Human nasal organ as well as preparation method and use method thereof

Abstract

A robust nasal organoid culture system and fully characterized 2D and 3D in vitro produced organoids are provided, as well as methods of using the organoids. The nasal organoids comprise a population of differentiated nasal epithelial cells having cellular heterogeneity and molecular markers similar to mature nasal epithelial tissue. Improved methods for producing two-dimensional and three-dimensional nasal organoids are also provided. These methods generally require a two-phase culture system, i.e., amplification and differentiation culture. The provided nasal organoids are suitable for reproducing nasal tissue complexity, for mimicking respiratory diseases, studying barrier function and drug delivery, high throughput drug screening, and assessing the effects of pathogens and environmental toxins on nasal respiratory epithelium.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims the benefit of and priority to U.S. Provisional Application No. 63 / 358,795, filed on July 6, 2022, the entire contents of which are specifically incorporated herein by reference.

[0003] References to sequence listings

[0004] The sequence listing is submitted as a text file, entitled “UHK_01234_PCT_ST26.xml,” created on June 27, 2023, and is 34,301 bytes in size, and is incorporated herein by reference pursuant to 37 C.FR §1.834(c)(1). Field of the Invention

[0005] The disclosed invention is generally in the field of organoids, and specifically in the field of human nasal organoids. Background Art

[0006] Although patients with COVID-19 are at risk for developing life-threatening pneumonia, most have mild to moderate symptoms due to upper respiratory tract involvement, including cough, sore throat, and occasionally loss of smell. Clinically, presymptomatic and symptomatic COVID-19 patients have high viral loads in nasal swabs, indicating robust viral growth in the nasal epithelium and the high transmissibility of SARS-CoV-2 (3). The human upper respiratory tract, particularly the nasopharyngeal epithelium, is the entry point and primary site of SARS-CoV-2 replication and transmission (4,5). In particular, nasal ciliated cells are the primary target of SARS-CoV-2 replication, especially in the early stages of infection (5).

[0007] The human airways, from the nasal cavity to the terminal bronchioles, are lined with airway epithelium, also known as pseudostratified ciliated epithelium, which is composed of four major cell types: ciliated cells, goblet cells, club cells, and basal cells. Single-cell RNA sequencing technology has enabled in-depth elucidation of the global molecular profile of human cells in vivo and has significantly advanced previous understanding of human cells based on traditional characterization methods. Single-cell sequencing studies of the human airways have shown that the airway epithelium lining the nasal cavity is distinct from the airway epithelium covering the tracheobronchial regions (6,7). Goblet cells are more abundant in the nasal epithelium than in the tracheobronchial epithelium. Furthermore, the same cell types in the nose displayed differential gene expression profiles compared to those in the tracheobronchial airways, suggesting region-specific subsets of airway epithelial cell types in the nasal and tracheobronchial compartments. Overall, nasal epithelial cells and their tracheobronchial counterparts have subtle but distinct molecular profiles, which may result in corresponding phenotypic variation.

[0008] Since the end of 2020, SARS-CoV-2 has undergone a series of mutations, including “variants of concern” (VOCs) that affect viral transmissibility and antigenicity. Epidemiological data show that the delta variant (B1.617.2), first discovered in December 2020, is 55% more transmissible than the earlier alpha variant (B1.1.7) (8). Subsequently, the Omicron variant (B1.1.529) emerged in November 2021; it quickly swept the world and became the dominant variant (9). As the epidemic develops, new variants will inevitably emerge. However, commonly used cell lines such as A549 or Calu3 for studying human respiratory viruses cannot simulate the multicellular complexity and functional diversity of the human respiratory epithelium, let alone simulate respiratory infections. Air-liquid interface cultures of primary human airway and nasal epithelial cells undergo mucociliary differentiation to pseudostratified airway epithelium. These epithelial cells have been used to study SARS-CoV-2 respiratory infections (2, 10-16). However, due to limited in vitro proliferation capacity, the so-called "Hayflick limit", primary epithelial cells cannot be expanded long-term (17), which greatly restricts their use for routine research purposes. Therefore, there is an urgent need for improved human nasal epithelial cell models for research purposes. There is also an urgent need for improved cell models for the treatment of respiratory problems.

[0009] It is therefore an object of the present invention to provide improved compositions of two-dimensional and three-dimensional nasal organoids.

[0010] It is another object of the present invention to provide improved methods for generating two-dimensional and three-dimensional nasal organoids.

[0011] It is another object of the present invention to provide methods of using nasal organoids to study nasal biology, biomarker identification, and evaluation of new and existing treatments. Summary of the invention

[0012] Human nasal organoids derived from human nasal cells are disclosed. Non-limiting examples illustrate that the disclosed human nasal organoids can better mimic the nasal epithelium than airway organoids derived from lung tissue. The disclosed human nasal organoids are derived from nasal epithelial cells extracted via a non-invasive procedure to produce the nasal organoids.

[0013] The inventors have established the first adult stem cell-derived human lung organoids directly from primary lung tissue (18-22). These lung organoids expanded stably over a year without the use of any feeder cells and cumbersome cell purification procedures. Then, proximal and distal differentiation of the long-term expandable lung organoids were induced, and mature airway and alveolar organoids were generated, which morphologically and functionally phenotypically mimic the natural airway and alveolar epithelium, respectively (18,22). These physiologically active respiratory organoids have become a robust and popular research tool for studying SARS-CoV-2 and other respiratory viruses (22-26). As mentioned above, the airway epithelium in the nasal mucosa is different from that covering the tracheobronchial region (6,7). Previous studies on human intestinal organoids, the first adult stem cell-derived organoids (27,28), showed that organoids generated from different intestinal segments retained the structural and functional characteristics from which they were derived (29).

[0014] A robust nasal organoid culture system and fully characterized organoids, as well as methods of using the organoids, are disclosed. Nasal organoids are stably passaged for more than 6 months, providing a renewable source of nasal epithelial cells. Although not intended to be limiting, the following are exemplary features of the disclosed nasal organoids: (1) nasal organoids are and can be derived from nasal epithelial cells obtained via nasal swabs; (2) organoids can have long-term expansion capacity (i.e., they can be serially passaged for up to six months or longer); (3) organoids can generate a variety of cell types, including ciliated cells, basal cells, goblet cells, and club cells; (4) organoids are and can be extensively characterized by, for example, light microscopy for brightfield images and videos of beating cilia, RT-qPCR for cell type-specific markers and compartment-specific markers, IF staining for cell type identification and tight junction formation, scanning electron microscopy for ultrastructural images of cilia, TEER for barrier integrity, flow cytometry for cell type composition and expression of host-dependent factors; (5) organoid types can include 3D dNSO, 2D dNSO (pH 7.4), and 2D optimized dNSO (pH 7.4). 6.6 / 7.4); and (6) replication kinetics of organoids via and can be determined by, for example, RT-qPCR and TCID 50 to be extensively characterized - approximately 3-4 log10 units for the ancestral virus and approximately 5-6 log10 units for the Delta variant / Omicron variant.

[0015] The disclosed 2D and 3D nasal organoid monolayers are and can be optimized by simulating the natural microenvironment of the nasal epithelium. It has been demonstrated that the optimized nasal organoid monolayers fully reproduce the high infectivity of SARS-CoV-2 in the upper respiratory tract, particularly the highly transmissible Delta variant and Omicron variant. The disclosed nasal organoid monolayers outperform most, if not all, existing respiratory organoid models. A robust organoid system was generated that is capable of stably expanding and reconstructing human nasal epithelium in a culture dish. The nasal organoid culture system provides an unlimited source of physiologically active nasal epithelial cells for studying respiratory pathogens, circumventing the limitations of cultured primary nasal epithelial cells. More importantly, the simple procedure for obtaining nasal cells and the zero-failure establishment efficiency enable researchers to easily establish personalized nasal organoids, which will pave new avenues for many exciting organoid-based studies to combat the COVID-19 epidemic. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1A It is a schematic diagram outlining the derivation, expansion and differentiation of human nasal organoids. The upper figure shows the derivation of nasal organoids (NsO) from nasal cells. 3D undifferentiated nasal organoids undergo expansion in expansion (Exp) culture medium. Microphotographs show organoids grown on day 0 (D0), day 3, day 7 and day 10 (magnification 40 times). The figure below shows that nasal organoids undergo differentiation protocols to produce 3D differentiated nasal organoids (3D dNsO) or differentiated nasal organoid monolayers (dNsO-mono). Microphotographs sequentially present differentiated 3D organoids (magnification 40 times) on day 0, day 2, day 4, day 6 and day 10 in basal culture medium and PD culture medium. Microphotographs sequentially show organoid monolayers differentiated in expansion culture medium and PD culture medium on day 2, day 4 and day 10 (magnification 100 times). Figure 1B Bar graph showing normalized expression of cell-specific marker genes and SARS-CoV-2 receptor ACE2 gene in parental 3D nasal organoids (NsO) and 3D differentiated nasal organoids (3D dNsO). Data represent mean and standard deviation of a representative experiment, n=4. Two-tailed unpaired Student's t-test. Experiments were performed independently in four organoid lines. Figure 1C-1H is a bar graph showing the expression levels of trachea / bronchial-enriched genes and nasal-enriched genes for three 3D differentiated human airway organoid (AwO) lines and three other 3D differentiated nasal organoid (dNsO) lines. Data represent the mean and standard deviation for each organoid line, n=2. Two-tailed unpaired Student's t-test. Fig. 1I are bar graphs showing the expression levels of cell-specific marker genes and SARS-CoV-2 receptor ACE2 in parental 3D nasal organoids (NsO) and differentiated nasal organoid monolayers (dNsO-mono). Figure 1Jis a line graph showing the transepithelial electrical resistance (TEER) of dNsO-mono on Transwell inserts measured every other day over 10 days. Blank inserts without cells were measured as baseline readings. Data represent mean and standard deviation of a representative experiment, n=4. Two-tailed unpaired Student's t-test. Experiments were performed independently in two organoid lines.

[0018] Figure 2A is a schematic outlining the generation of optimized differentiated nasal organoid monolayers (dNsO-mono). Figure 2B Is a line graph showing the transepithelial electrical resistance (TEER) of dNsO-mono differentiated in pH 7.4 / 7.4 or pH 6.6 / 7.4 PD medium measured every other day over 10 days. A blank insert without any cells was measured as a baseline. Data represent the mean and standard deviation of a representative experiment, n=4. Two-tailed unpaired Student's t-test. Experiments were performed independently in two organoid lines. Figure 2C-2V is a graph showing the results of optimization experiments of differentiated nasal organoid monolayers. Parental 3D NsO, 3D dNsO, and dNsO-mono differentiated at pH 7.4 / 7.4 or pH 6.6 / 7.4 were applied to flow cytometry to examine the abundance of CK5+ basal cells, ACCTUB+ ciliated cells, MUC5AC+ goblet cells, and CC10+ rod cells. Figure 2S-2V yes Figure 2C-2R Representative histograms of data in the middle. Data on the right represent mean and standard deviation of a representative experiment, n = 4. Ordinary one-way ANOVA with Tukey's multiple comparison test was used. Experiments were performed independently in two organoid lines.

[0019] Figures 3A-3J is a graph showing the expression of ACE2 and TMPRSS2. Organoids were applied to flow cytometry to examine the expression of ACE2 and TMPRSS2. Representative histograms are shown in Fig. 3I and 3J Middle. Red, cells stained with specific antibodies; blue, cells stained with isotype control. Data on the right represent mean and standard deviation of a representative experiment, n = 4. Ordinary one-way ANOVA with Tukey's multiple comparison test. Experiments were performed independently in two organoid lines.

[0020] Figures 4A-4P is a graph showing the results of SARS-CoV-2 infection and replication fitness in differentiated nasal organoids. Figures 4A-4Dis a bar graph showing that at the indicated hours after inoculation, culture medium was harvested from four lines infected with SARS-CoV-2 3D dNsO (top, 1 MOI) or dNsO-mono (bottom, 0.1 MOI) and applied to detect viral load of RdRp gene by RT-qPCR and viral titration by TCID50. Data represent mean and standard deviation, n=2 in each organoid line. Dashed line indicates detection limit. Figure 4E and Figure 4F are bar graphs showing that at the indicated hours after inoculation with wild type (WT), delta, or omega-3 variants (0.1 MOI), medium was harvested from the top chamber of dNsO-mono and applied to viral load detection and virus titration. Data show mean and standard deviation of a representative experiment, n = 3. Multiple unpaired t-tests were performed for multiple comparisons using the Holm-Sidak method. Experiments were performed independently in two organoid lines. Figure 4G SARS-CoV-2 WT, Delta, or Omicron-infected dNsO-mono were dissociated 24 h post-inoculation (1 MOI) and applied to flow cytometry to detect dsRNA+ cells. Data represent mean and SD of a representative experiment, n = 4. Ordinary one-way ANOVA with Tukey's multiple comparison test was used. Experiments were performed independently in two organoid lines. Figure 4H and Fig. 4I In the case of a 1:1 mixture of Omicron and Delta ( Figure 4H ) or a mixture of Omicron and WT viruses ( Fig. 4I At indicated hours after inoculation (total 0.1 MOI), culture medium was harvested from the top chamber of dNsO-mono and applied to viral load detection using variant-specific primers and probes. Data represent the mean and standard deviation of a representative experiment, n=3. Figure 4J and 4K In the , medium was harvested from the top chamber of the airway organoid monolayer (AwO-mono) at the indicated hours after inoculation with wild type (WT), Delta or Omicron variant (0.1 MOI) and applied to viral load detection and virus titration. Data show the mean and standard deviation of a representative experiment, n = 3. Multiple unpaired t-tests were performed using the Holm-Sidak method for multiple comparisons. Figure 4L is a bar graph showing that at the indicated hours after inoculation with a 1:1 mixture of Omicron and WT (total 0.1 MOI), culture medium was harvested from the top chamber of AwO-mono and applied to viral load detection using variant-specific primers and probes. Data represent the mean and standard deviation of a representative experiment, n=3. Figure 4M and 4Nis a bar graph showing that at the indicated hours after inoculation with wild type (WT), Delta or Omicron variant (0.01 MOI), medium was harvested from Vero E6 / TMPRSS2 cells and applied to viral load detection and virus titration. Data show the mean and standard deviation of a representative experiment, n=3. Multiple unpaired t-tests were performed using the Holm-Sidak method for multiple comparisons. Experiments were performed independently in two organoid lines. Fig.4O and 4P is a bar graph showing the results of using a 1:1 mixture of Omicron and Delta ( Fig.4O ) or a mixture of Omicron and WT viruses ( Figure 4P At the indicated hours after inoculation (total 0.01 MOI), culture medium was harvested from Vero E6 / TMPRSS2 cells and applied to viral load detection using variant-specific primers and probes. Data represent the mean and standard deviation of a representative experiment, n=3. Experiments were performed independently in two organoid lines.

[0021] Figures 5A-5C is a bar graph showing that SARS-CoV-2 targets ciliated cells. Figure 5A and 5B 24 h after seeding (1 MOI), mock-infected, WT-infected, Delta-infected, or Omicron-infected dNsO-mono were dissociated and applied to flow cytometry to detect ACCTUB+ ciliated cells. Data represent mean and SD of a representative experiment, n = 4. Ordinary one-way ANOVA with Tukey's multiple comparison test was used. Experiments were performed independently in two organoid lines. Figure 5C Airway organoid monolayers (AwO-mono) infected with mock, WT or Delta were dissociated 24 hours after seeding (1 MOI) and applied to flow cytometry to detect ACCTUB+ ciliated cells. Data represent mean and standard deviation of a representative experiment, n=3. Ordinary one-way ANOVA with Tukey's multiple comparison test was used. Experiments were performed independently in two organoid lines.

[0022] Figures 6A-6H is a bar graph showing SARS-CoV-2 damages cell junctions. Figures 6A-6C Figure 2 is a bar graph showing the quantification of immunofluorescence labeled dNsO-mono in mock-infected, WT-infected, or Delta-infected organoids. Fig. 6A )、ZO-1( Figure 6B ) and F-actin ( Figure 6C ). Data represent means and standard deviations from a representative experiment, n = 3. Ordinary one-way ANOVA with Tukey's multiple comparison test was used. Fig.6Dis a bar graph showing that 24 h after inoculation (1 MOI), mock-infected, WT-infected, Delta-infected, or Omicron-infected dNsO-mono were dissociated and applied to flow cytometry to detect OCLN + Cells. Data represent mean and standard deviation of a representative experiment, n = 4. Ordinary one-way ANOVA with Tukey's multiple comparison test was used. Experiments were performed independently in two organoid lines. Figure 6E-6G Image quantification of immunofluorescence labeled mock-infected, WT-infected, or Delta-infected AwO-mono is shown. Fig. 6E )、ZO-1( Fig. 6F ) and F-actin ( Figure 6G ) The geometric mean intensity of the analogs. Data represent the mean and standard deviation of a representative experiment, n = 3. Ordinary one-way ANOVA with Tukey's multiple comparison test was used. Figure 6H Shown 24 hours after seeding (1 MOI), mock-infected, WT-infected or Delta-infected AwO-mono were dissociated and applied to flow cytometry to detect OCLN+ cells. Data represent mean and standard deviation of a representative experiment, n=3. Ordinary one-way ANOVA with Tukey's multiple comparison test. Experiments were performed independently in two organoid lines. DETAILED DESCRIPTION OF THE INVENTION

[0024] The disclosed methods and compositions may be understood more readily by reference to the following detailed description of specific embodiments and the examples included therein and the drawings and the descriptions preceding and following them.

