiment, the nucleotide sequence encoding the RNA degrading enzyme is a nucleotide sequence codon-optimized using the GENEWIZ algorithm, the Genescript algorithm, or the Thermo algorithm.

[0154] In another preferred embodiment, the artificial RNA degrading enzyme is selected from the following group:

[0155] (a) a polypeptide having an amino acid sequence as shown in any one of SEQ ID NOs: 95-111, 116-119;

[0156] (b) a polypeptide having ≥80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5% homology (or identity) to the amino acid sequence of any one of SEQ ID NOs: 95-111, 116-119, and the polypeptide has the biological function of any one of SEQ ID NOs: 99-115, 120-123;

[0157] (c) A derivative polypeptide obtained by substituting, deleting or adding one or more (preferably 1-20, more preferably 1-10, and more preferably 1-5) amino acid residues of the amino acid sequence shown in any one of SEQ ID NOs: 95-111, 116-119, and retaining the biological function shown in any one of SEQ ID NOs: 95-111, 116-119.

[0158] In another preferred embodiment, the connecting peptide is a flexible peptide or a rigid peptide.

[0159] In another preferred embodiment, the connecting peptide is selected from the following group: XTEN peptide segment, GGGGS or other short peptide segments.

[0160] In another preferred embodiment, the length of the connecting peptide is 0-40 aa, preferably 2-20 aa.

[0161] A sixth aspect of the present invention provides a system for screening drugs for treating diseases associated with long RNA repeat sequences, the system comprising:

[0162] (a) the nucleic acid construct set according to the first aspect of the present invention;

[0163] (b) drugs to be screened;

[0164] Among them, when the expression level or intensity of the first detectable marker in the nucleic acid construct group is significantly reduced, and the expression level or intensity of the second detection marker changes very little or remains basically unchanged, it indicates that the drug to be screened is a candidate or potential drug that can be used to treat long RNA repeat sequence-related diseases.

[0165] In another preferred embodiment, the first detectable marker is driven by a first promoter (such as CMV promoter, CAG promoter, PGK promoter, EF-1α promoter, SV40 promoter, chicken beta-actin promoter, HSV-TK promoter, Ubc promoter, TRE promoter, UAS promoter, Ac5 promoter, Polyhedrin promoter, CaMKIIa promoter, IL-2 promoter, RSV promoter, or other eukaryotic cell promoters) to drive the expression of the first detectable marker.

[0166] In another preferred embodiment, the second detectable marker is expressed by a second promoter (such as CMV promoter, CAG promoter, PGK promoter, EF-1α promoter, SV40 promoter, chicken beta-actin promoter, HSV-TK promoter, Ubc promoter, TRE promoter, UAS promoter, Ac5 promoter, Polyhedrin promoter, CaMKIIa promoter, IL-2 promoter, RSV promoter, or other eukaryotic cell promoters).

[0167] In another preferred embodiment, the first promoter and the second promoter are the same or have similar expression strengths.

[0168] In another preferred embodiment, the close expression intensity means that the ratio (T1 / T2) of the expression intensity T1 of the first promoter to the expression intensity T2 of the second promoter is 0.8-1.2.

[0169] In another preferred embodiment, when the expression level or intensity of the first detectable marker is significantly reduced, the expression level or intensity of the second detectable marker changes slightly or remains essentially unchanged.

[0170] In another preferred embodiment, the first detectable marker and the second detectable marker are expressed respectively through the same promoter.

[0171] A seventh aspect of the present invention provides a screening composition for screening drugs for treating diseases associated with long RNA repeat sequences, the screening composition comprising:

[0172] (a) drugs to be screened;

[0173] (b) the nucleic acid construct set according to the first aspect of the present invention;

[0174] Among them, when the expression level or intensity of the first detectable marker in the nucleic acid construct group is significantly reduced, and the expression level or intensity of the second detection marker changes slightly or remains basically unchanged, it indicates that the drug to be screened is a candidate or potential drug that can be used to treat long RNA repeat sequence-related diseases.

[0175] The eighth aspect of the present invention provides a use of the system described in the sixth aspect of the present invention or the screening composition described in the seventh aspect of the present invention for screening drugs for treating diseases associated with long RNA repeat sequences.

[0176] In another preferred embodiment, the drug for treating long RNA repeat sequence-related diseases includes CRISPR reagents.

[0177] In another preferred embodiment, the CRISPR reagent includes a gene editing protein and an optional guide RNA.

[0178] In another preferred embodiment, the gene editing protein is capable of recognizing long RNA repeat sequences and cutting the recognized long RNA repeat sequences.

[0179] In another preferred embodiment, the guide RNA guides the gene editing protein to specifically bind to the DNA portion that can express the long RNA repeat sequence.

[0180] In another preferred embodiment, the gene editing protein is selected from the group consisting of Cas13a, Cas13b, Cas13d, Cas13x, Cas13y, RNA-targeting Cas9 (RCas9, dead Cas9 from Streptococcus pyogenes), dSaCas9 (dead Cas9 from Staphylococcus aureus), or a combination thereof.

[0181] In another preferred embodiment, the drug for treating long RNA repeat sequence-related diseases includes an artificial RNA degrading enzyme.

[0182] In another preferred embodiment, the RNA degrading enzyme has a structure shown in Formula IV or IV' from the NC end:

[0183] D1-A-L1-B-D2 (IV);

[0184] D1-B-L1-A-D2 (IV')

[0185] In the formula, each “-” is independently a connecting peptide or a peptide bond;

[0186] A is the PUF protein fragment;

[0187] B is the full length or active fragment of RNase or RNA helicase;

[0188] L1 is none or a linker peptide;

[0189] D1 is no or positioned peptide;

[0190] D2 is absent or positioned peptide.

[0191] In another preferred embodiment, the nucleotide sequence encoding the artificial RNA degrading enzyme is a codon-optimized nucleotide sequence.

[0192] In another preferred embodiment, the nucleotide sequence encoding the artificial RNA degrading enzyme is a nucleotide sequence codon-optimized using the GENEWIZ algorithm, the Genescript algorithm, or the Thermo algorithm.

[0193] In another preferred embodiment, the artificial RNA degrading enzyme is an RNA degrading enzyme encoded by a nucleotide sequence that has been codon-optimized (for example, codon-optimized using the GENEWIZ algorithm, the Genescript algorithm, or the Thermo algorithm).

[0194] A ninth aspect of the present invention provides a composition comprising:

[0195] (a) A drug for treating a disease associated with long RNA repeats obtained by the method of the fifth aspect of the present invention or the system of the sixth aspect of the present invention, wherein the drug for treating a disease associated with long RNA repeats comprises an artificial RNA degrading enzyme.

[0196] In another preferred embodiment, the RNA degrading enzyme has a structure shown in Formula IV or IV' from the NC end:

[0197] D1-A-L1-B-D2 (IV);

[0198] D1-B-L1-A-D2 (IV')

[0199] In the formula, each “-” is independently a connecting peptide or a peptide bond;

[0200] A is the PUF protein fragment;

[0201] B is the full length or active fragment of RNase or RNA helicase;

[0202] L1 is none or a linker peptide;

[0203] D1 is no or positioned peptide;

[0204] D2 is absent or positioned peptide.

[0205] A tenth aspect of the present invention provides a method for preparing an animal model for screening drugs for treating diseases associated with long RNA repeat sequences, the method comprising the following steps:

[0206] (a) providing non-human mammalian cells, introducing the nucleic acid construct set described in the first aspect of the present invention into the cells, thereby obtaining cells that simultaneously express long RNA repeat sequences and short RNA repeat sequences;

[0207] (b) Using the cells simultaneously expressing long RNA repeat sequences and short RNA repeat sequences obtained in step (a), an animal model is prepared for screening drugs for treating diseases associated with long RNA repeat sequences.

[0208] In another preferred embodiment, the cells include somatic cells, germ cells and / or embryonic stem cells.

[0209] In another preferred embodiment, the embryonic stem cells further include embryos and / or fertilized eggs that are less than 14 days old.

[0210] In another preferred embodiment, the cells are selected from non-human mammals, preferably rodents or primates, preferably mice, rats, rabbits and / or monkeys, chimpanzees.

[0211] In another preferred embodiment, the cell is a fertilized egg of a non-human mammal.

[0212] The eleventh aspect of the present invention provides a use of a non-human mammal model prepared by the method described in the tenth aspect of the present invention, wherein the model is used to screen or identify substances (therapeutic agents) for treating diseases associated with long RNA repeat sequences.

[0213] A twelfth aspect of the present invention provides a method for screening or identifying potential therapeutic agents for treating long RNA repeat sequence-related diseases, comprising the following steps:

[0214] (a) administering a test drug to a non-human mammal model prepared by the method of the ninth aspect of the present invention in the presence of a test drug in a test group, and analyzing the expression level or intensity of the first detectable marker and the second detectable marker in the animal model of the test group; and analyzing the expression level or intensity of the first detectable marker and the second detectable marker in the animal model of the control group in a control group in which the test drug is not administered and other conditions are the same;

[0215] (b) comparing the expression levels or intensities of the first detectable marker and the second detectable marker in the test group and the control group animal models, wherein, compared with the control group, if the expression level or intensity of the first detectable marker in the animal model administered with the test drug is significantly reduced, and the expression level or intensity of the second detectable marker remains essentially unchanged, it indicates that the test compound can be used as a potential therapeutic agent for treating diseases associated with long RNA repeat sequences.

[0216] In another preferred embodiment, the long RNA repeat sequence-related diseases include the disease types shown in Table 1 and Table 2.

[0217] In another preferred embodiment, the diseases associated with the long RNA repeat sequence include: frontotemporal dementia (FTD), Huntington disease (HD), myotonic dystrophy Type 1 / 2 (DM1 / 2), amyotrophic lateral sclerosis (ALS), Fuchs endothelial corneal dystrophy (FECD), autosomal-dominant cerebellar ataxias (ADCAs), and fragile X syndrome (FXS).

[0218] In another preferred embodiment, the method is non-diagnostic and non-therapeutic.

[0219] In another preferred embodiment, the method includes step (c): applying the potential therapeutic agent screened or identified in step (b) to the non-human mammal model prepared by the method described in the tenth aspect of the present invention, thereby determining its effect on the expression level or intensity of the first detectable marker and the second detectable marker in the animal model.

[0220] The thirteenth aspect of the present invention provides a non-human mammal model prepared using the method described in the tenth aspect of the present invention.

[0221] The fourteenth aspect of the present invention provides a use of the genetically engineered cells described in the third aspect of the present invention for preparing biological preparations for constructing animal models for screening drugs for treating diseases associated with long RNA repeat sequences in non-human mammals.

[0222] In another preferred embodiment, the biological agent is a liquid preparation.

[0223] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features described in detail below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be listed here one by one. BRIEF DESCRIPTION OF THE DRAWINGS

[0224] Figure 1. Schematic diagram of a dual reporter gene system with different RNA repeat sequences. (A) CUG repeat sequence; (B) CAG repeat sequence; (C) CCUG repeat sequence; (D) TGGAA repeat sequence.

[0225] Figure 2. Inducible expression of a dual reporter gene system containing CUG repeats in Flp-In T-REX 293 cells. (A) Reporter gene fluorescent protein expression in cells without the addition of an inducer; (B) Reporter gene fluorescent protein expression in cells with the addition of 1 μg / mL doxycycline; (C) Imaging of expression of the dual reporter gene system containing CUG repeats in cells.

[0226] Figure 3. Experimental flow chart comparing the effectiveness of existing systems that can target RNA repeat sequences.

[0227] Figure 4. Flow cytometry detection results of existing systems that can target RNA repetitive sequences.

[0228] Figure 5. RT-qPCR detection results of existing systems that can target RNA repetitive sequences.

[0229] Figure 6. Screening of novel artificial RNA degraders using a dual-reporter gene system with different RNA repeat sequences. (A) Schematic diagram of the composition of artificial RNA degraders; (B) Screening results of novel artificial RNA degraders (RT-qPCR).

[0230] Figure 7. Flow cytometric detection results of the newly constructed artificial RNA degrading enzyme on the RNA repeat sequence dual-reporter system.

[0231] Figure 8. Abnormal RNA aggregates generated in the cell nucleus by fluorescent RNA-labeled RNA repeats. (A) Schematic diagram of fluorescent RNA-labeled RNA repeats; (B) Number of abnormal RNA aggregates generated in the cell nucleus by RNA repeats of different lengths; (C) Imaging results of RNA repeats of different lengths in cells; (D) The distribution of fluorescent RNA labeling CUG repeats is consistent with the distribution of fluorescent protein targeting CUG repeats.

[0232] Figure 9. Different systems for the elimination of RNA repeat sequence nuclear aggregation. (A) Regulation of RNA repeat sequence nuclear aggregation by a non-PUF system; (B) Regulation of RNA repeat sequence nuclear aggregation by different PUF systems; (C) Statistics of all systems that can regulate RNA repeat sequence aggregation in cells (n = 50).

[0233] Figure 10. Construction of an MBNL1-overexpressing cell line to detect the nuclear distribution of pathogenic RNA (A). Expression strategy for a PUF protein-based artificial RNA degrader expression vector and a fluorescent vector for pathogenic repeat RNA (B). Clearance of nuclear accumulation of RNA repeats by the artificial RNA degrader and alleviation of disease molecular phenotypes (C). (D) Systematic statistical results of the ability of artificial RNA degraders to regulate intracellular RNA repeat accumulation (n = 50).

[0234] Figure 11. Flow cytometry results for ARC-S artificial RNA degrading enzyme expression optimized using different DNA sequence optimization methods (A). Flow cytometry results for ARC-T artificial RNA degrading enzyme expression optimized using different DNA sequence optimization methods (B). RT-qPCR results for ARC-S and ARC-T artificial RNA degrading enzyme expression optimized using different DNA sequence optimization methods (C). Expression level detection results for ARC-S and ARC-T artificial RNA degrading enzyme expression optimized using different DNA sequence optimization methods (D).

[0235] Figure 12. Protein purification strategy for ARC-S and ARC-T artificial RNA degrading enzymes (A). Purity evaluation of protein purification products of ARC-S and ARC-T artificial RNA degrading enzymes (B). In vitro evaluation of the enzymatic activity of ARC-S and ARC-T artificial RNA degrading enzymes (C).

[0236] Figure 13. Strategy for constructing mouse models with dual reporter gene systems carrying CUG repeat sequences of different lengths.

[0237] Figure 14. Strategy for constructing mouse models with dual reporter gene systems carrying CAG repeat sequences of different lengths.

[0238] Figure 15. Imaging results of dual reporter gene mice constructed with different CUG repeat sequence lengths.

[0239] Figure 16. Comparison of existing systemic effects using a dual-reporter mouse model (A). Schematic diagram of the mouse experimental protocol. Control AAV particles were injected into the left leg, and experimental AAV particles were injected into the right leg. The experiment lasted for 2 months. RT-qPCR results of a reporter gene with a long CUG sequence (mCherry-160CUG) (B). (C) RT-qPCR results of a reporter gene with a short CUG sequence (EGFP-14CUG) (C).

[0240] Figure 17. Effects of different targeting systems on changes in normal gene expression in mouse muscle tissue targeting pathogenic RNA repeats (A). Schematic diagram of the experimental protocol for isolating mouse peripheral blood T cells (B). RT-qPCR results for changes in expression of CD4 and CD8 immune response marker genes (C).

[0241] Figure 18. Crystal structure of the PUF domain bound to target RNA (PDB ID 2YJY) (left). PUF binding to RNA (right). DETAILED DESCRIPTION

[0242] Through extensive and in-depth research, the inventors have developed for the first time a nucleic acid construct panel for screening drugs for treating diseases associated with long RNA repeats, as well as vectors and screening systems for these nucleic acid constructs. This nucleic acid construct panel, vectors, and screening system enable high-throughput screening or identification of drugs for treating diseases associated with long RNA repeats. The RNA repeat screening method developed by the present invention can rapidly and accurately identify potential drugs for treating diseases associated with RNA repeats. The screening method of the present invention combines technologies from multiple fields, including bioinformatics, to comprehensively analyze and evaluate the potential therapeutic potential of multiple drugs. This is the basis for the present invention.

[0243] long RNA repeats

[0244] As used herein, the terms "long RNA repeats" or "long RNA repeats" are used interchangeably to refer to long sequences with an abnormal number of RNA repeat units, which can trigger abnormal RNA metabolism in cells, leading to disease. These are caused by abnormal expansion of microsatellite sequences in the genome.

[0245] The correspondence between the types of diseases caused by long RNA repeat sequences and the long RNA repeat sequences is shown in Tables 1 and 2. (Reference: Depienne, C., & Mandel, J.-L. (2021). 30 years of repeat expansion disorders: What have we learned and what are the remaining challenges? The American Journal of Human Genetics, 108(5), 764–785.)

[0246] Table 1 List of disordered repeat expansion sequences (sorted by discovery year)

[0247] Disorders: BCCD (brachydactyly and cleidocranial dysplasia); BPES (blepharophimosis, ptosis, and epicanthus inversus); CCHS (congenital central hypoventilation syndrome); DRPLA (dentatorubral-pallidoluysian atrophy); EIEE1 (early infantile epileptic encephalopathy type 1); HD (Huntington disease); HDL2 (Huntington disease-like 2); HFGS (hand-foot-genital syndrome); HPE5 (holoprosencephaly type 5); MRGH (mental retardation with isolated growth hormone deficiency; oculopharyngeal muscular dystrophy (OPMD); spinal and bulbar muscular atrophy (SBMA); synpolydactyly type 1 (SPD1); spinocerebellar ataxia (SCA).

[0248] Genetic characteristics: AD, autosomal dominant, autosomal dominant; XLR, X-linked recessive, X-linked recessive.

[0249] Pathogenic mechanism: polyA(DN), polyAlanine tract associated with dominant-negative effect; polyA(LoF), polyAlanine tract leading to a loss of function of the protein; polyQ, polyGlutamine protein toxicity; polyG, polyGlycine peptide toxicity; RNA, RNA toxicity; RNA(foci), RNA foci toxicity.

[0250] Identification methods: cl, cloning; CGA, candidate gene analysis;

[0251] ExScr, expansion screening; L, linkage; RED, repeat expansion detection.

[0252] Table 2 List of non-coding repeat expansion disorder sequences (sorted by discovery year)

[0253] Disorders: Baratela-Scott syndrome (BSS); cerebellar ataxia, neuropathy and vestibular areflexia syndrome (CANVAS); myotonic dystrophy type 1 (DM1); myotonic dystrophy type 2 (DM2); progressive myoclonus epilepsy type 1 (Unverricht-Lundborg disease) (EPM1); familial adult myoclonic epilepsy (FAME); Fuchs endothelial corneal dystrophy type 3 (FECD3); fragile XE syndrome (FRAXE); and Friedreich's disease (FRDA). ataxia, hereditary cerebellar ataxia syndrome; FTD / ALS, frontotemporal dementia / amyotrophic lateral sclerosis; FXPOI, fragile X-associated premature ovarian infertility; FXS, fragile X syndrome; FXTAS, fragile X-associated tremor ataxia syndrome; GDPAG, global developmental delay, progressive ataxia, and elevated glutamine; NIID, neuronal intranuclear inclusion disease; OPDM1, oculopharyngodistal myopathy type 1; OPDM2, oculopharyngodistal myopathy type 2;OPML1, oculopharyngeal myopathy with leukoencephalopathy type 1; SCA, spinocerebellar ataxia; XDP, X-linked dystonia parkinsonism.