[0025] Any discussion of documents, acts, materials, devices, articles of manufacture or the like included in this specification should not be taken as an admission that any or all of these matters form part of the prior art base or were common general knowledge in the field relevant to the present disclosure as it existed before the priority date of each claim of this application.

[0026] Throughout the present specification, the word "comprise" or variations such as "comprises" or "comprising" will be understood to mean the inclusion of a stated element, integer or step or group of elements, integers or steps but not the exclusion of any other element, integer or step or group of elements, integers or steps.

[0027] I. Definitions

[0028] As used herein, "organoid" refers to an artificial in vitro construct derived from adult stem cells that is created to mimic or resemble the function and / or histological structure of an organ or part thereof.

[0029] As used herein, "media" or "culture media" refers to an aqueous solution provided for the growth, vitality or storage of cells used in the practice of the present invention. The media or culture media can be natural or artificial. The media or culture media can include a basal medium and can be supplemented with nutrients (e.g., salts, amino acids, vitamins, trace elements, antioxidants) to promote desired cell activities, such as cell vitality, growth, proliferation and / or differentiation of cells cultured in the culture medium. As used herein, "basal medium" refers to an aqueous solution of basal salt nutrients or salts and other elements that provides cells with water and certain large amounts of inorganic ions necessary for normal cell metabolism and maintains intracellular and / or extracellular osmotic balance.

[0030] As used herein, the term "culture" refers to incubating and / or passage cells in adherent, suspended or 3D cultures. As used herein, the term "adherent culture" refers to a cell culture system in which cells are cultured on a solid surface, which in turn may be coated with an insoluble matrix, which in turn may be coated with another surface coating of the matrix, such as those listed below, or any other chemical or biological material that allows cells to proliferate or stabilize in culture. Cells may or may not be tightly adhered to a solid surface or matrix.

[0031] The matrix used for adherent culture can be any one or a combination of tissue culture treated plastic, polyornithine, laminin, polylysine, purified collagen, gelatin, fibronectin, tenascin, vitronectin, entactin, heparin sulfate proteoglycan, polyglycolytic acid (PGA), polylactic acid (PLA) and poly (lactic-co-glycolic acid) (PLGA). In one embodiment, the cells are plated on In another embodiment, the cells are plated on a fibronectin-coated plate. Cells can be cultured in filter cultures and micromass cultures. In one embodiment, the cells are plated on a membrane filter, optionally as a transwell system (e.g., ) are placed into tissue culture dishes. The matrix can also be a bone scaffold substitute, such as CPP (calcium polyphosphate) or other pharmaceutically acceptable scaffolds (such as BioOss).

[0032] The term "contacting" or "culturing with" is intended to include incubating components and cells / tissues together in vitro (e.g., adding a compound to cells in culture) and the step of "contacting" or "culturing with" can be performed in any suitable manner. For example, cells can be treated in adherent culture, suspension culture, or 3D culture; components can be added substantially simultaneously (e.g., together in a mixture) or sequentially (e.g., within 1 hour, 1 day, or longer after adding the first component) in time. Cells can also be contacted with another agent such as a growth factor or other differentiation agent or environment to stabilize the cells, or further differentiate the cells, including culturing the cells under conditions known in the art. Different methods can be used, such as methods based on markers (e.g., cell surface markers) (e.g., FACS sorting, etc.) to enrich cell populations.

[0033] The term "expression" is also represented by "+", which refers to the detectable protein expression compared to cells that do not express protein, such as measured by FACS analysis, in terms of cellular protein levels. The term "fold change" related to expression refers to how much the amount changes between the original measurement and the subsequent measurement. The fold change is considered to be the ratio between two amounts, such as amounts A and B, and the fold change of B relative to A is B / A. For example, a change from 30 to 60 is defined as a fold change of 2. This is also referred to as "doubling". For a given comparison, a positive fold change value indicates an increase in expression, while a negative fold change indicates a decrease in expression. The value is usually reported on a logarithmic scale (with 2 as the base). For example, in "WT vs. KO comparison", the log2 fold change of a specific gene is 1.5, which means that the expression of the gene has increased by a multiplication factor of 2^1.5≈2.82 in WT relative to KO.

[0034] The term "agonist" means, for example, an activator of a pathway or signaling molecule. An agonist of a molecule can retain substantially the same biological activity or a portion of the biological activity of the molecule (e.g., nodal). For example, a nodal agonist refers to a molecule that selectively activates nodal signaling.

[0035] The term "inhibitor" means, for example, a selective inhibitor of a pathway or signaling molecule. An inhibitor or antagonist of a molecule (e.g., a TGFβ inhibitor) can inhibit one or more activities of the naturally occurring form of the molecule. For example, TGF inhibitor β is a β molecule that selectively inhibits TGF signaling.

[0036] The term "stem cell" or "undifferentiated cell" refers to a cell that is capable of proliferation, self-renewal, and production of more progenitor or precursor cells that have the ability to produce a large number of mother cells that can in turn produce differentiated or differentiable daughter cells. Daughter cells can, for example, be induced to proliferate and produce daughter cells that subsequently differentiate into one or more mature cell types while also retaining one or more cells with the developmental potential of the parent. The term "stem cell" includes pluripotent stem cells.

[0037] As used herein, the term "differentiation" refers to a phenomenon in which cells divide and proliferate, and the structure or function of cells is specialized during the growth of the whole object. In other words, it refers to a process in which cells, tissues, etc. of a living organism change into a form and function suitable for performing the respective roles assigned to them, etc. and a process of transformation into endoderm cells, and a process in which hematopoietic stem cells transform into red blood cells, white blood cells, platelets, etc., i.e., a progenitor cell expressing a specific differentiation trait, can all be included in differentiation.

[0038] As used herein, the term "pluripotency" (or pluripotent) refers to stem cells that have the potential to differentiate into any of the three germ layers: endoderm (e.g., stomach lining, gastrointestinal tract, lung), mesoderm (e.g., muscle, bone, blood, urogenital system), or ectoderm (e.g., epidermal tissue and nervous system).

[0039] As used herein, the term "induced pluripotent stem cell" (iPSC) is a pluripotent stem cell artificially derived from a non-pluripotent cell.

[0040] Materials, compositions, and components are disclosed that can be used in, can be used in conjunction with, can be used to prepare, or are products of the disclosed methods and compositions. These and other materials are disclosed herein, and it should be understood that when combinations, subsets, interactions, groups, etc. of these materials are disclosed, each is specifically contemplated and described herein, although there may not be a specific reference to each of the various individual and collective combinations and arrangements of these compounds that are explicitly disclosed. For example, if a ligand is disclosed and discussed and many modifications that can be made to many molecules including the ligand are discussed, each and every combination and arrangement of the ligand and possible modifications are specifically contemplated unless otherwise indicated to the contrary. Thus, if a class of molecules A, B, and C and a class of molecules D, E, and F and examples AD of combination molecules are disclosed, each can be considered individually and collectively even if each is not listed individually. Thus, in this example, each of the combinations AE, AF, BD, BE, BF, CD, CE, and CF is specifically contemplated and should be considered disclosed from the disclosure of A, B, and C; D, E, and F and disclosed in the example combination AD. Likewise, any subset or combination of these is also specifically contemplated and disclosed. Thus, for example, the subgroup of AE, BF, and CE is specifically contemplated and should be considered disclosed from the disclosure of A, B, and C; D, E, and F; and the example combination AD. Furthermore, each material, composition, component, etc. contemplated and disclosed above may also be specifically and individually included or excluded from any group, subgroup, list, set, etc. of such materials.

[0041] These concepts apply to all aspects of this application, including, but not limited to, steps in methods of making and using the disclosed compositions. Thus, if there are a variety of additional steps that can be performed, it should be understood that each of these additional steps can be performed in any specific form or combination of forms of the disclosed methods, and each such combination is specifically contemplated and should be considered disclosed.

[0042] Unless otherwise specified or clearly contradicted by the context, all methods described herein can be performed in any suitable order. Unless otherwise required, the use of any and all examples or exemplary language (e.g., "such as") provided herein is intended only to better illustrate the form and does not limit the scope of the form. No language in the specification should be construed as indicating that any unclaimed element is essential to the practice of the invention.

[0043] Recitation of ranges of values ​​herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein.

[0044] The use of the term "about" is intended to describe a value that is within a range of about + / -10% above or below the value; in other embodiments, the value may be within a range of about + / -5% above or below the value; in other embodiments, the value may be within a range of about + / -2% above or below the value; in other embodiments, the value may be within a range of about + / -1% above or below the value. The foregoing ranges are intended to be clear from the context and no further limitation is implied. Unless otherwise indicated herein or clearly contradicted by the context, all methods described herein may be performed in any suitable order. Unless otherwise required, the use of any and all examples or exemplary language (e.g., "for example") provided herein is intended only to better illustrate the invention and does not constitute a limitation on the scope of the invention. No language in the specification should be interpreted as indicating that any unclaimed element is essential to the practice of the invention.

[0045] In vitro generated organoids are disclosed. In some forms, the organoids include a population of differentiated nasal epithelial cells that have cellular heterogeneity and molecular markers similar to mature nasal epithelial tissue. In some forms, the population of differentiated nasal epithelial cells are human nasal epithelial cells.

[0046] In some forms, the differentiated nasal epithelial cell population expresses one or more molecular markers selected from the group comprising: angiotensin converting enzyme-2 (ACE2), transmembrane serine protease 2 (TMPRSS2), forkhead box G1 (FOXG1), TUBB4B (tubulin beta 4B class IVb), SIX3, paired box-7 (PAX7), P63, keratin 5 (CK5), Sentan (SNTN), mucin 5AC (MUC5AC), MUC15 (mucin 15, cell surface associated) and CC10. In some forms, the differentiated nasal epithelial cell population has lower expression of genes selected from the group comprising FOLR1, LMO3 and IRX2 compared to tracheal / bronchial cells. In some forms, the differentiated nasal epithelial cell population has about 0.25-fold, about 0.50-fold, about 0.75-fold, about 1.0-fold or about 1.25-fold lower FOLR1 expression compared to tracheal / bronchial cells. In some forms, the differentiated nasal epithelial cell population has about 1.0-fold, about 1.5-fold, about 2.0-fold, about 2.5-fold, or about 2.5-fold lower expression of LMO3 compared to tracheal / bronchial cells. In some forms, the differentiated nasal epithelial cell population has about 0.5-fold, about 1.0-fold, about 1.5-fold, about 2.0-fold, about 2.5-fold, or about 3.0-fold lower expression of IRX2 compared to tracheal / bronchial cells.

[0047] In some forms, the cellular heterogeneity includes a mixture of basal cells, ciliated cells, goblet cells, and club cells. In some forms, the differentiated nasal epithelial cell population is organized into a three-dimensional structure and encapsulated within a hydrogel or embedded within a biocompatible scaffold that provides structural support and promotes organization.

[0048] In some forms, the differentiated nasal epithelial cell population comprises a percentage of about 12% to about 35% basal cells, a percentage of about 35% to about 45% ciliated cells, a percentage of about 5% to about 10% goblet cells, and a percentage of about 0.1% to about 5% club cells.

[0049] In some forms, ACE2 is expressed by about 20% to about 45% of a population of differentiated nasal epithelial cells and TMPRSS2 is expressed by about 40% to about 55% of a population of differentiated nasal epithelial cells.

[0050] In some forms, the differentiated nasal epithelial cell population is organized into a two-dimensional (2D) monolayer. In some forms, the differentiated nasal epithelial cell population is incubated in a medium having a slightly acidic pH of about 6.0 to about 6.9, preferably about 6.6 for a period of time during differentiation.

[0051] In some forms, the differentiated nasal epithelial cell population comprises a percentage of about 1% to about 10% basal cells, a percentage of about 75% to about 92% ciliated cells, a percentage of about 4% to about 22% goblet cells, and a percentage of about 0.05% to about 2% club cells.

[0052] In some forms, ACE2 is expressed by about 30% to about 50% of the differentiated nasal epithelial cell population and TMPRSS2 is expressed by about 85% to about 100% of the differentiated nasal epithelial cell population.

[0053] In some forms, the differentiated nasal epithelial cell population is derived from undifferentiated nasal cells obtained non-invasively from a subject, wherein the subject is preferably a human. In some forms, the differentiated nasal epithelial cell population is genetically modified to increase or decrease the expression of specific genes involved in nasal tissue development, function or disease. In some forms, the differentiated nasal epithelial cell population exhibits functional properties including mucus production, ciliary beating, and response to olfactory stimulation.

[0054] Also disclosed are methods for generating three-dimensional (3D) organoids of nasal epithelium. In some forms, the method comprises the following steps:

[0055] (i) attaching cells to a support structure that promotes (3D) organoid formation, wherein the cells are turbinate cells that are capable of differentiating into nasal epithelial cells;

[0056] (ii) culturing the turbinate cells on the support structure in an expansion medium for a period of time to produce 3D human nasal undifferentiated cells, wherein the period of time is about 8 days to about 12 days, preferably about 10 days;

[0057] (iii) culturing the 3D nasal undifferentiated cells on the support structure in a basal medium for a period of time to expand the central cavity, wherein the period of time is about 3 days to about 5 days, preferably about 4 days;

[0058] (iv) culturing the 3D nasal undifferentiated cells on the support structure produced in step (iii) in a proximal differentiation medium for a period of time to produce 3D differentiated organoids of human nasal epithelium, wherein the period of time is about 5 days to about 7 days, preferably about 6 days.

[0059] In some forms, the expansion medium comprises a basal medium comprising one or more buffers, one or more growth factors, a ROCK inhibitor, a TGFβ inhibitor, a MAPK inhibitor, a WNT agonist, a BMP-4 inhibitor, one or more supplements and one or more antibiotics. In some forms, the basal medium is Dulbecco's modified Eagle medium (DMEM), Advanced DMEM / F12, RPMI-1640 or a minimum essential medium (MEM). In some forms, the buffer is a HEPES buffer, which is present in an amount ranging from 0.5% to about 1.5%, preferably about 1.0%. In some forms, the one or more growth factors are selected from the group comprising: epidermal growth factor (EGF) and fibroblast growth factor (FGF), wherein the growth factor is preferably a concentration of about 3ng / ml to about 7ng / ml, preferably about 5ng / ml FGF-7, and a concentration of about 15ng / ml to about 25ng / ml, preferably about 20ng / ml FGF-10. In some forms, the ROCK inhibitor is Y-27632 at a concentration of about 3 μM to about 7 μM, preferably about 5 μM. In some forms, the TGF inhibitor is A8301 at a concentration of about 400 nM to about 600 nM, preferably about 500 nM. In some forms, the MAPK inhibitor is SB202190 at a concentration of about 0.5 μM to about 1.5 μM, preferably 1.0 μM. In some forms, the WNT agonist is RSpondin 1, which is present in an amount of about 8% to about 12%, preferably about 10%. In some forms, RSpondin 1 and / or Noggin are added to the culture medium as conditioned medium, which is a culture medium harvested from a stable cell line expressing RSpondin 1 and Noggin. As used herein, the percentage of an agent in a culture medium refers to a volume percentage, for example, 10 ml of each conditioned medium can be added to 100 ml of basal medium to prepare an expansion medium containing 10% of each supplement. The mathematical calculations involved in preparing the solutions are further described in Stephenson, "Calculations for Molecular Biology and Biotechnology", 3 rd Edition, Chapter 2-Solutions, Mixtures, and Media, pages 15-42 (2016), the entire contents of which are incorporated herein. In some forms, the BMP-4 inhibitor is Noggin, which is present at a concentration of about 8% to about 12%, preferably about 10%. In some forms, the one or more supplements are selected from the group consisting of: an amount of about 0.5% to about 1.5%, preferably about 1% B27 supplement, N-acetylcysteine ​​at a concentration of about 1.0mM to about 1.5mM, preferably about 1.25mM, and nicotinamide at a concentration of about 7mM to about 13mM, preferably about 10mM. In some forms, one or more antibiotics are selected from the group comprising: penicillin-streptomycin at a content of about 0.5% to about 1.5%, preferably about 1.0%, and PrimocinPrimocin at a concentration of about 75μg / ml to about 125μg / ml, preferably about 100μg / ml.

[0060] In some forms, the support structure comprises a material selected from the group consisting of: RGD functionalized PEG hydrogels, collagen, hyaluronic acid extracellular matrix, synthetic hydrogels, decellularized extracellular matrix, alginate, poly(lactic-co-glycolic acid) (PLGA), or electrospun fibers cross-linked with Factor XIIIa. In a preferred form, the support structure comprises

[0061] In some forms, the basal medium is supplemented with about 1% HEPES buffer, about 1% and about 1% penicillin-streptomycin in Advanced DMEM / F-12. In some forms, the proximal differentiation medium comprises a basal medium supplemented with a γ-secretase inhibitor at a concentration of about 7 μM to about 13 μM, preferably about 10 μM, and wherein the proximal differentiation medium has a pH of about 7.2 to about 7.6, preferably about 7.4.

[0062] In some forms, the method further comprises replenishing the expansion medium once a day, three times a week, or four times a week. In some forms, the method further comprises re-plating and passage the 3D human nasal undifferentiated cells one or more times.

[0063] Also disclosed are methods for deriving a two-dimensional (2D) organoid monolayer of nasal epithelium from the disclosed 3D nasal undifferentiated cells. In some forms, the method comprises the following steps:

[0064] (a) 3D nasal undifferentiated cells are dissociated into multiple single nasal undifferentiated cells;

[0065] (b) transferring the plurality of single nasal undifferentiated cells to a dual chamber support structure and culturing the plurality of single nasal undifferentiated cells in an expansion medium for a period of time to allow cell attachment and expansion, wherein the period of time is about 1 day to about 3 days; and

[0066] (c) Expanded nasal undifferentiated cells were cultured in first and second proximal differentiation media for a total of about 8 days to generate confluent two-dimensional (2D) organoid monolayers.

[0067] In some forms, the dual chamber support structure comprises a top chamber and a bottom chamber, and wherein the single nasal undifferentiated cell is adhered to the top chamber of the support structure.

[0068] In some forms, the culturing of step (c) comprises:

[0069] adding the first proximal differentiation medium to the top chamber and the bottom chamber, wherein the first proximal differentiation medium has a pH of about 7.2 to about 7.6, preferably about 7.4;

[0070] incubating the nasal undifferentiated cells for about 2 days;

[0071] replacing the first proximal differentiation medium in the top chamber with the second proximal differentiation medium, wherein the pH of the second proximal differentiation medium is about 6.4 to about 6.8, preferably about 6.6; and

[0072] The nasal undifferentiated cells were incubated for about 6 days.

[0073] Also disclosed are methods for screening for an agent that has an effect on the nasal epithelium. In some forms, the method comprises contacting an in vitro generated organoid disclosed herein with an agent and determining the effect of the agent on the survival, proliferation, differentiation, morphological parameters, genetic parameters, or functional parameters of the in vitro generated organoid.

[0074] In some forms, the agent is an antiviral, antibacterial, antifungal, or antiallergic agent, wherein the action of the agent indicates that the agent is safe for treating respiratory tract infections. In some forms, the agent is a nucleic acid or an analog thereof, a polypeptide or an analog thereof, an antibody, a chemical, a small molecule, and / or any combination thereof.

[0075] Also disclosed are kits for generating two-dimensional monolayers or three-dimensional organoids of human nasal epithelium. In some forms, the kit includes a combination of two or more of the following:

[0076] (i) an expansion medium for deriving 3D undifferentiated nasal cells, comprising a basal medium comprising one or more buffers, growth factors, a ROCK inhibitor, a TGFβ inhibitor, a MAPK inhibitor, a WNT agonist, a BMP-4 inhibitor, one or more supplements, and one or more antibiotics;

[0077] (ii) a basal medium comprising a HEPES buffer, and AdvancedDMEM / F-12 with antibiotics;

[0078] (iii) one or more proximal differentiation media comprising a basal medium supplemented with a γ-secretase inhibitor; and

[0079] (iv) one or more supports or support structures.

[0080] II. Composition

[0081] A robust human nasal organoid culture system has been established, including two-dimensional and three-dimensional human nasal organoids. The disclosed nasal organoid monolayers outperform most, if not all, existing respiratory organoid models. The nasal organoids show stable passage for over 6 months, providing a renewable source of nasal epithelial cells. Thus, the nasal organoid culture system provides an unlimited source of physiologically active nasal epithelial cells for studying respiratory pathogens, circumventing the limitations of cultured primary nasal epithelial cells.

[0082] The nasal organoids exhibit significant cellular heterogeneity and structural complexity, closely resembling native human nasal epithelium. The disclosed human nasal organoids are suitable for reproducing the complexity of nasal tissues for modeling nasal diseases, studying barrier function and drug delivery, high-throughput drug screening, and evaluating the effects of pathogens and environmental toxins on the nasal respiratory epithelium.

[0083] Although not intended to be limiting, the following are exemplary features of the disclosed nasal organoids: (1) nasal organoids are derived from and can be derived from nasal epithelial cells obtained via nasal swabs; (2) organoids can have long-term expansion capacity (i.e., they can be serially passaged for up to six months or longer); (3) organoids can generate a variety of cell types, including ciliated cells, basal cells, goblet cells, and club cells; (4) organoids are extensively characterized by and can be characterized by, for example, light microscopy for brightfield images and videos of beating cilia, RT-qPCR for cell type-specific markers and compartment-specific markers, IF staining for cell type identification and tight junction formation, scanning electron microscopy for ultrastructural images of cilia, TEER for barrier integrity, flow cytometry for cell type composition and expression of host-dependent factors; (5) organoid types can include 3D dNSO, 2D dNSO (pH 7.4), and 2D optimized dNSO (pH 7.4). 6.6 / 7.4); and (6) the replication kinetics of organoids are and can be extensively characterized by, for example, RT-qPCR and TCID50 - approximately 3-4 log10 units for the ancestral virus and approximately 5-6 log10 units for the Delta variant / Omicron variant.

[0084] A. Nasal organoids

[0085] As described in a non-limiting example, undifferentiated 3D nasal organoids derived from nasal epithelial cells were obtained from nasal swabs of the inferior turbinate of a subject, and differentiated 3D and 2D nasal organoids were induced to generate. It was also demonstrated that the differentiated 3D and 2D nasal organoids maintained productive SARS-CoV-2 infection and reproduced the higher replication fitness of the Omicron variant and the Delta variant compared to the ancestral virus.

[0086] Thus, differentiated 3D and 2D nasal organoids are disclosed. The differentiated 3D and 2D nasal organoids exhibit cellular heterogeneity, molecular composition, structural complexity, and function similar to the nasal epithelium of the human nasal cavity.

[0087] 1. Structure of nasal organoids

[0088] The disclosed differentiated nasal organoids generally exhibit morphological features and molecular markers similar to mature nasal tissue. Nasal organoids generally contain differentiated nasal epithelial cell populations, including basal cells, ciliated cells, goblet cells, and club cells. Basal cells are multipotent cells attached to the basal layer of the nasal epithelium that have regenerative capacity and contribute to the continuous renewal of the respiratory lining. Morphologically, basal cells are small cuboidal cells with large nuclei, few organelles, and scattered microvilli (Crystal, Am. J. Respir. Crit. Care Med. 190: 1355–1362 (2014)). To this end, basal cells are the main stem cells of the airway, with the ability to self-renew after injury and differentiate into most other important cell types, including goblet cells, club cells and ciliated cells, tuft cells, pulmonary neuroendocrine cells (PNECs), and pulmonary ionocytes (Montoro, et al., Nature 560, 319–324 (2018); Hong, et al., Am. J. Physiol. Lung Cell. Mol. Physiol., 286: L643–L649 (2004); Rock, et al. Proc. Natl Acad. Sci. USA 106: 12771–12775 (2009); Hajj, et al. Stem Cells, 25, 139–148 (2007)).

[0089] The disclosed nasal organoids also contain a subpopulation of ciliated cells. Ciliated cells are columnar epithelial cells that line the luminal surface of the nasal epithelium. Morphologically, ciliated cells are characterized by their elongated shape, polarized organization, and the presence of a large number of motile cilia protruding from their apical surface. These cilia are microtubule-based structures that undergo rhythmic, coordinated beating motions. The beating motion of the cilia helps to move mucus and trapped particles out of the respiratory tract (Bustamante-Marin, et al., Cold Spring Harb. Perspect. Biol. 9, a028241 (2017)).

[0090] Nasal organoids also contain a subpopulation of goblet cells. Morphologically, goblet cells have a rounded shape and an enlarged apical cytoplasm. The most notable feature of goblet cells is the presence of abundant secretory granules in their cytoplasm, which are filled with mucin, the main component of mucus. Goblet cells play a key role in maintaining respiratory health and homeostasis by secreting mucus (Whitsett, Ann. Am. Thorac. Soc., 15: S143–S148 (2018)). The mucus layer produced by goblet cells plays several important functions in the nasal epithelium, including but not limited to capturing and removing foreign particles and lubricating the airways.

[0091] Nasal organoids contain a small subpopulation of club cells, also known as Clara cells. Club cells are non-ciliated, dome-shaped secretory cells with a round nucleus and a well-developed endoplasmic reticulum (Boers, et al., Am. J. Respir. Crit. Care Med., 159: 1585–1591 (1999)). Club cells are typically characterized by the presence of secretory granules containing various bioactive substances that contribute to respiratory defense mechanisms and epithelial homeostasis, including but not limited to detoxification enzymes such as cytochrome P450 monooxygenases and glutathione S-transferases and mucus regulatory factors.

[0092] Nasal organoids may contain one or more other cell types, including but not limited to pulmonary neuroendocrine cells (PNEC), tuft cells, pulmonary ionocytes, and support (supporting cells). PNECs are innervated epithelial resident cells that sense airway activity and secrete neuropeptides to stimulate immune responses (Branchfield, et al., Science 351, 707–710 (2016)). Tuft cells (also called brush cells) are columnar epithelial cells with an elongated shape and a single apical microvilli cluster, hence the name. The microvilli cluster increases the cell surface area, allowing for increased sensory and signaling interactions with the surrounding environment. Tuft cells contain a centrally located nucleus and abundant organelles involved in protein synthesis and secretion (Schneider, et al., Nat. Rev. Immunol. 19, 584–593 (2019)). The cell types that comprise the nasal epithelium are further described in the following studies and review articles: Scherzad et al., J Inflamm Res., 12:309-317 (2019); Harkema et al., Toxicologic Pathology, 34(3):252-269 (2006); and Davis and Wypych, Mucosal Immunology, 14:978-990 (2021); all of which are incorporated herein in their entirety.

[0093] Nasal organoids generally have a molecular structure similar to that of native nasal epithelium. Nasal organoids may express one or more genes selected from the group comprising: angiotensin converting enzyme-2 (ACE2), transmembrane serine protease 2 (TMPRSS2), forkhead box G1 (FOXG1), SIX3, paired box-7 (PAX7), P63, keratin 5 (CK5), Sentan (SNTN), mucin 5AC (MUC5AC), TUBB4B (tubulin β4B class IVb), MUC15 (mucin 15, cell surface associated), OTX1 / 2 and CC10. In some forms, nasal organoids may express one or more cell type markers of basal cells, including but not limited to P63, CK1, CK5, CK10, CK14 and DLK2. In some forms, the nasal organoids can express one or more cell type markers of ciliated cells, including but not limited to LYPD2 (LY6 / PLAUR domain-containing 2), SPRR3 (small proline-rich protein 3), C15orf48 (chromosome 15 open reading frame 48), FOXJ1, ACCTUB, and SNTN. In some forms, the nasal organoids can express one or more cell type markers of secretory goblet cells, including but not limited to LYNX1, S100A4, CEACAM5, LYPD2, PI3, and MUC4.

[0094] In some forms, the nasal organoids may express one or more cell type markers of ionocytes, including but not limited to ASCL3 and CFTR. In some forms, the nasal organoids may express one or more cell type markers of ionocyte regulatory units, including but not limited to ASCL3, FOXI1 and DMRT2. In preferred forms, the nasal organoids express lower levels of tracheal / bronchial related genes, including but not limited to FOLR1, LMO3 and IRX2. In some forms, the differentiated nasal epithelial cell population has about 0.25 times, about 0.50 times, about 0.75 times, about 1.0 times or about 1.25 times lower FOLR1 expression compared to tracheal / bronchial cells. In some forms, the differentiated nasal epithelial cell population has about 1.0 times, about 1.5 times, about 2.0 times, about 2.5 times or about 2.5 times lower LMO3 expression compared to tracheal / bronchial cells. In some forms, a population of differentiated nasal epithelial cells has about 0.5-fold, about 1.0-fold, about 1.5-fold, about 2.0-fold, about 2.5-fold, or about 3.0-fold lower expression of IRX2 compared to tracheal / bronchial cells.

[0095] In some forms, the nasal organoids may express one or more genes associated with viral cells (e.g., coronavirus cells), including but not limited to ACE2 and TMPRSS2. In some forms, the nasal organoids may express one or more genes encoding regulatory units, such as MESP1 (posterior mesoderm BHLH transcription factor 1) (Takahashi et al., Development, 2005; 132: 787–796). In some forms, the nasal organoids may express one or more genes encoding transcription factors associated with the IFN pathway, including but not limited to IRF1, IFI27, and STAT1.

[0096] i. Organization of 3D nasal organoids

[0097] A range of conditions and differentiation protocols were tested to generate 3D differentiated nasal organoids with morphology and function similar to mature nasal epithelium. Thus, in some forms, populations of differentiated nasal epithelial cells were organized into three-dimensional structures, thereby generating differentiated 3D nasal organoids. The 3D nasal organoids generally had a variety of airway epithelial cell types in proportions that differed from 3D undifferentiated organoids and organoids derived from the trachea / bronchioles.

[0098] In some forms, the 3D nasal organoids contain basal cells at a percentage of about 12% to about 35% of the total cells forming the 3D nasal organoid. In some forms, basal cells account for about 12%, about 15%, about 20%, about 25%, about 30%, or about 35% of the total cells forming the 3D nasal organoid. In preferred forms, basal cells account for about 23% of the total cells forming the nasal organoid.

[0099] In some forms, the 3D nasal organoids contain ciliated cells at a percentage of about 35% to about 45% of the total cells forming the 3D nasal organoid. In some forms, ciliated cells account for about 36%, about 37%, about 38%, about 39%, about 40%, about 41%, about 42%, about 43%, about 44%, or about 45% of the total cells forming the 3D nasal organoid. In preferred forms, ciliated cells account for about 40% of the total cells forming the nasal organoid.

[0100] In some forms, the 3D nasal organoids contain goblet cells at a percentage of about 5% to about 10% of the total cells forming the 3D nasal organoid. In some forms, secretory goblet cells account for about 5%, about 6%, about 7%, about 8%, about 9%, or about 10% of the total cells forming the 3D nasal organoid. In preferred forms, goblet cells account for about 8% of the total cells forming the nasal organoid.

[0101] In some forms, the 3D nasal organoids contain rod-shaped cells at a percentage of about 0.1% to about 5% of the total cells forming the 3D nasal organoid. In some forms, secretory rod-shaped cells account for about 0.1%, about 0.5%, about 1%, about 2%, about 3%, about 4%, or about 5% of the total cells forming the 3D nasal organoid. In preferred forms, rod-shaped cells account for about 0.5% of the total cells forming the nasal organoid.

[0102] The differentiated 3D nasal organoids generally have a molecular composition similar to that of native nasal epithelium as described in Section II(A)(1) above. In some forms, the differentiated 3D nasal organoids can express one or more genes associated with viral cells (e.g., coronavirus cells), including but not limited to ACE2 and TMPRSS2.

[0103] In some forms, ACE2 is expressed by about 20% to about 45% of the differentiated nasal cell population of the 3D nasal organoid. In some forms, ACE2 is expressed by about 20%, about 25%, about 30%, about 35%, about 40%, or about 45% of the differentiated nasal cell population of the 3D nasal organoid. Preferably, ACE2 is expressed by about 35% of the differentiated nasal cell population of the 3D nasal organoid.

[0104] In some forms, TMPRSS2 is expressed by about 40% to about 55% of the differentiated nasal cell population of the 3D nasal organoid. In some forms, TMPRSS2 is expressed by about 40%, about 42%, about 44%, about 46%, about 48%, about 50%, about 52%, about 54%, or about 55% of the differentiated nasal cell population of the 3D nasal organoid. Preferably, TMPRSS2 is expressed by about 48% of the differentiated nasal cell population of the 3D nasal organoid.

[0105] ii. Organization of 2D nasal organoid monolayers

[0106] As described in the non-limiting examples, a range of conditions were tested to produce optimized nasal organoid monolayers that better mimic nasal epithelium exposed to invading pathogens. A key feature of the disclosed optimized 2D nasal organoid monolayer is that undifferentiated nasal cells are partially incubated in a differentiation medium having a slightly acidic pH, which is more representative of the physiological environment of the surface fluid in the human airway (including the nasal mucosa). The method for preparing the optimized 2D nasal organoid monolayer is described in detail in Section III below.

[0107] Thus, in some forms, a population of differentiated nasal epithelial cells is organized into a two-dimensional (2D) monolayer, thereby generating differentiated 2D nasal organoids. Similar to differentiated 3D nasal organoids, 2D nasal organoid monolayers typically have a variety of airway epithelial cell types in different proportions than 3D undifferentiated organoids and trachea / bronchiolar-derived organoids.

[0108] In some forms, the 2D nasal organoid monolayer contains basal cells at a percentage of about 1% to about 10% of the total cells forming the 2D nasal organoid monolayer. In some forms, basal cells account for about 1%, about 2%, about 4%, about 6%, about 8%, or about 10% of the total cells forming the 2D nasal organoid monolayer. In preferred forms, basal cells account for about 4% of the total cells forming the 2D nasal organoid monolayer.

[0109] In some forms, the 2D nasal organoid monolayer contains ciliated cells at a percentage of about 75% to about 95% of the total cells forming the 2D nasal organoid monolayer. In some forms, ciliated cells account for about 75%, about 80%, about 85%, about 90%, or about 95% of the total cells forming the 2D nasal organoid monolayer. In preferred forms, ciliated cells account for about 90% of the total cells forming the 2D nasal organoid monolayer.

[0110] In some forms, the 2D nasal organoid monolayer contains goblet cells at a percentage of about 4% to about 24% of the total cells forming the 2D nasal organoid monolayer. In some forms, secretory goblet cells account for about 4%, about 8%, about 12%, about 16%, about 20%, or about 24% of the total cells forming the 2D nasal organoid monolayer. In preferred forms, goblet cells account for about 18% of the total cells forming the 2D nasal organoid monolayer.

[0111] In some forms, the 2D nasal organoid monolayer contains rod-shaped cells at a percentage of about 0.05% to about 2% of the total cells forming the 2D nasal organoid monolayer. In some forms, secretory rod-shaped cells account for about 0.5%, about 1.0%, about 1.5%, or about 2% of the total cells forming the 2D nasal organoid monolayer. In preferred forms, rod-shaped cells account for about 0.5% of the total cells forming the 2D nasal organoid monolayer.