[0254] Genetic characteristics: AD, autosomal dominant, autosomal dominant; XL, X-linked, X chromosome linked; XLR, X-linked, recessive, X chromosome linked recessive; XLD, X-linked, dominant, X chromosome linked dominant.

[0255] Pathogenic mechanism: EGS, epigenetic gene silencing; Me / GS, gene silencing associated with hypermethylation; PS, protein sequestration; RNA, RNA toxicity; RNA (foci), RNA foci toxicity; RAN, repeat-associated non-AUG translation.

[0256] Identification methods: ADO, allele drop-out; cl, cloning; CGA, candidate gene analysis; exp, expression; ExScr, expansion screening; Fam, clinical analyses in fragile X-affected families; FS, fragile site; GWAS, genome-wide association study; K, karyotyping; L, linkage; LRS, long-read sequencing; RED, repeat expansion detection; WGS, whole-genome sequencing.

[0257] short RNA repeats

[0258] As used herein, the terms "short RNA repeat sequence" or "short RNA repeat sequence" are used interchangeably to refer to a short sequence with a normal number of RNA repeat units that does not cause abnormal RNA metabolism in cells.

[0259] gene-editing proteins

[0260] The present invention mainly focuses on CRISPR proteins. Currently, Cas13a, Cas13b, Cas13d, Cas13x, Cas13y, SpCas9 and SaCas9 have been discovered and proven to be active.

[0261] PUF protein

[0262] The Drosophila melanogaster (Pumilio) and Caenorhabditis elegans (fem-3) mRNA-binding factors (PUFs) are sequence-specific RNA-binding proteins that recognize mRNA targets using intraprotein repeats. Typical PUF proteins possess a C-terminal RNA-binding domain (also known as the PUF domain), which contains eight tandem repeats, along with N- and C-terminal regions. The eight PUF repeats are arranged in an arched pattern, each consisting of three α-helices. RNA binds to the concave surface of the PUF domain in an antiparallel manner, with each base being specifically recognized by a repeat. The second α-helix of each repeat contains a conserved RNA recognition code consisting of five amino acid residues, designated "12XX5" (where X represents a random residue). Residues 1 and 5 interact directly with RNA bases through polar interactions, while residue 2 stacks with the bases. The stacking residues within each PUF repeat play a crucial role in binding affinity, while two polar or charged residues determine the specificity of the PUF repeat. Consequently, natural PUF proteins possess a set of specific recognition codes: cysteine ​​and glutamine bind to adenine, asparagine and glutamine bind to uracil, and serine and glutamate bind to guanine. In 2011, two independent research groups successfully deciphered the missing cytosine recognition code (serine and arginine bind to cytosine) within the PUF recognition code using the yeast three-hybrid system. This allows PUF proteins to recognize any 8-nt RNA by altering their RNA recognition code, as shown in Figure 18.

[0263] The unique structure and relatively short length of the PUF domain make it an ideal RNA-binding scaffold for artificial proteins regulating RNA processing. Several artificial PUF regulators with different functional domains have been successfully developed and applied in various fields. Existing artificial PUFs are being used in biomedical research and novel therapies for RNA-related diseases. Despite the success of early applications, the use of customized PUF domains as programmable RNA-binding scaffolds faces several limitations. One major limitation is that natural PUF proteins recognize 8-nt RNA sequences. However, in some cases, PUF proteins may need to recognize target sequences of varying lengths. For example, when binding to a long RNA sequence across the entire transcriptome, PUFs with more repeats will minimize off-target effects. Conversely, shorter recognition sites are more practical for some in vitro applications, allowing for binding to RNA substrates at multiple sites. Recent studies on PUF structures of varying lengths have shown that PUFs with 9-10 repeats achieve maximum RNA recognition. While increasing or decreasing the number of repeats still binds to their target sequence, the affinity decreases.

[0264] Screening system and method of the present invention

[0265] The present invention is the first to construct a system for screening drugs for treating diseases associated with long RNA repeat sequences, the system comprising:

[0266] (a) drugs to be screened;

[0267] (b) the nucleic acid construct set according to the first aspect of the present invention;

[0268] Among them, when the expression level or intensity of the first detectable marker is significantly reduced and the expression level or intensity of the second detectable marker changes slightly or remains basically unchanged, it indicates that the drug to be screened is a drug for treating long RNA repeat sequence-related diseases.

[0269] The system of the present invention is mainly composed of plasmids that can express RNA with two different repeat sequence lengths at the same time and with the same intensity.

[0270] To facilitate screening, two RNAs with different repeat lengths can be linked to different reporter genes, including but not limited to various fluorescent proteins, luciferases, and other reporter genes that can be used to characterize gene expression levels.

[0271] The reporter gene system or screening system reported in the present invention can be used through a variety of detection methods, including but not limited to real-time fluorescence quantitative PCR, RNA-seq, fluorescence microscopy, microplate reader, protein immunoblotting (Western blotting), RNA immunoblotting (Northern blotting), flow cytometry (Flow cytometry), etc., to simultaneously detect the clearance of two different lengths of RNA by different drug molecules.

[0272] The system of the present invention can be used to characterize the clearance effects of different tools on long repeat sequences at the mammalian cell level, and the clearance of short repeat sequences by each system can also be observed simultaneously.

[0273] The system of the present invention can be used at the model animal (zebrafish, mouse) level to characterize the clearance effects of different tools on long repetitive sequences, and can also simultaneously observe the clearance of short repetitive sequences by each system.

[0274] Furthermore, according to the present invention, RNAs with two different repeat sequence lengths can be expressed simultaneously with the same intensity (or similar intensity), facilitating subsequent detection and evaluation.

[0275] According to the present invention, the expression methods that can be used include bicistronic expression or dual gene reverse expression, using the same (or similar expression strength) eukaryotic promoter, including but not limited to the commonly used CMV promoter, CAG promoter, PGK promoter, EF-1α promoter, SV40 promoter and other alternative promoters.

[0276] According to the present invention, the two RNAs expressed simultaneously contain two RNA repeat sequences of different lengths, one of which is a normal-length RNA with a shorter RNA repeat sequence, and the other is an abnormal-length RNA with a longer RNA repeat sequence.

[0277] The present invention has developed a reporter system for screening drugs targeting long RNA repeats. This method, based on the present invention's RNA repeat screening method, can rapidly and accurately identify potential drugs for treating diseases associated with RNA repeats. This screening method, incorporating technologies from multiple fields, including bioinformatics, can comprehensively analyze and evaluate the potential therapeutic potential of multiple drugs.

[0278] The development of this reporter system will further our understanding of the pathophysiological mechanisms of long RNA repeat-related diseases and promote the development and advancement of treatments for these diseases. Furthermore, this reporter system will have broad application prospects for drug screening against RNA repeat-related diseases across the research landscape, bringing more opportunities and possibilities for the treatment of RNA-related diseases. Further research into the molecular mechanisms and clinical manifestations of RNA repeat-related diseases will provide opportunities for the design and discovery of more innovative and effective drugs for these diseases.

[0279] The present invention also establishes a system that can simultaneously and equally express RNA with two different repeat lengths. This system closely mimics the in vivo situation where alleles express with similar intensities but with different repeat lengths, making it ideal for drug screening against such diseases.

[0280] The main advantages of the present invention include:

[0281] (1) A nucleic acid construct panel for screening drugs for treating long RNA repeat-associated diseases, as well as a vector and screening system for the nucleic acid construct panel, have been developed for the first time. Using this nucleic acid construct panel, vector, and screening system, high-throughput screening or identification of drugs for treating long RNA repeat-associated diseases is possible.

[0282] (2) The screening method developed by the present invention for RNA repeat sequences can quickly and accurately screen for potential drugs for treating diseases associated with RNA repeat sequences. The screening method of the present invention combines technologies from multiple fields, such as bioinformatics, and can comprehensively analyze and evaluate the potential therapeutic potential of multiple drugs. This invention was completed on this basis.

[0283] (3) The system of the present invention can be used to characterize or screen drugs targeting long repeat sequences while also characterizing their effects on short repeat sequences. Furthermore, because the same promoter elements are used, the expression intensities of the two RNA lengths are similar, similar to the situation in humans where long repeat sequences cause diseases.

[0284] (4) Currently, there is no commercially available similar system. Currently used systems generally only focus on characterizing the effects of long repeat sequences, while ignoring the characterization of short repeat sequences.

[0285] (5) The system of the present invention can also be used in cells and model animals (zebrafish, mice).

[0286] (6) The system of the present invention can be used to screen for drugs for treating diseases associated with long RNA repeat sequences, such as artificial RNA degrading enzymes having the specific structure of Formula IV or IV' of the present invention.

[0287] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are intended to illustrate the present invention only and are not intended to limit the scope of the present invention. The experimental methods in the following examples, for which specific conditions are not specified, are generally performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. Unless otherwise stated, percentages and parts are by weight.

[0288] Unless otherwise specified, the materials and reagents in the examples are all commercially available products.

[0289] Example 1. Construction of a reporter plasmid containing CTG repeat sequences.

[0290] First, DNA fragments expressing mCherry and EGFP were amplified by PCR and linearized in the pcDNA5-FRT / TO plasmid (purchased from Thermo Fisher). The mCherry fragment and the linearized vector pcDNA5-FRT / TO were cyclized by homologous recombination using Gibson Assembly Master Mix (purchased from New England Biolabs). The cyclized product was transformed into DH5a competent cells (purchased from Beijing Quanshijin Biotechnology) and cultured according to the manufacturer's instructions. The resulting plasmids were confirmed to be pcDNA5-FRT / TO-mCherry and pcDNA5-FRT / TO-EGFP by Sanger sequencing.

[0291] The synthesized (CTG) 14 The DNA fragment (purchased from Genewiz) was inserted into the pre-constructed pcDNA5-FRT / TO-mCherry by PCR, specifically at the C-terminus of the mCherry gene, thereby obtaining a protein that can express mCherry-(CTG) 14 Plasmid pcDNA5-FRT / TO-mCherry-(CTG) 14 .