[0112] The differentiated 2D nasal organoid monolayer generally has a molecular composition similar to that of the native nasal epithelium described in Section II(A)(1) above. In some forms, the differentiated 2D nasal organoid monolayer can express one or more genes associated with viral cells (e.g., coronavirus cells), including but not limited to ACE2 and TMPRSS2.

[0113] In some forms, ACE2 is expressed by about 30% to about 55% of the differentiated nasal cell population in a 2D nasal organoid monolayer. In some forms, ACE2 is expressed by about 30%, about 35%, about 40%, about 45%, about 50%, or about 55% of the differentiated nasal cell population in a 2D nasal organoid monolayer. Preferably, ACE2 is expressed by about 45% of the differentiated nasal cell population in a 2D nasal organoid monolayer.

[0114] In some forms, TMPRSS2 is expressed by about 85% to about 100% of the differentiated nasal cell population in a 2D nasal organoid monolayer. In some forms, TMPRSS2 is expressed by about 85%, about 90%, about 95%, or about 100% of the differentiated nasal cell population in a 2D nasal organoid monolayer. Preferably, TMPRSS2 is expressed by about 95% of the differentiated nasal cell population in a 2D nasal organoid monolayer.

[0115] 2. Functions of 2D and 3D nasal organoids

[0116] The disclosed 2D and 3D nasal organoids recapitulate respiratory functions similar to native nasal epithelium, thereby providing an improved research platform to study various aspects of respiratory physiology. For example, as described in a non-limiting example, organoid monolayers induced to differentiate in the apical chamber with slightly acidic medium (pH 6.6) showed a more enhanced epithelial barrier ( Figure 2B ) and higher expression of ACE2 (the cell receptor infected by SARS-CoV-2) ( Figures 3A-3J Notably, the optimized nasal organoid monolayers accurately reproduced the higher infectivity and improved replicative fitness of the Omicron variant compared to previously circulating variants, as measured by flow cytometric analysis of infection rates, viral titration assays for viral multiplication, and competition assays ( Figure 4E-4I ).

[0117] Typically, the different cell types that form 2D and 3D nasal organoids mimic multiple functions that contribute to respiratory defense, sensory perception, and airway maintenance. In some forms, 2D and 3D nasal organoids can exhibit filtration and defense functions. In some forms, goblet cells can produce mucus, and the coordinated movement of cilia on the surface of epithelial cells can mimic natural respiratory physiology that removes trapped particles and promotes their clearance.

[0118] In some forms, 2D and 3D nasal organoids can exhibit humidity and temperature control. A moist mucus layer on the epithelial surface adds moisture to the air, preventing respiratory tissues from overdrying. This humidification process is essential for maintaining optimal conditions for normal function of the respiratory system. In some forms, goblet cells in 3D and 2D nasal organoids produce and secrete mucus, a viscous fluid that helps lubricate the nasal passages and trap inhaled particles and pathogens. In some forms, mucus also contains antimicrobial components, such as antibodies and enzymes, which help defend against infection.

[0119] In some forms, 2D and 3D nasal organoids can mimic the immunophysiology of the nasal epithelium. In some forms, 2D and 3D nasal organoids can contain immune cells, including mast cells, macrophages, and dendritic cells, which actively monitor the nasal environment for potential pathogens or harmful substances. In some forms, immune cells can be included in 2D and 3D nasal organoids to simulate the initiation of an immune response, the release of inflammatory mediators, or the presentation of antigens to activate immune system processes that promote protection against infection or allergic reactions.

[0120] In some forms, 2D organoids can mimic the barrier function of the nasal epithelium. Acts2Dorganoids can exhibit barrier function against pathogens, toxins, and irritants. Tight junctions between epithelial cells form a physical barrier that limits the entry of harmful substances into the underlying tissue. In addition, the epithelium produces antimicrobial peptides and immunoglobulins, further enhancing its protective function.

[0121] In some forms, 2D nasal organoids contain apical junction complexes (AJCs), including tight junctions, adherens junctions, desmosomes, and hemidesmosomes, which connect epithelial cells to each other to form a nasal epithelial barrier. In natural nasal epithelial tissue, tight junctions are epithelial junctions located at the top, which contain more than 40 proteins that are transmembrane proteins or cytoplasmic actin-binding proteins (Campbell et al., Exp Cell Res (2017) 358: 39–44). Tight junctions regulate the homeostasis of ions, water, and certain macromolecules (Georas et al., J Allergy Clin Immunol (2014) 134: 509–20; Georas et al., J Allergy Clin Immunol (2014) 134: 509–20). Therefore, tight junctions are essential for generating a rate-limiting barrier against inhaled pathogens. In some forms, the tight junctions in the 2D nasal organoids include transmembrane proteins such as occludin (OCLN), claudin (CLDN), and junctional adhesion molecule (JAM). In some forms, the tight junctions contain one or more barrier-forming CLDN proteins, such as CLDN1, CLDN3, CLDN4, and CLDN7.

[0122] Adherens junctions are essential for cell adhesion, cell proliferation and differentiation (Bruser et al., Cold Spring Harb Perspect Biol (2017) 9; Campbell et al., Exp Cell Res (2017) 358: 39–44). Desmosomes are closely connected to adherens junctions and play a key role in maintaining intercellular cohesion and cell integrity (Rubsam et al., Cold Spring Harb Perspect Biol (2018) 10; Hatzfeld et al., Cold Spring Harb Perspect Biol (2017) 9). Hemidesmosomes are responsible for promoting stable adhesion of basal epithelial cells to the basement membrane and connecting the extracellular matrix to the intermediate filaments of the actin cytoskeleton. Nasal barrier integrity and tight junctions are further described in Husna et al., Front Immunol., 12:663626 (2021); Zhang et al., European Journal of Allergy and Clinical Immunology, 71(3):295-307 (2016); Laulajainen-Hongisto et al., Front. Cell Dev. Biol., 8:204 (2020); all of which are incorporated herein in their entirety.

[0123] C. Preparation

[0124] Also provided are preparations containing 2D nasal organoid monolayers and 3D nasal organoids. In some forms, the preparations include 2D or 3D nasal organoids provided in a cell culture medium. In some forms, the number of cells in the preparation is about 1 million to 100 million cells, about 5 million to 50 million cells, or preferably about 5 million cells.

[0125] In some forms, the preparation comprises a 3D nasal organoid surrounded by an extracellular matrix (ECM). The injectable material may comprise a biomaterial such as collagen, polyglycolic acid (pga), polylactic acid, alginate (e.g., calcium salt), polyethylene oxide, fibrin adhesive, polylactic acid-polyglycolic acid copolymer, proteoglycan, glycosaminoglycan, natural biomaterial such as Matrigel.

[0126] In some forms, the preparation includes 2D nasal organoid monolayers and 3D nasal organoids provided in a cryopreservative. In some forms, the number of cells in the preparation is about 1 million to 30 million cells, preferably 10 million cells.

[0127] Culture media for preserving cells are known in the art, such as CRYO-GOLD™ (cryopreservation medium) and (Cryopreservation Freezing Medium), which is designed to mitigate temperature-induced molecular cellular stress responses during freezing and thawing. Products are pre-formulated with USP-grade DMSO, an osmotic solute cryoprotectant that helps mitigate the damaging effects of intracellular ice formation. Available in a variety of packages and pre-formulated with DMSO at final concentrations of 2%, 5%, and 10%. Preferred media for cell maintenance include 5%-10% DMSO, e.g. CS10 (a uniquely formulated serum-free, animal component-free, and defined cryopreservation medium containing 10% dimethyl sulfoxide (DMSO)). In addition, cryoprotectants / cryoprotectant additives that can be included in the cell composition (for cryopreservation) are known in the art and include ethylene glycol (EG), antioxidants such as taurine, metformin, gamma-aminobutyric acid (GABA). The cells can be cultured at, for example, about 1-10 x 10 6 The cells are suspended at a density of 10 cells / ml in a "freezing medium", such as a cell culture medium containing 15%-20% fetal bovine serum (FBS) and 7%-10% DMSO, with or without 5%-10% glycerol. The cells are distributed into glass or plastic vials, which are then sealed and transferred to the freezing chamber of a programmable or passive freezer. The optimal freezing rate can be determined empirically. For example, a freezing program with a temperature change of -1°C / min given by the heat of fusion can be used. Once the vials containing the cells reach -80°C, they are transferred to a liquid nitrogen storage area.

[0128] D. Test kit

[0129] The above materials and other materials can be packaged together in any suitable combination as a kit for performing or aiding in the performance of the disclosed methods. It is useful if the kit components in a given kit are designed and adapted for use together in the disclosed methods.

[0130] In some forms, the kit can be a cell culture kit. In some forms, the cell culture kit can include one or more of undifferentiated 3D nasal organoids, culture reagents, and materials suitable for culturing 3D and 2D differentiated nasal organoids.

[0131] In an exemplary form, a kit for generating a two-dimensional monolayer or three-dimensional organoid of human nasal epithelium, the kit may comprise a combination of two or more of the following:

[0132] (i) an expansion medium for deriving 3D undifferentiated nasal cells, comprising a basal medium. The basal medium may comprise one or more buffers, growth factors, ROCK inhibitors, TGFβ inhibitors, MAPK inhibitors, WNT agonists, BMP-4 inhibitors, one or more supplements, and one or more antibiotics;

[0133] (ii) a basal medium containing HEPES buffer, and AdvancedDMEM / F-12 with antibiotics;

[0134] (iii) one or more proximal differentiation media comprising a basal medium supplemented with a γ-secretase inhibitor; and

[0135] (iv) one or more supports or support structures.

[0136] In some forms, one or more culture media in the test kit can be prepared in deionized distilled water. In some forms, one or more culture media are usually sterilized before use to prevent contamination, such as by ultraviolet light, heating, radiation or filtration. In some forms, one or more culture media can be frozen (for example, at -20 ° C or -80 ° C) for storage or transportation. In some forms, one or more culture media can include one or more antibiotics to prevent contamination.

[0137] In some forms, one or more culture media in the test kit can be prepared in deionized distilled water. In some forms, one or more culture media are usually sterilized before use to prevent contamination, such as by ultraviolet light, heating, radiation or filtration. In some forms, one or more culture media can be frozen (for example, at -20 ° C or -80 ° C) for storage or transportation. In some forms, one or more culture media can include one or more antibiotics to prevent contamination. For example, aqueous saline solution, aqueous buffer or culture media.

[0138] One or more culture media in the test kit may be contained in a sealed container to prevent contamination. An airtight sealed container may be preferably used for transportation or storage of the culture media. The container may be any suitable container, such as a flask, plate, bottle, jar, vial or bag.

[0139] The kit can also include instructions for use, such as for using the expansion medium to derive undifferentiated 3D nasal organoids and / or for adjusting the pH of the PD medium to derive 2D nasal monolayer organoids.

[0140] II. Methods for preparing nasal organoids

[0141] Methods for preparing 2D and 3D organoids are also provided. The disclosed methods outline the steps of culturing cells obtained non-invasively from the nasal concha. These methods generally require a two-phase culture system, namely expansion and differentiation culture ( Figure 1A ). Expansion medium maintains long-term expansion of nasal organoids for more than 6 months by directing 3D undifferentiated organoids to an immature state. Defined differentiation protocol to generate differentiated 3D nasal organoids and organoid monolayers ( Figure 1B and 1I ). The differentiated nasal organoids closely mimic the native nasal epithelium. That is, the nasal organoid culture system is able to efficiently reconstruct and stably expand the human nasal epithelium in culture plates for a variety of experimental applications.

[0142] Once established, the 2D and 3D organoids disclosed herein are stable for up to one month, two months, or longer, while showing remarkable phenotypic and genotypic stability. Thus, they overcome the reproducibility and availability limitations of current in vitro model systems. Several lines of 2D and 3D organoids were obtained from the nasal conchae of healthy patients. These 2D and 3D organoids included four major types of airway epithelial cells, namely ciliated cells (ACCTUB+ or FOXJ1+), basal cells (P63+), goblet cells (MUC5AC+), and rod cells (CC10+) ( Figure 2C and Figure 2D In some forms, the generation of 3D organoids or 2D monolayer organoids from turbinate cells using the disclosed methods requires about one week to about four weeks, more preferably about two weeks to about three weeks.

[0143] 1. Cell Source

[0144] A significant advance has been the source of cells used to derive nasal organoids. Nasal epithelial cells are obtained from the inferior turbinates of healthy donors using flocked swabs, a noninvasive procedure that differs from the derivation of lung organoids using cells from bronchoalveolar lavage or resected tissue, which requires invasive procedures by physicians and surgeons. More importantly, previous studies on human intestinal organoids, the first adult stem cell-derived organoid model, have shown that epithelial organoids generated from different intestinal segments retain the structural and functional characteristics from which they were derived (29) because tissue identity is imprinted in adult stem cells and maintained in these organoids during long-term expansion culture (37). Therefore, nasal epithelial cells would be the optimal source for deriving physiologically relevant nasal organoids. Indeed, nasal organoids exhibit compartment-specific gene expression profiles ( Figures 3A-3J ). More importantly, nasal organoids retain the genotypic and phenotypic characteristics of the original cells, which allows the generation of personalized nasal organoids and provides a simple and robust in vitro model of the upper respiratory epithelium for various applications in personalized medicine.

[0145] Interestingly, as described in the non-limiting examples, nasal organoids have been derived with an unexpectedly high success rate. It is speculated that the reason for this excellent efficiency may be that cells were harvested from healthy individuals and COVID-19 patients via nasal brushing, of which approximately 60% were ciliated cells and goblet cells, while suprabasal cells and club cells accounted for approximately 30% of the cells (5). Suprabasal cells are an intermediate cell population between basal cells and club cells (6). Basal / suprabasal cells and club cells have been reported to be progenitor cells for respiratory epithelial regeneration (38-40). These progenitor cells have the ability to clonally expand in vitro and proliferate to form organoids (40-42). The non-limiting examples demonstrated that expansion medium supplemented with R-spondin, Noggin, and FGF maintained the clonogenicity of these progenitor cells and was able to continuously expand undifferentiated nasal organoids for approximately 6 months. The simple cell acquisition procedure circumvents the relatively short expandability of nasal organoids, highlighting nasal organoids as a robust and personalized in vitro model of the nasal epithelium.

[0146] The disclosed 2D and 3D organoids can be cultured from tissue samples, preferably nasal turbinate samples obtained from mammals, such as any mammal, including but not limited to bovine, ovine, porcine, canine, feline, equine, primate. In preferred forms, the tissue sample is obtained from humans. In some forms, nasal turbinate cells are obtained from adolescents or adults.

[0147] In some forms, single cells are obtained from nasal concha samples using a combination of steps that produce single cells. Nasal samples may be aggregated in mucus when collected. Nasal cells can be isolated by dissociating the nasal concha samples used as a cell source using techniques known to those skilled in the art. For example, the nasal concha samples can be mechanically dissociated and treated with digestive enzymes and / or chelating agents to release the cells to form a suspension of single cells. Enzymatic hydrolysis can be accomplished by mechanical dissociation with one or more enzymes, such as trypsin, chymotrypsin, collagenase, elastase and / or hyaluronidase, deoxyribonuclease, pronase, dispase, etc.

[0148] The isolated cells are further cultured as discussed herein. A preferred cell culture medium is a defined synthetic medium buffered to pH 7.4 (preferably between 7.2 and 7.6 or at least 7.2 and not higher than 7.6) with a carbonate-based buffer, while the cells are cultured in an environment comprising 5% to 10% CO2, or at least 5% and not more than 10% CO2, preferably 5% CO2.

[0149] 2. Expansion medium

[0150] Cells are cultured in a supplemented basal cell culture medium. Typically, the expansion medium comprises a basal culture medium comprising one or more buffers, one or more growth factors, a ROCK inhibitor, a TGF inhibitor, a MAPK inhibitor, a WNT agonist, a BMP-4 inhibitor, one or more supplements, and one or more antibiotics. In some forms, the expansion medium is a basal culture medium supplemented with agents such as Rspondin (Wnt agonist), a BMP inhibitor, a TGF-β inhibitor, a fibroblast growth factor (FGF), and nicotinamide.

[0151] In some forms, the basal medium may include at least one carbohydrate as an energy source and / or buffer system to maintain the culture medium within a physiological pH range. Examples of commercially available basal mediums may include, but are not limited to, phosphate buffered saline (PBS), Dulbecco modified Eagle culture medium (DMEM), minimum essential medium (MEM), basal medium Eagle (BME), Roswell Park Memorial Institute culture medium (RPMI) 1640, MCDB 131, Click culture medium, McCoy 5A culture medium, culture medium 199, William culture medium E, insect culture medium such as Grace culture medium, Ham nutrient mixture F-10 (Ham's F-10), Ham's F-12, a-minimum essential medium (aMEM), Glasgow minimum essential medium (G-MEM) and Iscove modified Dulbecco culture medium. Preferred basal cell culture medium is selected from DMEM / F12 and RPMI1640. In further preferred embodiments, Advanced DMEM / F-12 or Advanced RPMI are used, which are optimized for serum-free culture and have included insulin. In this case, the Advanced DMEM / F12 or Advanced RPMI medium is preferably supplemented with glutamine and penicillin / streptomycin. In a preferred form, the basal medium comprises gastrin. In some forms, the basal medium further comprises NAc and / or B27. In some forms, the buffer is a HEPES buffer, which is present in an amount ranging from 0.5% to about 1.5%, preferably about 1.0%.

[0152] In some forms, the expansion medium described in WO2016 / 083613 may be used. In a particularly preferred form, an expansion medium as outlined in Table 1 is used, which is a supplemented basal medium suitable for maintaining 3D undifferentiated organoids in culture.