[0292] The restriction enzyme SapI cleavage site was inserted into the pre-constructed pcDNA5-FRT / TO-EGFP by PCR, specifically at the C-terminus of the EGFP gene, thereby obtaining pcDNA5-FRT / TO-EGFP-IN.

[0293] The gene synthesized (CTG) 50The DNA fragment was digested with EarI and ligated into the pcDNA5-FRT / TO-EGFP-IN vector digested with SapI to obtain pcDNA5-FRT / TO-EGFP-(CTG) 50 (denoted as 50CUG). Then repeat the enzyme digestion and ligation process to obtain pcDNA5-FRT / TO-EGFP-(CTG) 100 (denoted as 100CUG), pcDNA5-FRT / TO-EGFP-(CTG) 150 (denoted as 150CUG) and pcDNA5-FRT / TO-EGFP-(CTG) 200 (denoted as 200CUG). During the construction process, since the CTG repeat sequence will condense during the culture of E. coli, pcDNA5-FRT / TO-EGFP-(CTG) was also obtained. 130 (denoted as 130CUG) plasmid.

[0294] Place pcDNA5-FRT / TO-mCherry-(CTG) 14 Single restriction sites NotI and KpnI were introduced into the plasmid by PCR to obtain a vector. DNA fragments carrying EGFP and CUG of different lengths were obtained by digesting the plasmids with NotI and KpnI, such as 50CUG, 100CUG, 130CUG, 150CUG, and 200CUG. After homologous recombination, vectors were obtained that could simultaneously express two different CUG repeat sequence lengths with the same intensity. This vector produced two different fluorescent proteins that were used to indicate the amount of RNA expression (Figure 1A).

[0295] Example 2. Construction of a reporter plasmid containing CCTG repeat sequences

[0296] The synthesized (CCTG)8 DNA fragment was inserted into the pre-constructed pcDNA5-FRT / TO-mCherry by PCR, specifically at the C-terminus of the mCherry gene, thereby obtaining pcDNA5-FRT / TO-mCherry-(CCTG)8.

[0297] The restriction enzyme BbsI cleavage site was inserted into the pre-constructed pcDNA5-FRT / TO-EGFP by PCR, specifically at the C-terminus of the EGFP gene, thereby obtaining pcDNA5-FRT / TO-EGFP-IN.

[0298] Gene synthesis (CCTG) 50The DNA fragment was digested with BbsI and Esp3I and ligated into the BbsI-digested pcDNA5-FRT / TO-EGFP-IN vector to obtain pcDNA5-FRT / TO-EGFP-(CCTG) 50 (Recorded as 50CCUG). Then repeat the enzyme digestion and ligation process to obtain pcDNA5-FRT / TO-EGFP-(CCTG) 100 (denoted as 100CCUG), pcDNA5-FRT / TO-EGFP-(CCTG) 150 (denoted as 150CCUG) and pcDNA5-FRT / TO-EGFP-(CCTG) 200 (denoted as 200CCUG). Similarly, CCTG repeat sequences undergo condensation during the culture of E. coli, and pcDNA5-FRT / TO-EGFP-(CCTG) was obtained. 170 (denoted as 170CCUG) plasmid.

[0299] The NotI and KpnI restriction sites of the pcDNA5-FRT / TO-mCherry-(CCTG)8 plasmid were introduced by PCR to obtain a vector. DNA fragments carrying EGFP and CCUG of varying lengths were obtained by digesting the 50CCUG, 100CCUG, 150CCUG, and 200CCUG plasmids with NotI and KpnI. Homologous recombination reactions yielded vectors capable of simultaneously and with equal intensity expressing two different CCUG repeat sequence lengths. This vector produced two different fluorescent proteins, which were used to indicate RNA expression levels (Figure 1B).

[0300] Example 3. Construction of a reporter plasmid containing CAG repeat sequences

[0301] The synthesized (CAG) 23 The DNA fragment was inserted into the pre-constructed pcDNA5-FRT / TO-mCherry by PCR, specifically at the C-terminus of the mCherry gene, to obtain pcDNA5-FRT / TO-mCherry-(CAG) 23 .

[0302] The restriction enzyme BbsI cleavage site was inserted into the pre-constructed pcDNA5-FRT / TO-EGFP by PCR, specifically at the C-terminus of the EGFP gene, thereby obtaining pcDNA5-FRT / TO-EGFP-IN.

[0303] The gene synthesized (CAG) 50The DNA fragment was digested with BbsI and Esp3I and ligated into the BbsI-digested pcDNA5-FRT / TO-EGFP-IN vector to obtain pcDNA5-FRT / TO-EGFP-(CAG) 50 (denoted as 50CAG). Then repeat the enzyme digestion and ligation process to obtain pcDNA5-FRT / TO-EGFP-(CAG) 100 (denoted as 100CAG), pcDNA5-FRT / TO-EGFP-(CAG) 150 (denoted as 150CAG) and pcDNA5-FRT / TO-EGFP-(CAG) 200 (denoted as 200CAG).

[0304] Place pcDNA5-FRT / TO-mCherry-(CAG) 23 Single restriction sites NotI and KpnI were introduced into the plasmid by PCR to obtain a vector. DNA fragments carrying EGFP and CAG of different lengths were obtained by digesting the plasmids with NotI and KpnI at residues 50CAG, 100CAG, 150CAG, and 200CAG. After homologous recombination, vectors capable of simultaneously and with equal intensity expressing two different CAG repeat sequence lengths were obtained. This vector produced two different fluorescent proteins that were used as an indicator of RNA expression (Figure 1C).

[0305] Example 4. Construction of a reporter plasmid containing TGGAA repeat sequences

[0306] The synthesized (TGGAA)3 DNA fragment was inserted into the pre-constructed pcDNA5-FRT / TO-mCherry by PCR, specifically at the C-terminus of the mCherry gene, thereby obtaining pcDNA5-FRT / TO-mCherry-(TGGAA)3.

[0307] The restriction enzyme BbsI cleavage site was inserted into the pre-constructed pcDNA5-FRT / TO-EGFP by PCR, specifically at the C-terminus of the EGFP gene, thereby obtaining pcDNA5-FRT / TO-EGFP-IN.

[0308] The gene synthesized (TGGAA) 50 The DNA fragment was digested with BbsI and Esp3I and ligated into the BbsI-digested pcDNA5-FRT / TO-EGFP-IN vector to obtain pcDNA5-FRT / TO-EGFP-(TGGAA) 50(Note: 50TGGAA). Then repeat the enzyme digestion and ligation process to obtain pcDNA5-FRT / TO-EGFP-(TGGAA) 100 (denoted as 100TGGAA).

[0309] The pcDNA5-FRT / TO-mCherry-(TGGAA)3 plasmid was PCR-introduced with the NotI and KpnI single restriction sites to obtain a vector. Plasmids containing 50TGGAA and 100TGGAA were digested with NotI and KpnI to obtain DNA fragments carrying EGFP and TGGAA of varying lengths. Homologous recombination reactions yielded vectors capable of simultaneously and with equal intensity expressing two different TGGAA repeat sequence lengths. This vector produced two different fluorescent proteins that were used to indicate RNA expression levels (Figure 1D).

[0310] Example 5. Construction of a cell line stably expressing a reporter plasmid

[0311] The plasmids containing different CTG / CCTG / CAG / TGGAA repeat lengths obtained above were co-transfected with plasmid pOG44 (purchased from Thermo Fisher) at a ratio of 1:9 into Flp-In T-Rex 293 cells (purchased from Thermo Fisher). Forty-eight hours after transfection, the cells were washed and plated into fresh medium (<25% cell density) and cultured overnight at 37°C in 5% carbon dioxide. Subsequently, the cells were cultured every three days with fresh medium containing 100 μg / mL Hygromycin (purchased from Thermo Fisher) until resistant single-cell colonies appeared. Three to four individual colonies were selected for further use. The correctness of the inserted sequence was verified by Sanger sequencing.

[0312] Cell lines stably expressing reporter plasmids can be induced by adding doxycycline (purchased from Sigma-Aldrich) or tetracycline at a final concentration of 1 μg / mL. Cellular expression of the reporter system can be monitored using fluorescence microscopy, flow cytometry, or other assays. Figure 2 shows the results of inducible expression of a dual reporter gene system containing CUG repeats in Flp-In T-REX 293 cells. Figure 2A shows that without the addition of inducer, neither fluorescent reporter gene is expressed; however, after induction with 1 μg / mL doxycycline (Figure 2B), both fluorescent proteins show high expression. Figure 2C shows the results of fluorescence microscopy. The results in Figure 2 demonstrate that stably transfected cell lines carrying reporter genes with different RNA repeat lengths can stably express both different reporter genes and the RNA repeat sequences they carry.

[0313] Example 6. Comparison of existing methods for regulating RNA repeat sequences at the cellular level

[0314] The plasmid of the Cas13d system that can express the CUG repeat sequence targeting (purchased from addgene), the PIN-RCas9 system plasmid (purchased from addgene), the ASRE (CUG) plasmid (self-owned), the shRNA (CUG) plasmid (purchased from addgene), the antisense nucleotide (ASO) (purchased from Jima Gene) and the control plasmid empty vector pcDNA3.1 (purchased from Thermo Fisher) and the 150CUG plasmid of the present invention were transfected with Lipofectamine 3000 (purchased from Thermo Fisher) at a ratio of 1:10 and transfected into HEK 293T cells (purchased from ATCC). For specific steps, refer to the instructions of Lipofectamine 3000. After 48 hours of transfection, the adherent cells were digested with trypsin, centrifuged at 800g to collect the cells, and then washed with PBS solution (see Figure 3 for the experimental design and process).