[0153] In some forms, the supplemented basal medium used to culture cells dissociated from turbinate samples does not include a GSK3 inhibitor, such as CHIR99021 (6-[[2-[[4-(2,4-dichlorophenyl)-5-(5-methyl-1H-imidazol-2-yl)-2-pyrimidinyl]amino]ethyl]amino]-3-pyridinecarbonitrile). Known GSK inhibitors include small interfering RNA, 6-bromoindirubin-30-acetone oxime.

[0154] Preferred expansion medium is shown in Table 1.

[0155] Table 1: Composition of expansion medium

[0156] Reagents company Catalog Number Working concentration AdvancedDMEM / F12 Gibco 12634010 - HEPES Gibco 15630056 1％ GlutaMAX Gibco 35050061 1％ P / S Gibco 15140122 1％ Rspondin1 (Conditioned Medium) - - 10％ Noggin (Conditioned Medium) - - 10％ B27 Supplements Gibco 17504044 - N-Acetylcysteine Sigma A9165 1.25mM Niacinamide Sigma N0636 10mM Y-27632 Tocris 1254 5uM A8301 Tocris 2939 500nM SB202190 Sigma S7067 1uM FGF-7 Peprotech 100-19 5ng / ml FGF-10 Peprotech 100-26 20ng / ml Primocin InvivoGen ant-pm-1 100ug / ml Regulatory protein beta-1 (only for generation 0) Peprotech 100-03 5nM

[0157] The expansion medium includes a BMP inhibitor. A BMP inhibitor is defined as an agent that binds to a BMP molecule to form a complex, wherein the BMP activity is neutralized, such as by preventing or inhibiting the binding of a BMP molecule to a BMP receptor. Alternatively, an inhibitor is an agent that acts as an antagonist or inverse agonist. BMP binding proteins that can be used for the disclosed method include but are not limited to Noggin (Peprotech), chordin and chordin-like proteins (R&D systems) comprising a chordin domain, follistatin and follistatin-related proteins (R&D systems) comprising a follistatin (follistatin) domain, DAN and DAN-like proteins (R Systems) comprising a DAN cysteine ​​knot domain, sclerostin / SOST (R&D systems), decorin (R&D systems) and alpha-2 macroglobulin (R&D systems). The most preferred BMP inhibitor is Noggin. In some forms, Noggin is present in a basal medium at a concentration of about 8% to about 12%. Noggin is preferably added to the basal medium at a concentration of at least about 10%.

[0158] The expansion medium includes a WNT agonist. Wnt agonists include the Rspondin family of secreted proteins, which includes 4 members (R-spondin 1 (NU206, Nuvelo, San Carlos, CA), R-spondin 2 ((R&Dsytems), R-spondin 3 and R-spondin-4) and Norrin. In a preferred embodiment, the Wnt agonist is selected from the group consisting of R-Spondin, Wnt-3a and Wnt-6. The preferred concentration of the Wnt agonist for R-spondin is about 10%, and the preferred concentration for WNt-3a is about 100ng / ml or 100ng / ml. In some preferred forms, the WNT agonist is not a GSK inhibitor.

[0159] In some forms, the WNT agonist is RSpondin 1, which is present in an amount of about 8% to about 12%, preferably about 10%. In some forms, RSpondin 1 and / or Noggin are added to the culture medium as conditioned medium, which is culture medium harvested from a stable cell line expressing RSpondin 1 and Noggin. As used herein, the percentage of an agent in the culture medium refers to the volume percentage, for example, 10 ml of each conditioned medium can be added to 100 ml of basal medium to prepare an expansion medium containing 10% of each supplement. The mathematical calculations involved in preparing the solutions are further described in Stephenson, "Calculations for Molecular Biology and Biotechnology", 3 rd Edition, Chapter 2—Solutions, Mixtures, and Media, pages 15-42 (2016), the entire contents of which are incorporated herein.

[0160] The expansion medium includes a MAPK inhibitor. SB202190 (4-(4-fluorophenyl)-2-(4-hydroxyphenyl)-5-(4-pyridinyl)-1H-imidazole) is a highly selective, potent and cell permeable inhibitor of p38 MAP kinase. SB 202190 binds within the ATP pocket of the active kinase (Kd = 38 nM, as measured in recombinant human p38) and selectively inhibits p38 α and β isoforms. Other useful p38 MAPK inhibitors include, but are not limited to, SB203580 (4-[5-(4-fluorophenyl)-2-[4-(methylsulfonyl)phenyl]-1H-imidazol-4-yl]pyridine); SB 203580 hydrochloride (4-[5-(4-fluorophenyl)-2-[4-(methylsulfonyl)phenyl]-1H-imidazol-4-yl]pyridine hydrochloride); SB202190 (4-[4-(4-fluorophenyl)-5-(4-pyridinyl)-1H-imidazol-2-yl]phenol); DBM 1285 dihydrochloride (N-cyclopropyl-4-[4-(4-fluorophenyl)-2-(4-piperidinyl)-5-thiazolyl]-2-pyrimidinamine dihydrochloride); SB 239063 (trans-4-[4-(4-fluorophenyl)-5-(2-methoxy-4-pyrimidinyl)-1H-imidazol-1-yl]cyclohexanol); SKF 86002 dihydrochloride (6-(4-fluorophenyl)-2,3-dihydro-5-(4-pyridinyl)imidazo[2,1-b]thiazole dihydrochloride). In some forms, the MAPK inhibitor is SB202190, and its concentration is about 0.5 μM to about 1.5 μM, preferably about 1.0 μM.

[0161] The expansion medium contains one or more TGF inhibitors. A8301 (3-(6-methyl-2-pyridinyl)-N-phenyl-4-(4-quinolinyl)-1H-pyrazole-1-thiocarboxamide) is an effective inhibitor of TGF-β type I receptor ALK5 kinase, type I activin / nodal receptor ALK4, and type I nodal receptor ALK7. A83-01 can be added to the culture medium at a concentration of 10nM to 10μM, or 20nM to 5μM, or 50nM to 1μM. For example, A83-01 can be added to the culture medium at about 500nM. Other useful TGF-β type I receptor inhibitors include, but are not limited to, SB431542 (4-[4-(1,3-benzodioxol-5-yl)-5-(2-pyridinyl)-1H-imidazol-2-yl]benzamide); LY R268712 (4-[2-Fluoro-5-[3-(6-methyl-2-pyridinyl)-1H-pyrazol-4-yl]phenyl]-1H-pyrazole-1-ethanol); SB525334 (6-[2-(1,1-dimethylethyl)-5-(6-methyl-2-pyridinyl)-1H-imidazol-4-yl]quinoxaline); and SB505124 (2-[4-(1,3-benzodioxol-5-yl)-2-(1,1-dimethylethyl)-1H-imidazol-5-yl]-6-methyl-pyridine). In a preferred form, the TGF inhibitor is A8301, which is present at a concentration of about 400 nM to about 600 nM, preferably about 500 nM.

[0162] The expansion medium contains one or more ROCK inhibitors. Y-27632 (trans-4-[(1R)-1-aminoethyl]-N-4-pyridylcyclohexanecarboxamide dihydrochloride) is a selective p160 ROCK inhibitor. Other useful Rho inhibitors include isoquinoline and (S)-(+)-2-methyl-1-[(4-methyl-5-isoquinolyl)sulfonyl]-hexahydro-1H-1,4-diazepine Dihydrochloride (H-1152; Tocris Bioscience). In a preferred form, the ROCK inhibitor is Y-27632, and its concentration is about 3 μM to about 7 μM, preferably about 5 μM.

[0163] In a particularly preferred form, the expansion medium or PD cell culture medium used in the disclosed method includes an ErbB3 / 4 ligand (e.g., human neuregulin beta-1). The ErbB receptor tyrosine kinase family consists of four cell surface receptors: ErbBl / EGFR Her1, ii) ErbB2 / HER2, iii) ErbB3 / HER3, and iv) ErbB4 / HER4. ErbB3 / 4 ligands include members of the neuregulin / regulatory protein family. The neuregulin / regulatory protein family is referred to herein as the neuregulin family. The neuregulin family is a family of structurally related polypeptide growth factors that are the gene products of the alternatively spliced ​​genes NRG1, NRG2, NRG3, and NRG4. In a more preferred form, one or more ErbB3 / 4 ligands excluded from the culture medium are polypeptides that are gene products of one or more of NRG1, NRG2, NRG3, and NRG4, i.e., neuregulin polypeptides).

[0164] In some forms, the expansion medium may include one or more supplements, growth factors and / or antibiotics. Cell culture supplements are growth medium additives required for healthy expansion or differentiation of cells. Certain cell types, such as mammalian cells, require additional compounds in addition to the basal medium. These include amino acids (such as L-glutamine), glucose, vitamins, and proteins. In some forms, the one or more supplements are selected from the group consisting of: an amount of about 0.5% to about 1.5%, preferably about 1% B27 supplement, N-acetylcysteine ​​at a concentration of about 1.0 mM to about 1.5 mM, preferably about 1.25 mM, and niacinamide at a concentration of about 7 mM to about 13 mM, preferably about 10 mM.

[0165] In some forms, the expansion culture medium may include one or more growth factors. Growth factors are typically small proteins or peptides that act as signal transduction molecules, which transmit specific instructions to cells to regulate their behavior. Growth factors are added to the culture medium, providing cells with necessary signals to support their growth and maintain their specific functions in vitro, and promoting cell proliferation, differentiation and maintaining cell viability. In some forms, the one or more growth factors are selected from the group comprising: epidermal growth factor (EGF) and fibroblast growth factor (FGF), wherein the growth factor is preferably a concentration of about 3ng / ml to about 7ng / ml, preferably about 5ng / ml FGF-7, and a concentration of about 15ng / ml to about 25ng / ml, preferably about 20ng / ml FGF-10.

[0166] In some forms, the expansion medium contains one or more antibiotics and / or antifungals. Antibiotics and antifungals are often added to cell culture media to help prevent the growth of contaminating bacteria, fungi, and mycoplasmas. In addition, certain selection antibiotics are used to select and establish eukaryotic cells modified by genetic engineering. In some forms, one or more antibiotics are selected from the group comprising: penicillin-streptomycin in an amount of about 0.5% to about 1.5%, preferably about 1.0%, and primocin in a concentration of about 75 g / ml to about 125 g / ml, preferably about 100 g / ml.

[0167] 3. Proximal Differentiation Medium

[0168] Preferred PD medium is a cell culture medium suitable for culturing nasal epithelial organoids. In some embodiments, the PD medium is serum-free and / or BPE-free (bovine pituitary extract). An example of a suitable PD medium is the commercially available PneumaCult-ALI medium (StemCell Technologies). PneumaCult TM -ALI Medium is a serum- and BPE-free medium for culturing human airway epithelial cells at the air-liquid interface (ALI). TM -Airway epithelial cells cultured in ALI medium undergo extensive mucociliary differentiation to form a pseudostratified epithelium that exhibits morphological and functional characteristics similar to those of the human airway in vivo. PneumaCult TM -ALI medium supports the generation of differentiated nasal organoids in either 2D or 3D culture systems.

[0169] In a particularly preferred form, the proximal differentiation medium contains a basal medium supplemented with a γ-secretase inhibitor at a concentration of about 7 μM to about 13 μM, preferably about 10 μM, and wherein the pH of the proximal differentiation medium is about 7.2 to about 7.6, preferably about 7.4.

[0170] In a particularly preferred embodiment, the PD medium is supplemented with a notch inhibitor, preferably at a concentration ranging from 5 μM to 30 μM, preferably from 10 μM to 20 μM, more preferably about 10 μM.

[0171] Examples of preferred Notch inhibitors that can be used in the context of the present invention are: γ-secretase inhibitors, such as DAPT or dibenzazepines (DBZ) or benzodiazepine (BZ) or LY-411575, an inhibitor capable of reducing ligand-mediated Notch activation (e.g., via a dominant negative ligand of Notch or via a dominant negative Notch or via an antibody capable of at least partially blocking the interaction between a Notch ligand and Notch), or an inhibitor of ADAM proteases. In a particularly preferred embodiment, the notch inhibitor is DAPT ([N-(N-[3,5-difluorophenylacetyl]-L-alanyl)-S-phenylglycine tert-butyl ester).

[0172] The isolated cells cultured in the expansion medium are then cultured in the PD medium for a period of time effective to form PD-organoids. In one preferred form, the period of time effective to form PD-organoids is about 5 to about 8 days. In another preferred embodiment, the period of time effective to form airway organoids is about 6 to about 7 days.

[0173] 4.3D nasal organoids

[0174] Improved procedures for generating the disclosed differentiated 3D nasal organoids have been established. As described in the non-limiting examples, a range of conditions and differentiation protocols were tested to generate 3D differentiated nasal organoids with morphology and function similar to mature nasal epithelium.

[0175] The method for generating highly differentiated 3D nasal organoids generally comprises the following steps:

[0176] (i) obtaining nasal turbinate cells capable of differentiating into nasal epithelial cells;

[0177] (ii) adhering the turbinate cells from step (i) to a support structure that promotes (3D) organoid formation;

[0178] (iii) culturing the turbinate cells from step (ii) on a support structure in an expansion medium for a period of time to produce 3D nasal undifferentiated cells, wherein the period of time is about 8 days to about 12 days, preferably about 10 days;

[0179] (iv) culturing the 3D nasal undifferentiated cells from step (iii) on the support structure in a basal medium for a period of time to expand the central cavity, wherein the period of time is about 3 days to about 5 days, preferably about 4 days;

[0180] (v) culturing the 3D nasal undifferentiated cells from step (iv) in a proximal differentiation medium on a support structure for a period of time to generate 3D differentiated organoids of said human nasal epithelium, wherein said period of time is about 5 days to about 7 days, preferably about 6 days.

[0181] In some forms, the expansion medium comprises a basal medium. In some forms, the basal medium contains one or more buffers, one or more growth factors, a ROCK inhibitor, a TGF inhibitor, a MAPK inhibitor, a WNT agonist, a BMP-4 inhibitor, one or more supplements, and one or more antibiotics.

[0182] In some forms, the basal medium is Dulbecco's Modified Eagle Medium (DMEM), Advanced DMEM / F12, RPMI-1640, or Minimum Essential Medium (MEM). In some forms, the basal medium is Advanced DMEM-F12. In some forms, the buffer is HEPES buffer. In some forms, the HEPES buffer is present in the basal medium in an amount ranging from 0.5% to about 1.5%. Preferably, the HEPES buffer accounts for 1.0% of the total concentration of the basal medium. In some forms, the basal medium is supplemented with about 1% HEPES buffer, about 1% and Advanced DMEM / F-12 with approximately 1% penicillin-streptomycin.

[0183] In some forms, one or more growth factors are selected from the group comprising epidermal growth factor (EGF) and fibroblast growth factor (FGF). In a preferred form, the growth factor is FGF-7. In some forms, FGF-7 is present at a concentration of about 3ng / ml to about 7ng / ml. In a preferred form, FGF-7 is present at about 5ng / ml. In another embodiment, the FGF is FGF-10. In these forms, FGF-10 is present at a concentration of about 15ng / ml to about 25ng / ml. Preferably, FGF-10 is present at a concentration of about 20ng / ml.

[0184] In some forms, the ROCK inhibitor is Y-27632. In some forms, the ROCK inhibitor is present at a concentration of about 3 μM to about 7 μM. Preferably, the ROCK inhibitor is present at a concentration of about 5 μM. In some forms, the TGF-inhibitor is A8301. In some forms, the TGF-inhibitor is present at a concentration of about 400 nM to about 600 nM. Preferably, the TGF-inhibitor is present at a concentration of about 500 nM.

[0185] In some forms, the MAPK inhibitor is SB202190, which is present at a concentration of about 0.5 μM to about 1.5 μM, preferably 1.0 μM. In some forms, the WNT agonist is RSpondin 1, which is present in an amount of about 8% to about 12%, preferably about 10%. In some forms, RSpondin 1 and / or Noggin are added to the culture medium as conditioned medium, which is medium harvested from a stable cell line expressing RSpondin 1 and Noggin. As used herein, the percentage of an agent in the culture medium refers to the volume percentage, for example, 10 ml of each conditioned medium can be added to 100 ml of basal medium to prepare an expansion medium containing 10% of each supplement. The mathematical calculations involved in preparing the solutions are further described in Stephenson, "Calculations for Molecular Biology and Biotechnology", 3 rd Edition, Chapter 2—Solutions, Mixtures, and Media, pages 15-42 (2016), the entire contents of which are incorporated herein. In some forms, the BMP-4 inhibitor is Noggin, which is present at a concentration of about 8% to about 12%, preferably about 10%.

[0186] In some forms, one or more supplements are selected from the group consisting of: B27 supplement, N-acetylcysteine ​​at a concentration of about 1.0 mM to about 1.5 mM, preferably about 1.25 mM, and niacinamide at a concentration of about 7 mM to about 13 mM, preferably about 10 mM;

[0187] In some forms, the one or more antibiotics are selected from the group comprising: penicillin-streptomycin in an amount of about 0.5% to about 1.5%, preferably about 1.0% and primocin in a concentration of about 75 g / ml to about 125 g / ml, preferably about 100 g / ml.

[0188] In some forms, the support structure comprises a material selected from the group consisting of: RGD-functionalized PEG hydrogels, collagen, hyaluronic acid extracellular matrix, synthetic hydrogels, decellularized extracellular matrix, alginate, poly(lactic-co-glycolic acid) (PLGA), or electrospun fibers cross-linked with Factor XIIIa.

[0189] In a preferred form, the method is performed using a commercially available extracellular matrix. Preferred ECMs for use in the methods of the present invention include at least two different glycoproteins, such as two different types of collagen, or collagen and laminin. In a preferred form, the method is performed using a commercially available extracellular matrix such as MATRIGEL TM (growth factor-reduced basement membrane matrix), the extracellular matrix comprising laminin, entactin and collagen IV. Other extracellular matrices (ECM) for culturing cells are known in the art. Typically, the extracellular matrix comprises laminin, entactin and collagen. In a preferred form, the method is performed using a three-dimensional culture device (chamber) that simulates the in vivo environment for culturing cells, wherein preferably, the extracellular matrix is ​​formed in a plate that can induce stem cell proliferation under hypoxic conditions. Such three-dimensional devices are known in the art. Other commercially available products include Basement membrane extract (BME; Trevigen). Polyethylene glycol (PEG), polyvinyl alcohol (PVA), polylactide-co-glycolide (PLG), and polycaprolactone (PLA) are common materials used to form synthetic scaffolds. Scaffold-free 3D cell spheroids can be produced in suspension by forced floating, hanging drop, or stirring-based methods. Edmondson, et al., Assay Drug. Dev. Technol., 12(4): 207-218 (2014). For example, isolated cells are embedded in 60% MATRIGEL before culturing in expansion medium. TM and inoculated in suspension culture plates.

[0190] In some forms, the proximal differentiation medium contains a basal medium supplemented with a γ-secretase inhibitor at a concentration of about 7 μM to about 13 μM, preferably about 10 μM, and wherein the proximal differentiation medium has a pH of about 7.2 to about 7.6, preferably about 7.4.

[0191] In some forms, the method for generating 3D organoids further comprises replenishing the expansion medium once a day, three times a week, or four times a week. In some forms, the method for generating 3D organoids further comprises re-plating and passage the 3D human nasal undifferentiated cells one or more times. In some forms, the method for generating 3D nasal organoids further comprises passage undifferentiated nasal cells at a ratio of about 1:3, about 1:4, about 1:5, about 1:6, about 1:7, about 1:9, or about 1:10, or about 1:11.

[0192] 5.2D Nasal Organoid Monolayer

[0193] Also disclosed are methods for generating 2D nasal organoid monolayers. Non-limiting examples demonstrate optimized procedures that can be used to generate superior nasal organoid monolayers that better mimic nasal epithelium exposed to invading pathogens. As described in the Examples, a key step in the disclosed methods for generating optimized 2D nasal organoid monolayers is the partial incubation of undifferentiated nasal cells in a differentiation medium having a slightly acidic pH. This acidic pH has been found to be more representative of the physiological environment of surface fluids in the human airway, including the nasal mucosa.

[0194] The disclosed method for generating a 2D nasal organoid monolayer from 3D nasal undifferentiated cells comprises the following steps:

[0195] (i) dissociating 3D nasal undifferentiated cells into single nasal undifferentiated cells;

[0196] (ii) transferring the single nasal undifferentiated cell of step (ii) to a dual chamber support structure and culturing them in an expansion medium for a period of time to allow the cells to attach and expand, wherein the period of time is about 1 day to about 3 days; and

[0197] (iii) culturing the nasal undifferentiated cells of step (ii) in the first and second proximal differentiation media for a total of about 8 days to generate a confluent two-dimensional (2D) organoid monolayer.

[0198] In some forms, the dual chamber support structure comprises a top chamber and a bottom chamber, and wherein the single nasal undifferentiated cell is adhered to the top chamber of the support structure.

[0199] In some forms, step (iii) further comprises: (a) adding the first proximal differentiation medium to the top chamber and the bottom chamber to incubate the nasal undifferentiated cells for about 2 days, wherein the pH of the first proximal differentiation medium is about 7.2 to about 7.6, preferably about 7.4, and (b) replacing the first proximal differentiation medium in the top chamber with the second proximal differentiation medium for about 6 days, wherein the pH of the second proximal differentiation medium is about 6.4 to about 6.8, preferably about 6.6.

[0200] In some forms, dissociated undifferentiated nasal epithelial cells are cultured as a monolayer, preferably on a permeable support (cell culture insert) in expansion medium in a humidified incubator at 37°C, 5% CO2 for 1-2 days, and then cultured as a monolayer in PD medium for a period of 5-16 days, preferably 10-14 days, more preferably about 12-14 days to obtain a 2D organoid monolayer. PD medium is preferably provided on the apical and basolateral sides of the monolayer. Permeable supports are commercially available, for example Transwell inserts are convenient, ready-to-use permeable supports prepackaged in standard multiwell plates. The unique self-centering hanging design prevents media wicking between the insert and the outer wells. Transwell inserts are available in a variety of sizes, membrane types, and configurations.

[0201] III. Methods of Using Nasal Organoids

[0202] Methods of using in vitro generated organoids and compositions thereof are disclosed. In vitro generated organoids are particularly suitable for research purposes, providing an optimized cell model for the study of nasal biology and respiratory disease pathology. In vitro generated organoids are also particularly suitable for biomarker identification, and for the evaluation of new molecules and existing therapeutics for the treatment of respiratory infections and / or diseases. As described in Section II(A) above, the in vitro generated organoids can be 3D nasal organoids or 2D nasal organoid monolayers (referred to herein as "nasal organoids").

[0203] a. Provide cell models for studying upper respiratory tract biology and disease pathology

[0204] Nasal organoids can be used to study respiratory biology in a physiologically relevant manner; therefore, enabling a better understanding of the mechanisms underlying nasal epithelial tissue function and the impact of pathogens and respiratory disease. In some formats, nasal organoids can be used to study morphological features, cellular interactions, molecular dynamics, and tissue architecture that are specific to upper respiratory epithelium. In some formats, nasal organoids can be used to explore ciliary beating, mucociliary clearance, mucus production, and barrier function of the nasal epithelium.

[0205] Nasal organoids can be used to study the effects of environmental factors and genetic modification on health and disease. In some forms, nasal organoids can be used to simulate various nasal diseases and conditions, including respiratory infections, allergies, chronic sinusitis and nasal polyps. By incorporating patient-derived cells or genetically modified cells into nasal organoids, researchers can simulate specific disease phenotypes and study the potential mechanisms of disease development and progression. For example, nasal organoids can be derived from patient samples or genetically modified to express specific immune factors, which contribute to the study of individual changes in susceptibility to certain allergens (such as pollen, dust mites or pet dander). Therefore, nasal organoids can be used to study the effects of genetic factors on the development of allergic rhinitis (hay fever), and explore potential personalized treatment methods. Another example is to use nasal organoids to study inflammatory conditions that develop in the absence of immune-mediated allergic reactions, such as inflammatory conditions triggered by irritants such as strong odors, smoke, air pollution, temperature changes or hormone imbalances.

[0206] Nasal organoids provide a platform for studying host-pathogen interactions in the human respiratory tract. For example, researchers can infect nasal organoids with respiratory viruses or bacteria to study cellular responses, immune interactions, and molecular pathways involved in the infection process. This enables a deeper understanding of viral or bacterial pathogenesis and the development of antiviral or antibacterial strategies. In some formats, nasal organoids can be used to study how pathogens manipulate host cell signaling pathways and immune responses, such as pathogen evasion strategies, host innate immune responses, and activation of pro-inflammatory pathways, providing insight into the interaction between pathogens and the nasal epithelium. In some formats, nasal organoids provide a valuable platform for studying host immune responses to pathogenic infections, such as activation of immune cells, production of cytokines, and recruitment of immune cells to sites of infection.

[0207] In an exemplary form, nasal organoids can be infected with a variety of respiratory viruses, including but not limited to influenza virus, respiratory syncytial virus (RSV), coronaviruses (e.g., SARS-CoV-2), and rhinoviruses. Infection of organoids with the viruses can facilitate the study of viral entry, replication, and spread within the nasal epithelium, closely mimicking the in vivo infection process. The disclosed nasal organoids also provide a platform for studying the effects of viral variants and mutations on viral infectivity, replication, and interaction with the nasal epithelium. Such knowledge is critical for understanding the emergence of new viral strains and developing strategies to slow their spread. For example, it was demonstrated that 2D and 3D organoids reproduced the increased susceptibility of nasal epithelial tissue to infection with the SARS-CoV-2 variant strains Delta and Omicron compared to the ancestral wild-type strains ( Figure 3C-3G ).

[0208] In other exemplary forms, nasal organoids provide a controlled system to study potential mechanisms of viral pathogenesis by facilitating the examination of interactions between the virus and different cell types within the organoid. Exemplary parameters that can be assessed include, but are not limited to, cell tropism, viral replication kinetics, and the effects of viral infection on the nasal tissue microenvironment. Non-limiting examples demonstrate the use of 2D and 3D organoids to determine the effects of SARS-CoV-2 infection on cell adhesion, such as the strength of tight junctions ( Figures 6A-6G ), and mucociliary clearance by ciliated and goblet cells ( Figures 5A-5C ).

[0209] 1. Exemplary Pathogens

[0210] Nasal organoids can be used to study a variety of pathogens that infect and / or disrupt nasal epithelial function, including but not limited to viruses, bacteria, and fungi.

[0211] a. Coronavirus

[0212] As extensively characterized in the non-limiting examples, the optimized nasal organoid monolayers fully reproduced the high infectivity of SARS-CoV-2 in the upper respiratory tract, particularly the highly transmissible Delta and Omicron variants. Notably, in nasal organoids, the Omicron variant exhibited significantly higher replication fitness and infection rates than the early circulating variants and surpassed the latter in competition assays, indicating that nasal organoids are able to reproduce the infectivity of emerging SARS-CoV-2 variants ( Figure 4E-4I ). In contrast, the Omicron and Delta variants showed lower replication fitness than the WT strain in Vero E6 / TMPRSS2 cells ( Figure 4M-4P ), highlighting the strength of biologically relevant nasal organoids ( 43 ).

[0213] In some forms, coronavirus is derived from mammal or non-mammalian coronavirus, such as human coronavirus, cat coronavirus, canine coronavirus, porcine coronavirus, bovine coronavirus, dromedary camel coronavirus, mouse coronavirus or its variant. In a preferred form, coronavirus particles are derived from human coronavirus. In some forms, coronavirus particles are human coronavirus 229E (HCoV-229E) particles, human coronavirus OC43 (HCoV-OC43) particles, human coronavirus NL63 (HCoV-NL63) particles, human coronavirus HKU1 (HCoV-HKU1) particles, Middle East respiratory syndrome coronavirus (MERS-CoV) particles, severe acute respiratory syndrome coronavirus 1 (SARS-CoV-1) particles, SARS-CoV-2 particles and / or its variant particles. In some forms, culture coronavirus is alpha coronavirus, beta coronavirus, delta coronavirus and / or gamma coronavirus, or its subvariant and / or subvariant particles.

[0214] i. Coronavirus and SARS-CoV-2

[0215] The coronaviruses (Nidovirales, Coronaviridae, and Genus Coronavirus) are a diverse group of large, enveloped, positive-strand RNA viruses that cause respiratory and enteric illness in humans and other animals.

[0216] Coronaviruses generally have narrow host specificity and can cause severe disease in many animals, and several, including infectious bronchitis virus, feline infectious peritonitis virus, and transmissible gastroenteritis virus, are important veterinary pathogens. Human coronaviruses (HCoVs) exist in group 1 (HCoV-229E) and group 2 (HCoV-OC43) and historically account for approximately 30% of mild upper respiratory tract illnesses.

[0217] Their genomes are about 30,000 nucleotides, the largest of all RNA viruses. There are three groups of coronaviruses; Groups 1 and 2 contain mammalian viruses, while Group 3 contains only avian viruses. Within each group, coronaviruses are divided into different species based on host range, antigenic relationships, and genome structure. The genome structure is typical of coronaviruses, with a characteristic gene order (5'-replicase [rep], spike [S], envelope [E], membrane [M], nucleocapsid [N]-3') and short untranslated regions at both ends. The SARS-CoV rep gene comprises approximately two-thirds of the genome and encodes two polyproteins (encoded by ORF1a and ORF1b) that undergo co-translational proteolytic processing. There are four open reading frames (ORFs) downstream of rep that are predicted to encode the structural proteins S, E, M, and N, which are common to all known coronaviruses.

[0218] In some forms, the coronavirus particles are derived from COVID associated with the SARS-CoV-2 beta coronavirus of the subgenus Sarbecovirus. The SARS-CoV-2 virus has approximately 79% genome sequence identity with the SARS-CoV virus identified in 2003. The genome structure of the SARS-CoV-2 virus is shared with other beta coronaviruses; six functional open reading frames (ORFs) are arranged in order from 5' to 3': replicase (ORF1a / ORF1b), spike (S), envelope (E), membrane (M), and nucleocapsid (N). In addition, seven putative ORFs encoding accessory proteins are interspersed between the structural genes.

[0219] In some forms, the coronavirus particles are derived from variants of SARS-CoV-2, such as SARS-CoV-2B.1.1.7 (alpha variant), SARS-CoV-2B.1.351 (beta variant), SARS-CoV-2P.1 (gamma variant), SARS-CoV-2B.1.617, SARS-CoV-2B.1.617.1 (kappa variant), SARS-CoV-2B.1.621 (mu variant), SARS-CoV-2B.1.617.2 (delta variant), SARS-CoV-2B.1.617.3, and SARS-CoV-2B.1.1.529 (omega variant). In some forms, the SARS-CoV-2 particle is a SARS-CoV-2 alpha variant particle, a SARS-CoV-2 beta variant particle, a SARS-CoV-2 gamma variant particle, a SARS-CoV-2 delta variant particle, a SARS-CoV-2 epsilon variant particle, a new SARS-CoV-2 eta variant particle, a SARS-CoV-2 ι variant particle, a SARS-CoV-2 kappa variant particle, a SARS-CoV-2 μ variant particle, a SARS-CoV-2 omega variant particle, a SARS-CoV-2 omega variant particle, a SARS-CoV-2 zeta variant particle, a SARS-CoV-2 1.617.3 variant particle, and / or a SARS-CoV-2 lambda variant particle.

[0220] In some forms, the coronavirus particle can be derived from a subvariant of SARS-CoV-2B.1.1.7 (alpha variant), a subvariant of SARS-CoV-2B.1.351 (beta variant), a subvariant of SARS-CoV-2P.1 (gamma variant), a subvariant of SARS-CoV-2B.1.617, a subvariant of SARS-CoV-2B.1.617.1 (kappa variant), a subvariant of SARS-CoV-2B.1.617.1 (mu variant), a subvariant of SARS-CoV-2B.1.617.2 (delta variant), a subvariant of SARS-CoV-2B.1.617.3, or a subvariant of SARS-CoV-2B.1.1.529 (omicron variant), or a subvariant derived from a descendant lineage of one or more of the foregoing subvariants. For example, when the SARS-CoV-2 variant is an Omicron variant, the Omicron subvariant can be a BA.1 subvariant, a BA.2 subvariant, a BA.3 subvariant, a BA.4 subvariant, a BA.5 subvariant, or a BA.1 / BA.2 epidemic recombinant subvariant, such as XE.

[0221] ii. SARS-CoV

[0222] In some forms, coronaviruses are derived from the replication of SARS-CoV and its variants. SARS-CoV predisposes the host to severe acute respiratory syndrome, also known as SARS. SARS is caused by a SARS coronavirus called SARS CoV. SARSCoV is thought to be a strain of coronavirus normally found only in small mammals that has mutated to allow it to infect humans.

[0223] A wide range of clinical manifestations can be seen in SARS patients, ranging from mild, moderate to severe as well as rapidly progressive and fulminant illness. The estimated mean incubation period of SARS-CoV infection is 4.6 days (95% CI, 3.8-5.8 days), with 95% of onset occurring within 10 days. The mean time from symptom onset to hospitalization ranges from 2 to 8 days but is shorter in the later stages of the epidemic. The mean time from symptom onset to the need for invasive mechanical ventilation (IMV) and death is 11 days and 23.7 days, respectively.

[0224] The main clinical features of SARS are fever, chills, chills, myalgia, dry cough, malaise, dyspnea, and headache. Sore throat, sputum, rhinorrhea, nausea, vomiting, and dizziness are less common. Watery diarrhea is present in 40% to 70% of SARS patients and tends to occur about 1 week after the onset of the disease. SARS-CoV was detected in the serum and cerebrospinal fluid of 2 patients with status epilepticus. Elderly patients infected with SARS-CoV may present with loss of appetite, decreased general health, falls leading to fractures, and confusion, but some elderly subjects may not experience a febrile reaction. In contrast, SARS-CoV infection in children under 12 years of age is generally mild, while infection in adolescents is similar to that in adults. Mortality rates in young children and adolescents are low. SARS-CoV infection acquired during pregnancy has a case fatality rate of 25% and is associated with a high incidence of spontaneous abortion, premature birth, and intrauterine growth retardation in neonates without perinatal SARS-CoV infection.

[0225] Asymptomatic SARS-CoV infection was uncommon in 2003; a meta-analysis showed an overall seroprevalence of 0.1% (95% CI, 0.02-0.18) in the general population and 0.23% (95% CI, 0.02-0.45) in health care workers, compared with healthy blood donors, other persons from the general community, or patients without SARS-CoV infection recruited from health care settings (0.16%, 95% CI, 0-0.37).

[0226] The clinical course of patients with SARS-CoV infection appears to present in distinct phases. During the first week of illness with SARS-CoV infection, many patients present with fever, nonproductive cough, myalgia, and malaise, which may improve despite the presence of lung consolidation and rising viral loads in serial samples. During the second week, many patients experience recurrence of fever, worsening consolidation, and respiratory failure, while approximately 20% of patients progress to ARDS requiring IMV. The peak viral load on day 10 of illness corresponds in time to the peak extent of radiographic consolidation and is at greatest risk for nosocomial transmission, particularly to health care workers.