[0315] The cells were then divided into three equal parts. The first part of the cells was used to detect the fluorescence levels of EGFP and mCherry by flow cytometry (see Figure 4). Figure 4 shows that using the screening and comparison system provided by the present invention, it can be found that among the currently available regulation methods, only the PIN-RCas9 system can achieve a significant reduction in the long RNA repeat sequence EGFP-130CUG, as manifested by a decrease in the level of EGFP protein expressed.

[0316] The second part of the cells was centrifuged again, lysed with RIPA solution (purchased from Thermo Fisher) and added with 2xLaemmli Sample Buffer (purchased from Biorad), heated to 99°C for 10 minutes, and then used for protein immunoblotting identification.

[0317] The third part of the cells was lysed with TRIzol Reagent (purchased from Thermo Fisher), and the total RNA of the cells was extracted according to the instructions. The extracted total RNA was reverse transcribed using TAKARA's PrimeScript RT Reagent Kit with gDNA Eraser or a reverse transcription kit from another company. Subsequently, 2X Universal SYBR Green Fast qPCR Mix reagent (purchased from Wuhan ABclonal) was used for quantitative PCR detection to compare the clearance effect and off-target effect of the regulatory methods used (see Figure 5 for the test results). Figure 5 shows that among all the methods involved in the comparison, only shCUG and PIN-RCas9 (CUG) achieved clearance of the target long RNA repeat sequence, but the selectivity of shCUG was poor.

[0318] The primer sequences used for quantitative PCR were as follows: EGFP-F1: 5'-AGTGCTTCAGCCGCTACCC-3'; EGFP-R1: 5'-GTTGTACTCCAGCTTGTGCC-3'; mCherry-F1: 5'-CTTCAAGTGGGAGCGCGTG-3'; mCherry-R1: 5'-CAGCCTCTGCTTGATCTCGCC-3'; GAPDH-F: 5'-TTGCCATCAATGACCCCTTCA-3'; GAPDH-R: 5'-CGCCCCACTTGATTTTGGA-3'.

[0319] Example 7. Construction and detection of new artificial RNA enzymes

[0320] The plasmid expressing ASRE(CUG) was linearized by PCR using the following primer sequences: PUF-R: 5'-CTGAGAGCCGTTGCCGGTGTCGACCCCTAAGTCAACACCGTTC-3'; CDNA-F: 5'-GCTAGCGTTTAAACTTAAGCTTGGTACC-3'. The artificial RNase portion of ASRE(CUG) was constructed using the NLS-PUF(CUG)-Linker-PIN construct.

[0321] The full-length DNA or active partial DNA fragments of the following RNases or RNA helicases were amplified from the cDNA of HEK 293T by PCR amplification: including but not limited to ANG (UNIPROT: P03950), RNASEL (UNIPROT: Q05823), RRP44 (UNIPROT: Q9Y2L1), RNASE1 (UNIPROT: P07998), RNASET2 (UNIPROT: O00584), SUPV3L1 (UNIPROT: Q8IYB8), PNPT1 (UNIPROT: Q8TCS8), REXO2 (UNIPROT: Q9Y3B8), MRPL44 (UNIPROT: Q9H9J2), LACTB2 (UNIPROT: Q53H82), TSEN15 (UNIPROT: Q8WW01), and ZC3H12A (UNIPROT: Q5D1E8). The amplified fragments all contained DNA bases (>20 bp) that could complement the linearized ASRE (CUG) plasmid. These DNA fragments were circularly ligated with the linearized ASRE (CUG) plasmid vector using Gibson Assembly Master Mix (purchased from New England Biolabs), thereby replacing the original artificial RNA enzymes PUF-ANG, PUF-ANG-S, PUF-RNASEL, PUF-SUPV3L1, PUF-SUPV3L1 FL, PUF-RNASET2, PUF-RRP44, PUF-RNASE1, PUF-PNPT1, PUF-REXO2, PUF-MRPL44, PUF-LACTB2, PUF-TSEN15, and PUF-ZC3H12A. Similarly, PCR and homologous recombination methods can also be used to construct ANG-PUF, ANG-S-PUF, SUPV3L1-PUF, SUPV3L1 FL-PUF, RNASET2-PUF, RNASE1-PUF, PNPT1-PUF, REXO2-PUF and ZC3H12A-PUF (the structure of the resulting new artificial RNA enzyme element is shown in Figure 6A, which is only a schematic diagram).

[0322] 1 μg of the new artificial RNA enzyme plasmid and 0.1 μg of the reporter plasmid pcDNA5-EGFP-CTG130-mCherry-CTG14 were co-transfected into HEK 293T cells (cell density was approximately 80%) according to the instructions of Lipofectamine 3000 (purchased from Thermo Fisher), and the transfected cells were collected 48 hours after transfection. The resulting cells were lysed with TRIzol Reagent (purchased from Thermo Fisher), and the total RNA of the cells was extracted according to the instructions. The extracted total RNA was reverse transcribed using PrimeScript RT Reagent Kit with gDNA Eraser (purchased from TAKARA) or a reverse transcription kit from other companies. Subsequently, quantitative PCR detection was performed using 2X Universal SYBR Green Fast qPCR Mix reagent (purchased from Wuhan Aibotek ABclonal) (test results are shown in Figure 6B). From the detection results in Figure 6B, it can be seen that PUF-RNASE1, PUF-SUPV3L1 (ARC-S), PUF-SUPV3L1 FL, PUF-RNASET2, PUF-PNPT1, PUF-REXO2, RNASE1-PUF, PNPT1-PUF and REXO2-PUF, SUPV3L1-PUF, SUPV3L1 FL-PUF, RNASET2-PUF (ARC-T) (ARC, Artificial RNA Cleaver, artificial RNA enzyme) showed good selectivity for two different lengths of CTG repeat sequences, and had a good effect on reducing long CUG repeat sequences.

[0323] Subsequently, we transfected HEK 293T cells (purchased from ATCC) with the ARC-S and ARC-T plasmids described herein at a 1:10 ratio using Lipofectamine 3000 (purchased from Thermo Fisher). Specific steps were described in the Lipofectamine 3000 instructions. 48 hours after transfection, adherent cells were trypsinized, centrifuged at 800g, and washed with PBS. (See Figure 3 for the experimental design and process.)

[0324] The cells were then used to detect the fluorescence levels of EGFP and mCherry using a flow cytometer (results shown in Figure 7). Figure 7 shows that using the screening and comparison system provided by the present invention, it can be found that the new artificial RNA enzymes ARC-S and ARC-T we constructed achieved a significant reduction in the long RNA repeat sequence EGFP-130CUG, which was manifested as a decrease in the level of EGFP protein expressed by it, but had no obvious effect on mCherry-14CUG containing a short repeat sequence.

[0325] Example 9

[0326] Based on literature reports demonstrating fluorescent RNA imaging, a DNA sequence containing a fluorescent RNA fragment (4Pepper, obtained from East China University of Science and Technology) was ligated into plasmids DT12 (purchased from Addgene, Cat#80416) and DT960 (purchased from Addgene, Cat#80412) via PCR digestion and restriction ligation. The insertion position was before the DMPK exon 12 and after the CMV promoter. This resulted in plasmids DT12-4Pepper and DT960-4Pepper (Figure 8A).

[0327] DT12-4Pepper and DT960-4Pepper were co-transfected with NLS-PUF-BFP-CUG plasmid (constructed with reference to the construction method of Example 1) using Lipofectamine 3000 (purchased from Thermo Fisher) and transfected into HEK 293T cells (purchased from ATCC). The steps refer to the instructions of Lipofectamine 3000. 48 hours after transfection, the cells were imaged with a fluorescence confocal microscope, and the number of RNA aggregates in the cell nucleus was counted and detected (Figure 8B) (n=50). The statistical results of Figure 8B show that DT960-4Pepper can form more RNA aggregates in the cell nucleus (consistent with reports in the literature), while DT12-4Pepper can only form a small amount or no RNA aggregates. At the same time, by quantitatively analyzing the distribution of fluorescent RNA labeled CUG repeat sequences and the distribution of fluorescent protein NLS-PUF-BFP targeting CUG repeat sequences (Figure 8C), it was found that the distribution of the two was positively correlated (Figure 8D).

[0328] Example 10. Clearance of RNA repetitive sequence nuclear aggregation by different systems

[0329] The existing different systems for RNA repeat sequences (plasmids were all labeled with BFP for imaging detection) were co-transfected with DT960-4Pepper using Lipofectamine 3000 (purchased from Thermo Fisher) and transfected into HEK 293T cells (purchased from ATCC). The steps refer to the instructions of Lipofectamine 3000. After 48 hours of transfection, the cells were imaged using a fluorescence confocal microscope to detect the number of RNA aggregates in the cell nucleus. In the imaging results, the dye SYTO 9 was used to distinguish between the cytoplasm and the nucleus (FITC channel, green), the blue fluorescent protein BFP labeled by different system plasmids was used to characterize the cells with successful transfection system, and the TRITC channel was used to select cells successfully transfected with DT960-4Ppepper (orange). Cells expressing BFP and DT960-4Ppepper at the same time were used to count the number of RNA aggregates in the cell nucleus.

[0330] Imaging results showed that among non-PUF protein-related regulatory systems, the PIN-RCas9 system had the best clearance ability (Figure 9A) (n=50). Among PUF protein-related regulatory systems, the ARC-T constructed in this application had the best clearance ability (Figure 9B) (n=50). Among all system comparisons, the PIN-RCas9 system and ARC-T had similar clearance effects (Figure 9C).