[0227] SARS-CoV particles can be extracted from patients infected with SARS-CoV and / or its variants for viral research and / or antiviral drug evaluation.

[0228] iii.MERS-CoV

[0229] In some forms, the disclosed compositions and methods of use thereof can be used to study and test Middle East Respiratory Syndrome-related Coronavirus (MERS-CoV) and its variants. MERS-CoV predisposes hosts to Middle East Respiratory Syndrome (MERS). MERS-CoV is a coronavirus believed to have originated from bats. However, humans are usually infected by camels through direct or indirect contact. Human-to-human transmission usually requires close contact with an infected person. As of 2021, there is no specific vaccine or treatment for the disease, although attempts are being made.

[0230] The virus MERS-CoV is a member of the betacoronavirus lineage C of the coronavirus beta group. The MERS-CoV genome is phylogenetically divided into two clades, clade A and clade B. The earliest cases are in the clade A cluster, while most recent cases are in the genetically distinct clade B. MERS-CoV is closely related to bat coronavirus HKU4 and bat coronavirus HKU5.

[0231] The specific exposures leading to sporadic MERS-CoV infection are unknown, making it challenging to estimate the incubation period for primary cases. However, based on data from human-to-human transmission, the median incubation period is 5–7 days, with a range of 2–14 days (median 5.2 days [95% CI 1.9–14.7]). Longer incubation periods of up to 20 days may occur in immunocompromised patients.

[0232] iv. Common human coronaviruses

[0233] Unlike the highly pathogenic SARS-CoV, MERS-CoV, and SARS-CoV-2, these four so-called common HCoVs typically cause mild upper respiratory tract illness and account for 15%-30% of common cold cases in adults, although severe and life-threatening lower respiratory tract infections sometimes occur in infants, the elderly, or immunocompromised patients. In some forms, the disclosed compositions containing eSTBs and methods of use thereof can be used to culture HCoVs for viral research and to screen for drugs that reduce replication and ameliorate pathology associated with one or more of the four common HCoVs.

[0234] Human coronavirus 229E (HCoV-229E) is a coronavirus that infects humans and bats. HCoV-229E is a member of the genus Alphacoronavirus and the subgenus Duvinacovirus. It is an enveloped, positive-sense, single-stranded RNA virus that enters its host cells by binding to the APN receptor. HCoV-229E is associated with a range of respiratory symptoms, from the common cold to high-morbidity outcomes such as pneumonia and bronchiolitis. However, this high-morbidity outcome almost always occurs in cases of co-infection with other respiratory pathogens. In some forms, HCoV-229E may cause acute respiratory distress syndrome (ARDS). HCoV-229E is also one of the coronaviruses most frequently co-detected with other respiratory viruses, particularly human respiratory syncytial virus (HRSV).

[0235] Human coronavirus NL63 (HCoV-NL63) is a species of coronavirus, specifically Setracovirus from the genus Alphacoronavirus. The virus is an enveloped, positive-sense, single-stranded RNA virus that enters its host cell by binding to ACE2. The virus is mainly found in young children, elderly people, and immunocompromised patients with acute respiratory diseases. It is also seasonally associated in temperate climates. The evolution of HCoV-NL63 appears to involve recombination between an ancestral NL63-like virus prevalent in Triaeenops afer bats in Africa and a CoV 229E-like virus prevalent in Hipposideros bats. Recombinant viruses can be generated when two viral genomes are present in the same host cell. The first case of HCoV-NL63 infection was identified in a young child admitted to the hospital with severe lower respiratory tract infection. Although the clinical manifestations of the virus can be severe, it has also been found in cases of mild respiratory infections. The comorbidity of HCoV-NL63 with other respiratory infections makes it difficult to determine the specific symptoms of the virus. A study of clinical symptoms in patients with HCoV-NL63 without secondary infection reported that the most common symptoms were fever, cough, rhinitis, sore throat, hoarseness, bronchitis, bronchiolitis, pneumonia, and laryngitis. An earlier study investigating children with lower respiratory tract illness found that HCoV-NL63 was more common in outpatients than in hospitalized patients, suggesting that it is a common cold virus similar to HCoV-229E and HCoV-OC43 that generally causes less severe symptoms.

[0236] Human coronavirus OC43 (HCoV-OC43) is a member of the betacoronavirus 1 species that infects humans and cattle. Infectious coronaviruses are enveloped, positive-sense, single-stranded RNA viruses that enter their host cells by binding to the N-acetyl-9-O-acetylneuraminic acid receptor. Four HCoV-OC43 genotypes (A to D) have been identified, of which genotype D is most likely caused by genetic recombination. Whole genome sequencing and bootscan analysis of genotypes C and D showed a recombination event between genotypes B and C during the generation of genotype D. Of the 29 virus variants identified, none belonged to the older genotype A. Symptoms of HCoV-OC43 infection are as described for HCoV-229E and HCoV-NL63.

[0237] Human coronavirus HKU1 (HCoV-HKU1) is an enveloped, positive-sense, single-stranded RNA virus that, like OC43, enters its host cell by binding to the N-acetyl-9-O-acetylneuraminic acid receptor. HCoV-HKU1 has a hemagglutinin esterase (HE) gene, which distinguishes it as a member of the genus Betacoronavirus and the subgenus Embecovirus. Symptoms of HCoV-HKU1 infection are as described for HCoV-229E and HCoV-NL63.

[0238] v. Non-human coronavirus

[0239] The disclosed compositions and methods of use thereof can be used to study alpha coronaviruses or beta coronaviruses that can infect non-human mammals. In some forms, the alpha coronavirus can be a canine enteric coronavirus (CECoV), a feline coronavirus (FCoV), a porcine respiratory coronavirus (PRCV), a porcine epidemic diarrhea virus (PEDV), or a transmissible gastroenteritis virus (TGEV). In some forms, the alpha coronavirus can be a variant derived from a rhinolophus bat coronavirus HKU2 (Bat-CoVHKU2) or a miniopterus bat coronavirus HKU8 (Bat-CoV HKU8). In some forms, the beta coronavirus can be a canine respiratory coronavirus (CRCoV), a mouse coronavirus (M-CoV), a porcine hemagglutinating encephalomyelitis virus (PHEV), a hedgehog coronavirus 1, a bovine coronavirus (B-CoV), or an equine coronavirus (E-CoV). In some forms, the betacoronavirus can be a variant derived from tylonycteris bat coronavirus HKU4 (Bat-CoV HKU4), pipistrellus bat coronavirus HKU5 (Bat-CoV HKU5), or rousettus bat coronavirus HKU9 (Bat-CoV HKU9).

[0240] The coronavirus may also be a gammacoronavirus or a deltacoronavirus. In some forms, the gammacoronavirus may be avian infectious bronchitis (AIBV) or Beluga CoV SW1. In some forms, the delta coronavirus can be nightingale CovHKU11 (BuCoV HKU11), thrush CovHKU12 (ThCoV HKU12), munia Cov HKU13 (MunCoV HKU13), pig Cov HKU15 (PDCoV HKU15), white-eyed Cov HKU16 (WECoV HKU16), sparrow Cov HKU17 (SpCoV HKU17), magpie robin Cov HKU18 (MRCoV HKU18), night heron Cov HKU19 (NHCoV HKU19), water duck Cov HKU20 (WiCoVHKU20), moorhen Cov HKU21 (CMCoV HKU21), falcon Cov HKU27 (FalCoV UAE-HKU27), houbara bustard CovHKU28 (HouCoV UAE-HKU28), pigeon Cov HKU29 (PiCoV UAE-HKU29) and quail Cov HKU30 (QuaCoVUAE-HKU30), which is the best characterized DCoV species. Delta coronaviruses are further described in detail by Vlasova et al. (2021) Frontiers in Veterinary Science, Vol. 10, doi: 10.3389 / fvets.2020.626785. Non-human coronaviruses are further described in detail by Kenney et al. 2020 Veterinary Pathology, Vol. 58, Issue 3, pages 438-452, doi: 10.1177 / 0300985820980842; Alluwaimi et al. (2020) Frontiers in Veterinary Science, Vol. 7, Article number 582287, doi: 10.3389 / fvets.2020.582287).

[0241] b. Other respiratory viruses

[0242] Additional respiratory viruses that can be studied using nasal organoids include, but are not limited to, rhinoviruses, influenza virus, respiratory syncytial virus (RSV), coronaviruses, adenoviruses, parainfluenza viruses, and enteroviruses.

[0243] In some forms, the respiratory virus is a rhinovirus. Rhinoviruses are the main cause of the common cold. They primarily infect the upper respiratory tract, including the nasal epithelium, causing symptoms such as runny or stuffy nose, sore throat, coughing and sneezing. Therefore, in some forms, nasal organoids can be used to model the effects of rhinoviruses on nasal biology.

[0244] In some forms, the respiratory virus is an influenza virus or a parainfluenza virus. Influenza viruses, including influenza A and B, are responsible for seasonal flu outbreaks. These viruses infect the respiratory epithelium and in severe cases can cause symptoms such as fever, cough, sore throat, body aches, fatigue, and respiratory distress. Parainfluenza viruses are a common cause of respiratory infections, especially in young children. They can cause symptoms such as laryngitis (inflammation of the larynx and trachea), bronchiolitis, and pneumonia. Therefore, in some forms, nasal organoids can be used to model the effects of influenza and parainfluenza viruses on nasal biology.

[0245] In some forms, the respiratory virus is respiratory syncytial virus (RSV). RSV is a common viral pathogen that primarily affects infants and young children. It causes respiratory infections ranging from mild cold-like symptoms to more severe lower respiratory tract infections such as bronchiolitis and pneumonia. Therefore, in some forms, nasal organoids can be used to model the effects of RSV on nasal biology to help develop more effective vaccines.

[0246] In some forms, the respiratory virus is an adenovirus. Adenoviruses can cause respiratory infections, especially in young children. They infect the upper respiratory tract, causing symptoms such as sore throat, cough, runny nose, and fever. Adenoviruses can also cause lower respiratory tract infections, including bronchitis and pneumonia. Therefore, in some forms, nasal organoids can be used to model the effects of adenovirus on nasal biology to help develop more effective vaccines.

[0247] In some forms, the respiratory virus is an enterovirus. Some enteroviruses, such as enterovirus D68, can cause respiratory infections, especially in children. These viruses can cause symptoms ranging from mild respiratory illness to severe respiratory distress, especially in individuals with underlying respiratory conditions. Therefore, in some forms, nasal organoids can be used to model the effects of enteroviruses on nasal biology to help develop more effective vaccines.

[0248] c. Bacterial pathogens

[0249] Some respiratory pathogens can resist the antimicrobial properties of healthy airway epithelial cells, causing the pathogen to persist and establish chronic or acute infections. Exemplary bacteria that can infect respiratory epithelial cells include, but are not limited to, Staphylococcus aureus, Streptococcus pneumoniae, Streptococcus pyogenes, Haemophilus influenzae, Mycobacterium tuberculosis, Mycoplasma pneumoniae, Bordetella pertussis, Legionella pneumophila, Klebsiella pneumoniae, Moraxella catarrhalis, Corynebacterium diphtheriae, and Chlamydia species. These bacteria have different infection strategies. For example, some bacterial pathogens such as Streptococcus pneumoniae and Haemophilus influenzae colonize the upper respiratory tract, i.e., the nose or nostrils, nasal cavity, mouth, throat (pharynx), and vocal cords (larynx). Other bacterial pathogens such as Mycoplasma pneumoniae infect the upper and lower respiratory tracts. Some bacterial pathogens are particularly virulent and resistant to multiple antibiotics, such as Staphylococcus aureus. Therefore, the disclosed nasal organoids can be used to simulate the effects of these bacterial pathogens on disease pathology and nasal biology to help develop more effective antibacterial treatments. Bacterial pathogens that infect respiratory epithelium are further described in Bertuzzi et al., FEMS Microbial Rev., 43(2): 145-161(2019); Cappelletty, The Pediatric Infectious Disease Journal, 17(8): S55-S61(1998); and Sharma, et al., Front. Immunol., 11: 91(2020); the contents of which are incorporated herein in their entirety.

[0250] Exemplary respiratory infections caused by one or more bacterial species include, but are not limited to, pneumonia, sinusitis, otitis media (middle ear infection), whooping cough (pertussis), bronchitis, tuberculosis, Legionnaires' disease, and diphtheria. Exemplary symptoms of respiratory infections caused by one or more of the bacterial species listed above include, but are not limited to, severe and prolonged cough, sore throat, and mild to moderate respiratory distress, chest pain, fever, difficulty breathing and fatigue, muscle pain, swollen lymph nodes, weight loss, facial pain or pressure, nasal and chest congestion, thick nasal discharge, and headache. Thus, the disclosed nasal organoids can be used to study the host's immune response to these bacterial infections, such as activation of immune cells, cytokine production, and recruitment of immune cells to the site of infection.

[0251] d. Fungal pathogens

[0252] Certain fungal species also interact with respiratory epithelial cells and may utilize host cell receptors, resulting in better cell adhesion (and frequent invasion), thereby establishing fungal infections in the host. Exemplary fungi that can infect respiratory epithelial cells include, but are not limited to, Aspergillus species, such as Aspergillus fumigatus, Aspergillus flavus, and Aspergillus niger; Cryptococcus neoformans, Histoplasma capsulatum, Blastomyces dermatitidis, Coccidioides species such as Coccidioides immitis and Coccidioides posadasii. Non-limiting examples of respiratory infections caused by fungal pathogens include, but are not limited to, allergic bronchopulmonary aspergillosis (ABPA), invasive aspergillosis, cryptococcal meningitis, histoplasmosis, blastomycosis, pneumocystis disease, and coccidioidomycosis (valley fever). Fungal pathogens and the respiratory infections they cause are further described in Barros et al., J. Fungi (Basel), 8(6):548 (2022); Crossen et al., J. Fungi (Basel), 9(1):40 (2022); and Li et al., Front. Immunol., 10:1524 (2019), the contents of which are incorporated herein in their entirety. Thus, the disclosed nasal organoids can be used to study fungal infection dynamics and the host's immune response to these fungal infections.

[0253] 2. Non-pathogenic respiratory conditions and diseases

[0254] Nasal organoids also provide a more physiologically relevant system that can be used to study the mechanisms of non-pathogenic respiratory conditions and diseases. These conditions and diseases are generally non-infectious and may be caused by various factors, including environmental triggers, genetic predispositions, or underlying physiological abnormalities. Exemplary non-pathogenic respiratory conditions and diseases include, but are not limited to, allergic rhinitis, asthma, chronic obstructive pulmonary disease (COPD), occupational lung disease, idiopathic pulmonary fibrosis (IPF), pulmonary fibrosis, bronchiectasis, cystic fibrosis, and interstitial lung disease.

[0255] In some forms, the respiratory condition or disease is allergic rhinitis or asthma. Allergic rhinitis, commonly known as hay fever, is an inflammation of the nasal cavity caused by allergens such as pollen, dust mites, pet dander or mold spores. It can cause symptoms such as nasal congestion, sneezing, itching and runny nose. Allergic rhinitis is caused by the immune system's response to these allergens rather than pathogenic infections. Asthma is a chronic respiratory condition characterized by inflammation and airway narrowing. It may be triggered by various factors, including allergens, irritants (such as smoke or strong odors), exercise or respiratory infections. Asthma can cause recurrent wheezing, coughing, shortness of breath and chest tightness. Although respiratory infections can trigger asthma symptoms, this condition itself is not caused by pathogens. Therefore, nasal organoids can be engineered to contain disease-related cell types, such as mucus-secreting goblet cells in allergic rhinitis or airway smooth muscle cells in asthma.

[0256] In some forms, the respiratory condition or disease is cystic fibrosis and / or interstitial lung disease. Cystic fibrosis is a genetic disorder that affects the production and function of mucus, causing thick mucus to accumulate in the lungs and other organs. It can cause chronic lung infections, persistent coughs, and difficulty breathing. Interstitial lung disease is a group of lung diseases characterized by inflammation and scarring of lung tissue. It can cause progressive difficulty breathing, coughing, and decreased lung function. Therefore, in some forms, nasal organoids can be generated using patient-derived cells with mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene to mimic the dysfunctional CFTR seen in cystic fibrosis, allowing the study of the effects of CFTR dysfunction on the respiratory epithelium and studying disease mechanisms.

[0257] In some forms, the respiratory condition or disease is chronic obstructive pulmonary disease (COPD). COPD is a progressive lung disease mainly caused by long-term exposure to irritants, particularly cigarette smoke. It includes conditions such as chronic bronchitis and emphysema, which are characterized by persistent cough, excessive mucus production, shortness of breath, and reduced airflow in and out of the lungs. COPD is primarily a non-infectious disease caused by long-term exposure to irritants. Therefore, in some forms, nasal organoids can be exposed to cigarette smoke extracts or other COPD-related irritants to induce disease-like phenotypes. This exposure can replicate the chronic inflammation, oxidative stress, and tissue damage observed in COPD. Researchers can study how the respiratory epithelium responds to these irritants and investigate the potential mechanisms that lead to the onset of COPD.