[0331] Example 11. New artificial RNA enzyme lesion clearance and molecular phenotype relief

[0332] HEK 293T cells (purchased from ATCC) were used to construct a cell line stably overexpressing MBNL1. The gene-synthesized MBNL1 sequence (Uniprot: Q9NR56Q) was constructed on the lentiviral expression vector pcDH-Ecmv-Puro (purchased from addgene) to obtain the target expression plasmid, and then the envelope plasmid (pMD2G), packing Plasmid (pSPAX) (purchased from addgene) and the target plasmid were transfected into the cells at a ratio of 1:3:4. The steps were referred to the instructions of Lipofectamine 3000. After 48 hours of transfection, the viral supernatant was harvested for use. The packaged viral supernatant can infect HEK 293T cells. After 48 hours of infection, Puromycin (Gibco) at a concentration of 5 μg / ml needs to be added to screen cells successfully infected with the virus, and finally a cell line stably overexpressing MBNL1 is obtained (Figure 10A).

[0333] The existing new artificial RNA enzymes (all plasmids were labeled with BFP for imaging detection) were co-transfected with DT960-4Pepper using Lipofectamine 3000 (purchased from Thermo Fisher) and transfected into the above-mentioned MBNL1 overexpressing cell line (Figure 10B). The steps were referred to the instructions for Lipofectamine 3000. 48 hours after transfection, cells were imaged using fluorescence confocal microscopy to detect the number of RNA aggregates in the cell nucleus and observe the nuclear distribution of MBNL1. In the imaging results, the dye SYTO 9 (purchased from Thermo Fisher) was used to distinguish between the cytoplasm and the cell nucleus (FITC channel, green). The blue fluorescent protein BFP labeled with different system plasmids was used to characterize cells with successful transfection. The TRITC channel was used to select cells successfully transfected with DT960-4Ppepper (red). The snap tag was used to indicate the distribution of MBNL1 protein in the cell nucleus (purple). Cells expressing both BFP and DT960-4Ppepper were used to count the number of RNA aggregates in the cell nucleus.

[0334] Imaging results showed that compared with the control group (Mock), the newly constructed artificial RNA enzymes ARC-S and ARC-T not only efficiently eliminated pathogenic RNA aggregates (Figure 10C), but also significantly improved the mislocalization of MBNL1 in the nucleus, changing its abnormal punctate aggregation to a diffuse and uniform distribution in the nucleus. In statistical results, the artificial enzyme system significantly reduced the number of pathogenic RNA aggregates (n = 50) (Figure 10D).

[0335] Example 12. Enhanced Efficacy of New Artificial RNA Enzymes After Sequence Optimization

[0336] The new artificial RNA enzyme sequence constructed in this application is optimized, and the sequence design method is the sequence optimization algorithm publicly published by GENEWIZ, GenScript, and Thermo, which can enhance the expression level and efficacy of the artificial enzyme.

[0337] The sequence-optimized new artificial RNase was constructed on the same expression vector, pcDNA5 (purchased from Thermo Fisher), and transfected with the 150CUG plasmid described herein at a 1:10 ratio using Lipofectamine 3000 (purchased from Thermo Fisher) into HEK 293T cells (purchased from ATCC). Specific steps were followed, as described in the Lipofectamine 3000 instructions. 48 hours after transfection, adherent cells were trypsinized, centrifuged at 800g, and washed with PBS. The experimental design and procedures were similar to those described above.

[0338] The cells were then divided into three parts, and the first part of the cells was used to detect the fluorescence levels of EGFP and mCherry by flow cytometry (see Figures 11A and 11B for the results). The results showed that the sequence-optimized artificial RNA enzymes retained the pathogenic RNA targeted clearance ability possessed by the present invention. Both ARC-S and ARC-T artificial RNA enzymes significantly reduced the expression of the long RNA repeat sequence EGFP-130CUG, and the level of EGFP protein expressed by them decreased.

[0339] In the second part, the cells were collected by centrifugation again, lysed with RIPA solution (purchased from Thermo Fisher) and added with 2xLaemmli Sample Buffer (purchased from Biorad), heated to 99°C for 10 minutes, and then used for protein immunoblotting identification (Figure 11D). The results showed that the design of different sequence optimizations would affect the expression levels of the two artificial RNA enzymes of this application. The sequence optimized by the GENEWIZ algorithm had higher protein expression levels than the original sequence and other sequence optimization methods.

[0340] The third part of the cells was lysed with TRIzol Reagent (purchased from Thermo Fisher), and the total RNA of the cells was extracted according to the instructions. The extracted total RNA was reverse transcribed using TAKARA's PrimeScript RT Reagent Kit with gDNA Eraser or a reverse transcription kit from another company. Subsequently, 2X Universal SYBR Green Fast qPCR Mix reagent (purchased from Wuhan Aiboteike (ABclonal)) was used for quantitative PCR detection to compare the clearance effect and off-target effect of the regulatory method used (see Figure 11C for the test results). The results showed that in all sequence optimization methods, enhancing the expression of artificial RNA enzymes would increase the ability to clear pathogenic RNA.

[0341] The primer sequences used for quantitative PCR were as follows: EGFP-F1: 5'-AGTGCTTCAGCCGCTACCC-3'; EGFP-R1: 5'-GTTGTACTCCAGCTTGTGCC-3'; mCherry-F1: 5'-CTTCAAGTGGGAGCGCGTG-3'; mCherry-R1: 5'-CAGCCTCTGCTTGATCTCGCC-3'; GAPDH-F: 5'-TTGCCATCAATGACCCCTTCA-3'; GAPDH-R: 5'-CGCCCCACTTGATTTTGGA-3'.

[0342] Example 13. The purified new artificial RNA enzyme also exerts pathogenic RNA clearance activity under in vitro conditions

[0343] The effectiveness of the invention can be more effectively supported by expressing and purifying the protein of the new artificial RNA enzyme in vitro. The four protein expression sequences of PUF, GFP, ARC-S and ARC-T were constructed on the pET28a (purchased from addgene) prokaryotic expression vector, and the protein expression in vitro was prepared by bacterial culture. The bacterial lysate was separated and purified by a two-step method using His-tag and Strep-Tactin filler columns (purchased from Thermo) to obtain a high-purity protein product. For specific steps, refer to the instructions (Figure 12A). The protein purified in vitro was identified for protein purity by SDS-PAGE. The results showed that the four purified protein bands were of the correct size and single band (Figure 12B).

[0344] The sequences in the aforementioned dual fluorescent vector were transcribed in vitro to generate mRNA, which can obtain high-purity long and short CUG repeat sequence RNA. Gluc mRNA was purchased from Jinan Protein Biology Company, tRNA was purchased from Thermo Fisher Scientific, and the in vitro transcription was performed using MAXIscript. TM SP6 transcription kit (Thermo), refer to the instructions for specific steps. The RNA mixture was incubated with 5 μM of PUF, GFP, ARC-S, and ARC-T proteins at 37°C for 60 min. Electrophoresis results showed that PUF and GFP proteins had little effect on the degradation of the RNA mixture. ARC-S and ARC-T could significantly degrade mRNA with CUG repeat sequences, but had little effect on RNA without CUGs. ARC-T also had a stronger RNA degradation ability than ARC-S (Figure 12C).

[0345] Example 14. Construction of a mouse strain capable of stably expressing a reporter plasmid

[0346] A mouse strain (denoted as mouse-CUG-R160G14) that can stably express the reporter plasmid was constructed by a contract research organization (CRO) (purchased from Saiye Bio). Specifically, it can simultaneously express EGFP-(CUG) 14 with mCherry-(CUG) 160 The DNA fragment of the RNA sequence was inserted into the intron 1 position of the ROSA26 gene (NCBI Reference Sequence: NR_027008.1) on the mouse genome (see Figure 13 for the construction strategy).

[0347] A mouse strain (denoted as mouse-CAG-G155R23) that can stably express the reporter plasmid was constructed by a contract research organization (CRO) (purchased from Saiye Bio). Specifically, it can simultaneously express EGFP-(CAG) 155 with mCherry-(CAG) 23 The DNA fragment of the RNA sequence was inserted into the intron 1 position of the ROSA26 gene (NCBI Reference Sequence: NR_027008.1) on the mouse genome (see Figure 14 for the construction strategy).

[0348] The transgenic mouse mouse-CUG-R160G14 can simultaneously express EGFP-(CUG) 14 with mCherry-(CUG) 160 RNA sequences, resulting in two different fluorescence patterns (Figure 15). This property can be used to rapidly screen and evaluate the efficacy of drugs specific to CUG repeat sequences.

[0349] Example 15. Comparison of existing methods for regulating RNA repeat sequences at the in vivo level

[0350] AAV virus particles expressing the Cas13d system targeting CUG repeat sequences (purchased from Heyuan Biotechnology), AAV virus particles of the PIN-RCas9 system plasmid (purchased from Heyuan Biotechnology), AAV virus particles of PUF-PIN (purchased from Heyuan Biotechnology), AAV virus particles of ARC-S (purchased from Heyuan Biotechnology), and AAV virus particles of ARC-T (purchased from Heyuan Biotechnology) were added at 10 11 vg total amount was injected into the thigh skeletal muscle (right leg) of mouse-CUG-R160G14 mice (purchased from Saiye Bio), and at the same time, the respective control AAV virus particles (purchased from Heyuan Bio) were injected into the left leg of the same mouse with the same total injection amount (Figure 16A).

[0351] Two months after the injection, the leg muscles of the injected part were removed and total RNA was extracted using TRIzol Reagent (purchased from Thermo Fisher), and the specific operation steps were carried out according to the instructions. The extracted total RNA was reverse transcribed using TAKARA's PrimeScript RT Reagent Kit with gDNA Eraser or other companies' reverse transcription kits. Subsequently, 2X Universal SYBR Green Fast qPCR Mix reagent (purchased from Wuhan Aibotek ABclonal) was used for quantitative PCR detection to compare the clearance effect and off-target effect (Figure 16B and Figure 16C) of the regulatory method used. As can be seen from Figure 16B, ARC-T viral particles have the best clearance effect on mCherry-160CUG with long RNA repeats, followed by Cas13d-CUG, ARC-S, PUF-PIN-CUG and PIN-RCas9-CUG. As can be seen from Figure 16C, Cas13d-CUG virus particles have the greatest off-target clearance effect (about 50%) on EGFP-14CUG with short RNA repeat sequences, while the other four have comparable and lower off-target effects (about 20%), and ARC-T has the lowest off-target rate.

[0352] The primer sequences used for quantitative PCR were as follows: EGFP-F2: 5'-CCCGACAACCACTACCTGAG-3'; EGFP-R2: 5'-TGCATCTTACACCAAACTCATCTG-3'; mCherry-F2: 5'-AAGACTATGGGCTGGGAGGC-3'; mCherry-R2: 5'-CTCGTTGTGGGAGGTGATGT-3'; mGAPDH-F: 5'-GTCAAGGCCGAGAATGGGAA-3'; mGAPDH-R: 5'-CTCGTGGTTCACACCCATCA-3'.

[0353] Example 16. Evaluation of the specificity and immunogenicity of novel artificial RNases in vivo

[0354] According to the above-mentioned mouse live injection method, different viral particles expressing the target CUG repeat sequence (purchased from Heyuan Bio) were injected into the mouse at a rate of 10 11The total amount of vg was injected into the thigh skeletal muscle (right leg) of mouse-CUG-R160G14 mice (purchased from Saiye Bio), and the respective control AAV virus particles (purchased from Heyuan Bio) were injected into the left leg of the same mouse with the same total injection amount (Figure 16A). Two months after the injection, the leg muscles of the injected part were taken out and RNA was extracted and sequenced as described above. The data analysis results showed that all CUG-targeted virus particles caused perturbations in gene expression levels in mouse muscle tissue. Among several different targeting systems, shRNA and Cas13d caused the largest number of upregulated and downregulated genes, followed by PIN-RCas9-CUG, dSaCas9, etc. The two new artificial RNA enzymes ARC-S and ARC-T applied for in the present invention have little effect on normal gene expression, and show specificity in therapeutic applications among existing potential disease targeting tools (Figure 17A).

[0355] The novel artificial RNA enzymes of the present invention also exhibit safer characteristics in terms of immunogenicity. Virus particles were injected into the tail vein of living mice. ARC-S and ARC-T virus particles (purchased from Heyuan Bio) were injected at a rate of 10 12 vg was injected into mice, and two months after injection, CD4 and CD8 T cells in the peripheral blood of mice were isolated and tested for the common immune response Maeker gene. Peripheral blood cell separation was performed using Dynabeads TM FlowComp TM Mouse CD4, CD8 test kit (Thermo), specific steps refer to the instructions (Figure 17B). The isolated CD4 and CD8 cells were respectively extracted with TRIzol Reagent (purchased from Thermo Fisher), and the specific operation steps were carried out according to the instructions. The extracted total RNA was reverse transcribed using TAKARA's PrimeScript RT Reagent Kit with gDNA Eraser or other companies' reverse transcription kits. Subsequently, quantitative PCR detection was performed using 2X Universal SYBR Green Fast qPCR Mix reagent (purchased from ABclonal, Wuhan Aiboteike). The results show that the two artificial RNA enzymes in the present application do not induce an immune response in mice, and therefore have a strong safety in the application of targeted repeat sequence expansion RNA therapy (Figure 17C).

[0356] The primer sequences used in quantitative PCR are: mCD25-F: 5'-GCGTTGCTTAGGAAACTCCTGG-3'; mCD25-R: 5'-GCATAGACTGTGTTGGCTTCTGC-3'; mIFNG-F: 5'-CAGCAACAGCAAGGCGA AAAAGG-3';mIFNG-R:5'-TTTCCGCTTCCTGAGGCTGGAT-3';mIL-17-F:5'-CAGACTACCTCAACCGTTCCAC-3';mIL-17-R:5'-TCCAGCTTTCCCTCCGCATT GA-3';mIL-4-F:5'-ATCATCGGCATTTTGAACGAGGTC-3';mIL-4-R:5'-ACCTTGGAAGCCCTACAGACGA-3';mLAMP1-F:5'-CCAGGCTTTCAAGGTGGACAGT -3';mLAMP1-R:5'-GGTAGGCAATGAGGACGATGAG-3';mTNFa-F:5'-GGTGCCTATGTCTCAGCCTCTT-3';mTNFa-R:5'-GCCATAGAACTGATGAGAGGGAG-3';

[0357] Sequence information

[0358] SEQ ID NO: 1 PUF protein fragment

[0359] CMV promoter SEQ ID NO: 2

[0360] SEQ ID NO: 3 CAG promoter

[0361] SEQ ID NO:4 PGK promoter

[0362] SEQ ID NO:5 EF-1α promoter

[0363] SEQ ID NO:6 SV40 promoter

[0364] SEQ ID NO:7 chicken beta-actin promoter

[0365] SEQ ID NO:8 HSV-TK promoter

[0366] SEQ ID NO:9 Ubc promoter

[0367] SEQ ID NO: 10 TRE promoter

[0368] SEQ ID NO:11 UAS promoter

[0369] SEQ ID NO: 12 Ad promoter

[0370] SEQ ID NO: 13 Ac5 promoter

[0371] SEQ ID NO: 14 Polyhedrin promoter

[0372] SEQ ID NO:15 p10 promoter

[0373] SEQ ID NO: 16 CaMKIIa promoter

[0374] SEQ ID NO: 17 IL-2 promoter

[0375] SEQ ID NO: 18 RSV promoter

[0376] SEQ ID NO: 19 Gal1 promoter

[0377] SEQ ID NO: 20 TEF1 promoter

[0378] SEQ ID NO:21 TDH3 promoter

[0379] SEQ ID NO:22 ADH1 promoter

[0380] SEQ ID NO:23 T7 promoter TAATACGACTCACTATAGG

[0381] SEQ ID NO:24 T3 promoter AATTAACCCTCACTAAAGG

[0382] SEQ ID NO:25 SP6 promoter ATTTAGGTGACACTATAGA

[0383] SEQ ID NO:26 araBAD promoter

[0384] SEQ ID NO:27 trp promoter

[0385] SEQ ID NO:28 tac promoter TTGACAATTAATCATCGGCTCGTATAATG SEQ ID NO:29 lac promoter TTTACACTTTATGCTTCCGGCTCGTATGTTG SEQ ID NO:30 pL promoter

[0386] SEQ ID NO: 31 Nucleic acid sequence encoding β-galactosidase LacZ

[0387] SEQ ID NO:32β-galactosidase LacZ protein sequence

[0388] SEQ ID NO:33 Nucleic acid sequence encoding mCherry

[0389] SEQ ID NO:34 mCherry protein sequence

[0390] SEQ ID NO:35 nucleic acid sequence encoding GFP

[0391] SEQ ID NO:36 GFP protein sequence

[0392] SEQ ID NO: 37 encoding EGFP nucleic acid sequence

[0393] SEQ ID NO:38 EGFP protein sequence

[0394] SEQ ID NO: 39 encoding dTomato nucleic acid sequence

[0395] SEQ ID NO:40 dTomato protein sequence

[0396] SEQ ID NO:41 Nucleic acid sequence encoding BFP

[0397] SEQ ID NO:42 BFP protein sequence

[0398] SEQ ID NO:43 Nucleic acid sequence encoding YFP

[0399] SEQ ID NO:44 YFP protein sequence

[0400] SEQ ID NO:45 encoding ZsGreen nucleic acid sequence

[0401] SEQ ID NO:46 ZsGreen protein sequence

[0402] SEQ ID NO: 47 Nucleic acid sequence encoding firefly luciferase (FLuc)

[0403] SEQ ID NO:48 Firefly luciferase (FLuc) protein sequence

[0404] SEQ ID NO: 49 Nucleic acid sequence encoding Renilla Luciferase (RLuc)

[0405] SEQ ID NO:50 Renilla Luciferase (RLuc) protein sequence

[0406] SEQ ID NO:51 Nucleic acid sequence encoding Gaussia Luciferase (GLuc)

[0407] SEQ ID NO:52 Gaussia Luciferase (GLuc) protein sequence

[0408] SEQ ID NO:53 Nucleic acid sequence encoding Nano-Glo Luciferase (NLuc)

[0409] SEQ ID NO:54 Nano-Glo Luciferase (NLuc) protein sequence

[0410] SEQ ID NO:55 Nucleic acid sequence encoding Cypridina Luciferase (CLuc)

[0411] SEQ ID NO:56 Cypridina Luciferase (CLuc) protein sequence

[0412] SEQ ID NO:57 CaMV poly(A) signal nucleic acid sequence

[0413] SEQ ID NO:58 EF-1α poly(A) signal nucleic acid sequence

[0414] SEQ ID NO:59 bGH poly(A) signal nucleic acid sequence

[0415] SEQ ID NO:60 hGH poly(A) signal nucleic acid sequence

[0416] SEQ ID NO:61 SV40 poly(A) signal nucleic acid sequence

[0417] SEQ ID NO:62 human β-globin poly(A) signal nucleic acid sequence

[0418] SEQ ID NO:63 Nucleic acid sequence encoding nuclear localization signal peptide sequence CCAAAAAAGAAGAGAAAGGTA SEQ ID NO:64 Nuclear localization signal peptide protein sequence PKKKRKV

[0419] SEQ ID NO:65 Nucleic acid sequence encoding mitochondrial localization signal peptide sequence

[0420] SEQ ID NO:66 Mitochondrial localization signal peptide protein sequence

[0421] SEQ ID NO:67 Nucleic acid sequence encoding nuclear export signal peptide sequence

[0422] SEQ ID NO:68 Nuclear export signal peptide protein sequence LPPLERLTL SEQ ID NO:69 Nucleic acid sequence encoding ANG protein

[0423] SEQ ID NO:70 ANG protein sequence

[0424] SEQ ID NO: 71 Nucleic acid sequence encoding ANG-S protein

[0425] SEQ ID NO:72 ANG-S protein sequence

[0426] SEQ ID NO: 73 Nucleic acid sequence encoding RNASEL protein

[0427] SEQ ID NO:74 RNASEL protein sequence

[0428] SEQ ID NO:75 Nucleic acid sequence encoding RRP44 protein

[0429] SEQ ID NO:76 RRP44 protein sequence

[0430] SEQ ID NO: 77 Nucleic acid sequence encoding RNASE1 protein

[0431] SEQ ID NO:78 RNASE1 protein sequence

[0432] SEQ ID NO: 79 Nucleic acid sequence encoding PNPT1 protein

[0433] SEQ ID NO:80 PNPT1 protein sequence

[0434] SEQ ID NO:81 Nucleic acid sequence encoding REXO2 protein

[0435] SEQ ID NO:82 REXO2 protein sequence

[0436] SEQ ID NO:83 Nucleic acid sequence encoding MRPL44 protein

[0437] SEQ ID NO:84 MRPL44 protein sequence

[0438] SEQ ID NO:85 Nucleic acid sequence encoding LACTB2 protein

[0439] SEQ ID NO:86 LACTB2 protein sequence

[0440] SEQ ID NO:87 Nucleic acid sequence encoding TSEN15 protein

[0441] SEQ ID NO:88 TSEN15 protein sequence

[0442] SEQ ID NO:89 Nucleic acid sequence encoding ZC3H12A protein

[0443] SEQ ID NO:90 ZC3H12A protein sequence

[0444] SEQ ID NO:91 XTEN connecting peptide sequence SGSETPGTSESATPES SEQ ID NO:92 connecting peptide protein sequence GGGGS

[0445] SEQ ID NO:93(CTG)14 nucleic acid sequence

[0446] SEQ ID NO:94 mCherry-(CTG)14 nucleic acid sequence

[0447] SEQ ID NO:95 PUF-ANG protein sequence

[0448] SEQ ID NO:96 PUF-ANG-S protein sequence

[0449] SEQ ID NO:97 PUF-RNASEL protein sequence

[0450] SEQ ID NO:98 PUF-RRP44 protein sequence

[0451] SEQ ID NO:99 PUF-RNASE1 protein sequence

[0452] SEQ ID NO: 100 PUF-PNPT1 protein sequence

[0453] SEQ ID NO:101 PUF-REXO2 protein sequence

[0454] SEQ ID NO: 102 PUF-MRPL44 protein sequence

[0455] SEQ ID NO: 103 PUF-LACTB2 protein sequence

[0456] SEQ ID NO: 104 PUF-TSEN15 protein sequence

[0457] SEQ ID NO: 105 PUF-ZC3H12A protein sequence

[0458] SEQ ID NO: 106 ANG-PUF protein sequence

[0459] SEQ ID NO: 107 ANG-S-PUF protein sequence

[0460] SEQ ID NO: 108 RNASE1-PUF protein sequence

[0461] SEQ ID NO: 109 PNPT1-PUF protein sequence

[0462] SEQ ID NO:110 REXO2-PUF protein sequence

[0463] SEQ ID NO:111 ZC3H12A-PUF protein sequence

[0464] SEQ ID NO: 112 Nucleic acid sequence encoding RNASET2 protein

[0465] SEQ ID NO: 113 RNASET2 protein sequence

[0466] SEQ ID NO: 114 Nucleic acid sequence encoding SUPV3L1 protein

[0467] SEQ ID NO: 115 SUPV3L1 protein sequence

[0468] SEQ ID NO: 116 PUF-RNASET2 protein sequence

[0469] SEQ ID NO: 117 RNASET2-PUF protein sequence

[0470] SEQ ID NO: 118 PUF-SUPV3L1 protein sequence

[0471] SEQ ID NO: 119 SUPV3L1-PUF protein sequence

[0472] All documents mentioned in this application are incorporated herein by reference, just as if each document were incorporated herein by reference individually. It should also be understood that after reading the above teachings of the present invention, those skilled in the art may make various changes or modifications to the present invention, and that such equivalents also fall within the scope of the claims appended hereto.

Claims

1. A nucleic acid construct set, characterized in that: The nucleic acid construct group includes: a first nucleic acid construct and a second nucleic acid construct; Furthermore, the first nucleic acid construct contains a first expression cassette, the first expression cassette expresses a long RNA repeat sequence, and the first expression cassette comprises a repeat sequence unit of 3-6 nucleotides, the repeat sequence is repeated 41-2000 times, preferably 45-1500 times, more preferably 50-1000 times; The second nucleic acid construct contains a second expression cassette, which expresses a short RNA repeat sequence, and the second expression cassette contains a repeat sequence unit of 3-6 nucleotides corresponding to the first expression cassette, and the repeat sequence is repeated 2-40 times, preferably 5-40 times.

2. A recombinant vector, characterized in that: The recombinant vector comprises the nucleic acid construct set as claimed in claim 1.

3. A genetically engineered cell, characterized in that: The genetically engineered cell contains the nucleic acid construct set according to claim 1, or contains the recombinant vector according to claim 2.

4. A kit, characterized in that: The kit comprises: a container and the nucleic acid construct set according to claim 1 located in the container.

5. A method for screening drugs for treating diseases associated with long RNA repeat sequences, characterized in that: Includes steps: (a) introducing the nucleic acid construct set according to claim 1 and the drug to be screened into cells together, (b) judging whether the drug to be tested is a drug for treating a disease associated with a long RNA repeat sequence by the intensity change of the first detectable marker and the second detectable marker in the nucleic acid construct group.

6. A system for screening drugs for treating diseases associated with long RNA repeat sequences, characterized in that: The system comprises: (a) The nucleic acid construct set of claim 1; (b) drugs to be screened; Among them, when the expression level or intensity of the first detectable marker in the nucleic acid construct group is significantly reduced, and the expression level or intensity of the second detectable marker changes very little or remains basically unchanged, it indicates that the drug to be screened is a candidate or potential drug that can be used to treat long RNA repeat sequence-related diseases.

7. A screening composition for screening drugs for treating diseases associated with long RNA repeat sequences, characterized in that: The screening composition comprises: (a) drugs to be screened; (b) the nucleic acid construct set according to claim 1; Among them, when the expression amount or intensity of the first detectable marker in the nucleic acid construct group is significantly reduced, and the expression amount or intensity of the second detection marker changes slightly or remains basically unchanged, it indicates that the drug to be screened is a candidate or potential drug that can be used to treat long RNA repeat sequence-related diseases.

8. Use of the system of claim 6 or the screening composition of claim 7, characterized in that: Used to screen drugs for treating diseases associated with long RNA repeat sequences.

9. A composition, characterized in that include: (a) A drug for treating a disease associated with long RNA repeat sequences obtained by the method of claim 5 or the system of claim 6, wherein the drug for treating a disease associated with long RNA repeat sequences comprises an artificial RNA degrading enzyme, and preferably, the RNA degrading enzyme has a structure shown in Formula IV or IV' from the NC end of the protein: D1-A-L1-B-D2(IV); D1-B-L1-A-D2(IV') In the formula, each "-" is independently a connecting peptide or a peptide bond; A is the PUF protein fragment; B is the full length or active fragment of an RNase or RNA helicase; L1 is none or a linker peptide; D1 is no or localized peptide; D2 is a peptide without or positioned, and the full length or active fragment of the RNA enzyme or RNA helicase is selected from the following group: PIN (from SMG6, UNIPROT: Q86US8), ANG (UNIPROT: P03950), RNASEL (UNIPROT: Q05823), RRP44 (UNIPROT: Q9Y2L1), RNASE1 (UNIPROT: P07998), RNASET2 (UNIPROT: O00584) 、SUPV3L1(UNIPROT:Q8IYB8)、PNPT1(UNIPROT:Q8TCS8)、REXO2(UNIPROT:Q9Y3B8)、MRPL44(UNIPROT:Q9H9J2)、LACTB2(UNIPROT:Q53H82)、TSEN15(UNIPROT:Q8WW01)、ZC3H12A(UNIPROT:Q5D1E8), or their active regions and sequence combinations.

10. A method for preparing an animal model for screening drugs for treating diseases associated with long RNA repeat sequences, characterized in that: The method comprises the following steps: (a) providing cells of a non-human mammal, and introducing the nucleic acid construct set according to claim 1 into the cells, thereby obtaining cells that simultaneously express long RNA repeat sequences and short RNA repeat sequences; (b) Using the cells obtained in step (a) that simultaneously express long RNA repeat sequences and short RNA repeat sequences, an animal model is prepared for screening drugs for treating diseases associated with long RNA repeat sequences.

11. Use of a non-human mammal model prepared by the method according to claim 10, characterized in that: This model is used to screen or identify substances (therapeutic agents) for treating long RNA repeat sequence-related diseases.

12. A method for screening or identifying potential therapeutic agents for treating long RNA repeat sequence-related diseases, characterized in that: The following steps are involved: (a) in a test group, administering the test drug to the non-human mammal model prepared by the method of claim 9 in the presence of the test drug, and analyzing the expression amount or intensity of the first detectable marker and the second detectable marker in the animal model of the test group respectively; and in a control group to which the test drug is not administered and other conditions are the same, analyzing the expression amount or intensity of the first detectable marker and the second detectable marker of the animal model of the control group; (b) comparing the expression levels or intensities of the first detectable marker and the second detectable marker in the test group and the control group animal models, wherein, if the expression level or intensity of the first detectable marker in the animal model administered with the test drug is significantly reduced compared with the control group, and the expression level or intensity of the second detectable marker remains essentially unchanged, it indicates that the test compound can be used as a potential therapeutic agent for treating diseases associated with long RNA repeat sequences.

13. A use of the genetically engineered cell according to claim 3, characterized in that: Used to prepare biological preparations for constructing animal models for screening drugs for treating diseases associated with long RNA repeat sequences in non-human mammals.

Images