[0258] In some forms, respiratory conditions or diseases are classified as occupational lung diseases. Certain occupational exposures can lead to respiratory diseases. For example, occupational asthma can develop from exposure to workplace allergens or irritants such as dust, chemicals, or fumes. Occupational lung diseases, such as silicosis (caused by inhalation of crystalline silica particles) or asbestosis (caused by exposure to asbestos fibers), are non-infectious conditions that affect the respiratory epithelium. Therefore, nasal organoids can be exposed to specific occupational toxins or irritants commonly encountered in certain workplaces, such as silica dust, asbestos fibers, coal dust, or various chemicals. By exposing organoids to these substances, researchers can simulate the effects of occupational exposures on the respiratory epithelium and study the resulting cellular and molecular changes.

[0259] In some forms, the respiratory condition or disease is idiopathic pulmonary fibrosis (IPF). IPF is a progressive and irreversible lung disease characterized by the formation of scar tissue in the lungs. The exact cause of IPF is unclear, and it is believed to be the result of the combined effects of genetic and environmental factors. IPF causes symptoms such as persistent dry cough, shortness of breath, fatigue, and gradual loss of lung function. Therefore, in some forms, nasal organoids can be derived from individuals with familial IPF, or specific genetic variants associated with the disease can be produced, allowing researchers to study how these genetic factors affect disease development, progression, and response to potential therapies. These patient-specific nasal organoids contribute to the identification of personalized medicine approaches and genotype-specific therapeutic targets.

[0260] B. Drug Screening and Evaluation

[0261] The composition is particularly suitable for screening and identifying potential candidate agents for treating respiratory infections and diseases. An exemplary method for screening and evaluating candidate agents for treating respiratory infections and / or diseases comprises one or more of the following steps:

[0262] (i) contacting the in vitro produced organoid with a predetermined concentration of an infectious agent or a disease agent, and incubating the in vitro produced organoid for a predetermined period of time;

[0263] (ii) measuring one or more parameters indicative of a pathological cellular phenotype associated with the infection or disease of interest;

[0264] (iii) administering a predetermined concentration of a candidate agent to the in vitro generated organoids, and incubating the in vitro generated organoids for a predetermined period of time;

[0265] (iv) measuring one or more parameters indicative of a cellular response to a candidate agent; and

[0266] (v) evaluating the efficacy of the candidate agent by comparing the measured parameter of step (iv) with the measured parameter of an untreated in vitro generated organoid, wherein a significant difference between the measured parameter of step (iv) and the measured parameter of the untreated control indicates that the candidate agent can be considered for treating a respiratory infection or disease.

[0267] In some forms, parameters indicative of cellular responses to a test compound include, but are not limited to, effects of the agent on survival, proliferation, differentiation, morphological parameters, genetic parameters, or functional parameters of in vitro generated organoids.

[0268] In some forms, the candidate agent can be a nucleic acid or an analog thereof, a polypeptide or an analog thereof, an antibody, a chemical, a small molecule and / or any combination thereof. In some forms, PCR techniques, immunoassays, sequencing, biochemical assays, functional assays, cell viability assays, microscopy or a combination thereof are used to evaluate treated and untreated cells from 2D and 3D nasal organoids. Methods for screening agents are known in the art and include, but are not limited to, scintillation proximity assays, direct fluorescence measurements, fluorescence polarization, fluorescence resonance energy transfer (FRET), time-resolved fluorescence (TRF, HTRF and TiRF), AlphaScreen, high content screening (HCS), protein fragment complementation assays (PCA), microfluidics, flow cytometry and label-free techniques (reviewed in Janzen (2014) Chemistry and Biology Vol 21 (9), pages 1162-1170).

[0269] In some forms, the predetermined concentration and the predetermined time period in steps (i) and (iii) are optimized based on the type of candidate agent, respectively. In some forms, the candidate agent is selected from a compound library comprising natural products, synthetic compounds, or a combination thereof.

[0270] In some forms, the candidate agent is an antiviral agent, an antibacterial agent, an antifungal agent, or an antiallergic agent, wherein the effects of the agent indicate that the agent is safe for treating respiratory infections and / or diseases.

[0271] Evaluation / screening of candidate drugs

[0272] Methods for evaluating and screening candidate pharmaceutical agents using nasal organoids are disclosed. The method steps generally include contacting an in vitro generated organoid with a candidate pharmaceutical agent and determining the effect of the pharmaceutical agent on the survival, proliferation, differentiation, morphological parameters, genetic parameters, or functional parameters of the in vitro generated organoid.

[0273] In some forms, nasal organoids are cultured under conditions suitable for inducing differentiation of the desired cell populations disclosed herein, and one or more candidate agents can be applied to the cultured differentiated 2D and 3D nasal organoids and evaluated for their ability to treat one or more symptoms of diseased, dysfunctional or defective cells. The one or more symptoms can be specific to the disease state being studied, or can be general. Physiological, phenotypic, morphological or molecular symptoms and other markers of the cells can be monitored over time.

[0274] 1. Exemplary Antimicrobial Agents

[0275] In some forms, nasal organoids can be used for high-throughput drug screening to identify potential antimicrobial compounds. In some forms, nasal organoids can be used to evaluate the efficacy of antiviral drugs, assess their effects on viral replication, and examine their effects on host immune responses. In this way, organoids can help discover and develop new therapeutic strategies to combat microbial infections. For example, in some forms, the disclosed organoids can be used to screen for drug safety, toxicity, efficacy, and evaluate test compounds for drug therapy.

[0276] In some forms, the disclosed nasal organoids can be used as a platform to determine the effect of candidate compounds on inhibiting microorganisms before evaluating the efficacy of candidate agents in clinical trials or approving candidate agents for further agent testing to determine the safety of the agent.

[0277] In some forms, the disclosed cells can be used to determine the drug efficacy of existing drugs, such as FDA-approved drugs, or the compound is newly discovered and whether it is effective in clinical use can be evaluated using nasal organoids based on clinical symptoms or other therapeutic tests.

[0278] In exemplary formats, compounds are tested for toxicity and / or ability to further improve one or more wild-type functions. For example, in some formats, nasal organoids can be generated from established differentiation protocols and used as a screening platform to identify one or more candidate agents compatible with the development of inactivated vaccines.

[0279] In exemplary forms, the disclosed nasal organoids and compositions thereof can be used to study the activity or suitability of one or more candidate agents to treat or alleviate one or more symptoms of a viral infection and / or a disease or condition associated with a viral infection. In these forms, the candidate agent can be added at different stages of viral infection, such as before infection (before the virus is introduced) or after infection (before the virus is introduced). In some forms, the test compound can also be pre-incubated (neutralized) with the virus. In these forms, various tests can help reveal how the antiviral drug works (e.g., whether it neutralizes the virus or prevents viral entry). For example, in view of the lack of effective treatments available for treating coronaviruses, the disclosed compositions and methods are particularly suitable for studying the activity or efficacy of candidate agents to treat or alleviate or prevent one or more symptoms of any of the coronaviruses described below.

[0280] In an exemplary form, the disclosed nasal organoids can be used to screen for agents that act on cells infected with coronavirus, the method comprising contacting the coronavirus-infected nasal organoid with a candidate agent and determining the effect of the agent on the survival, proliferation, differentiation, or morphological, genetic, or functional parameters of various cell types of the nasal organoid. Thus, in some forms, the method comprises one or more steps for evaluating the replication of coronavirus in the presence of one or more active agents.

[0281] In some forms, the agent may be an existing FDA-approved drug with a known indication. In some forms, the agent is an unknown compound whose antiviral effect has not yet been reported. In some forms, the agent may be one or more chemically synthesized compounds. In some forms, the agent may be one or more components extracted from natural plants or herbs.

[0282] In some forms, the candidate agent is an antibacterial therapeutic agent. Exemplary antibacterial agents are mupirocin (Bactroban Nasal TM In some forms, the candidate agent is an antifungal therapeutic, such as amphotericin B. TM ) and Mycostatin TM ).

[0283] In some forms, the candidate agent is an antiviral therapeutic. In some forms, the antiviral therapeutic is an antiviral drug, a monoclonal antibody, a corticosteroid, an immunomodulator, a cell therapy, or an anticoagulant. Non-limiting examples of antiviral drugs include, but are not limited to, remdesivir (GS-5734), monolavir, favipiravir, and ivermectin. Remdesivir (GS-5734) is a viral RNA-dependent RNA polymerase inhibitor that has in vitro inhibitory activity against SARS-CoV-1 and Middle East Respiratory Syndrome (MERS-CoV). Due to its ability to inhibit SARS-CoV-2 in vitro, it was identified early on as a promising candidate therapeutic for COVID-19. Monolavir (LAGEVRIO TM ) is an oral antiviral drug that interferes with viral replication. Favipiravir (T-705) is an antiviral drug that inhibits viral RNA polymerase. Non-limiting examples of monoclonal antibodies include (casirizumab and idenumab, administered together), baricitumab and etresvirumab administered together, and sotorovimab (VIR-7831); the last of which targets the spike protein of SARS-CoV-2. An exemplary corticosteroid is dexamethasone, a corticosteroid with anti-inflammatory effects that is primarily used in severe COVID-19 cases or those requiring respiratory support. Non-limiting examples of immunomodulators include tocilizumab and baricitinib. Tocilizumab (Actemra TM ) is an immunosuppressive drug that blocks the interleukin-6 (IL-6) receptor and is used to control severe inflammatory responses in patients with COVID-19. TM ) is an immunomodulatory drug that inhibits the Janus kinase (JAK) pathway and is used in combination with remdesivir for hospitalized patients. An exemplary antiviral cell therapy is convalescent plasma collected from individuals who have recovered from COVID-19 and contains antibodies against the virus. Non-limiting examples of anticoagulants include heparin and enoxaparin, which are used to prevent or treat blood clots, which may occur in severe cases of COVID-19 due to the hypercoagulable state associated with the disease.

[0284] In some forms, the candidate agent is a vaccine, such as an antiviral vaccine. In some forms, the vaccine is a viral vector-based vaccine, an mRNA vaccine, a protein subunit vaccine, or an inactivated virus vaccine. Exemplary mRNA vaccines include Pfizer-BioNTech (Comirnaty TM), an mRNA vaccine that requires two doses administered 3 to 4 weeks apart; Moderna, an mRNA vaccine that requires two doses administered 4 weeks apart. Exemplary viral vector-based vaccines include Oxford-AstraZeneca (Vaxzevria TM , Covishield TM ), a viral vector-based vaccine that requires two doses administered 4 to 12 weeks apart; Johnson & Johnson (Janssen TM ), a single-dose viral vector-based vaccine; and CanSinoBIO TM , a single-dose viral vector-based vaccine. Exemplary inactivated virus vaccines include Sinovac, an inactivated virus vaccine that requires two doses administered 2 to 4 weeks apart; Sinopharm, an inactivated virus vaccine that requires two doses administered 2 to 4 weeks apart; and Bharat Biotech (Covaxin TM ); this inactivated virus vaccine requires two doses administered 4 to 6 weeks apart. Exemplary protein subunit vaccines include Covovax (Novavax TM ), a protein subunit vaccine that requires two doses administered 3 weeks apart; EpiVacCorona, a protein subunit vaccine that requires two doses administered 3 to 4 weeks apart; Abdala, a protein subunit vaccine that requires three doses administered 2 weeks apart; Soberana 02, a protein subunit vaccine that requires two doses administered 28 days apart; Covovax (Biovac TM ), a protein subunit vaccine under development; and Covovax, a protein subunit vaccine under development.

[0285] In some forms, the antiviral vaccine is an influenza vaccine, such as a trivalent inactivated influenza vaccine (TIV); a quadrivalent inactivated influenza vaccine (QIV); a live attenuated influenza vaccine (LAIV); and a recombinant influenza vaccine. In some forms, the antiviral vaccine is a respiratory syncytial virus (RSV) vaccine, such as palivizumab (Synagis TM ), a monoclonal antibody for the prevention of severe RSV infection in high-risk infants.

[0286] In some forms, the candidate agent is a bacterial vaccine, such as a pertussis vaccine, such as a diphtheria, tetanus, and acellular pertussis (DTaP) vaccine, and a tetanus, diphtheria, and acellular pertussis (Tdap) vaccine. In some forms, the bacterial vaccine is a tuberculosis vaccine, such as a Bacillus Calmette-Guérin (BCG) vaccine.

[0287] Thus, in some forms, the method comprises the steps of: treating the nasal organoids with an antiviral drug (e.g., remdesivir and PAXLOVID TM ) and one or more of a monoclonal antibody (e.g., casirizumab, idenumab, banivetinib, etesvirumab, baricitinib, and sotovirumab) and determining the effect of the agent on the survival, proliferation, differentiation, or morphological, genetic, or functional parameters of the nasal organoids based on the disclosed methods. In some forms, treated and untreated coronavirus-infected nasal organoids are evaluated using PCR techniques, immunoassays, sequencing, biochemical assays, functional assays, cell viability assays, microscopy, or a combination thereof.

[0288] 2. Exemplary Non-Microbial Respiratory Agents

[0289] In some forms, nasal organoids can be used for high-throughput drug screening to identify potential compounds for the treatment of non-pathogenic respiratory conditions. In some forms, the candidate agent is a nasal steroid, such as fluticasone propionate (Flonase TM ), mometasone furoate (Nasonex TM ), budesonide (Rhinocort TM ), triamcinolone acetonide (Nasacort TM ) and beclomethasone dipropionate (Qnas1 TM ).

[0290] In some forms, the candidate agent is an antihistamine, such as loratadine. TM ), Cetirizine (Zyrtec TM ) and fexofenadine (Allegra TM In some forms, the candidate agent is a decongestant, such as pseudoephedrine (Sudafed TM ), Sudafed PE TM ) and oxymetazoline (Afrin TM In some forms, the candidate agent is an anticholinergic drug, such as ipratropium bromide (Atrovent TM ) and tiotropium (Spiriva TM In some forms, the candidate agent is a mast cell stabilizer, such as sodium cromoglycate (NasalCrom TM ).

[0291] C. Biomarker Identification

[0292] Due to a combination of factors, including the lack of models that more accurately represent the nasal tissue microenvironment, the molecular mechanisms driving the pathology of conditions and diseases of the respiratory epithelium are poorly understood. The disclosed nasal organoids and / or cells / tissues thereof are ideal for recapitulating respiratory disease phenotypes; therefore, providing a more accurate model for biomarker discovery and identification of molecular targets for treating respiratory diseases.

[0293] Methods for identifying biomarkers and potential molecular targets using animal models are known in the art. Exemplary methods for identifying biomarkers for pathogenic and non-pathogenic respiratory diseases and conditions include one or more of the following steps:

[0294] (i) contacting the in vitro produced organoids with a predetermined concentration of an infectious or disease agent and incubating the in vitro produced organoids for a predetermined period of time;

[0295] (ii) isolating and purifying nucleic acids, proteins and / or metabolites from cells of in vitro generated organoids;

[0296] (iii) measuring the expression levels of nucleic acids, proteins and / or metabolites;

[0297] (iv) comparing the expression level of the nucleic acid, protein and / or metabolite to the corresponding expression level of a control nucleic acid, protein and / or metabolite in an in vitro generated organoid-derived cell; and

[0298] (v) measuring one or more parameters indicative of a cellular response to a candidate agent; and

[0299] (vi) identifying one or more biomarkers for a respiratory disease or condition based on statistically significant differences in the expression levels of nucleic acids, proteins and / or metabolites between diseased cells and control cells.

[0300] Methods for extracting and analyzing nucleic acids, proteins or metabolites from tumor tissue are known in the art. Suitable methods include, but are not limited to, PCR, qPCR, RNA-seq, mass spectrometry, ELISA, Western blot, immunohistochemistry and metabolic profiling, and any combination thereof. Unless otherwise indicated, the practice of the methods described herein can utilize techniques of cell biology, cell culture, molecular biology, transgenic biology, microbiology, recombinant DNA and immunology. These techniques are explained in detail in the following literature, for example: Molecular Cloning A Laboratory Manual, 2nd Ed., ed. By Sambrook, Fritsch and Maniatis (Cold Spring Harbor Laboratory Press: 1989); DNA Cloning, Volumes I and II (DN Glovered, 1985); Oligonucleotide Synthesis (MJ Gaited., 1984); Mullis et al US Patent No. 4,683,195; Nucleic Acid Hybridization (BD Hames & S.J. Higgins eds. 1984); Transcription and Translation (BD Hames & S.J. Higgins eds. 1984); Culture Of Animal Cell (RI Freshney, Alan R. Liss, Inc., 1987); Immobilized Cells And Enzymes (IRL Press, 1986); B. Perbal, A Practical Guide To Molecular Cloning (1984), the series, Methods In Enzymology (J.Abelson and M.Simon, eds.-in-chief, Academic Press, Inc., New York), specifically, Vols.154and 155 (Wu et al.eds.) and Vol.185, "Gene ExpressionTechnology" (D.Goeddel, ed.); Gene Transfer Vectors For Mammalian Cells (JHMiller and MPCaloseds., 1987, Cold Spring Harbor Laboratory); Immunochemical Methods In Cell And Molecular Biology (Mayer and Walker, eds., Academic Press, London, 1987); Hand book Of Experimental Immunology, Volumes V (DMWeir and CCBlackwell, eds., 1986); and Manipulating the Mouse Embryo, (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1986), each of which is incorporated herein by reference in its entirety. .

[0301] In some forms, the method of biomarker identification includes analyzing the genome of infected or diseased nasal organoid cells. Exemplary genomic analysis includes segmenting the genomic profile, identifying loci, and prioritizing the identified loci; and involving querying genes for respiratory diseases or respiratory infections at the identified loci. In some forms, the gene query at the identified loci is based on gene expression data. In some forms, the gene query at the identified loci is based on in vitro screening assays.

[0302] The identified biomarkers are typically biomarkers associated with respiratory infections or diseases. The identified biomarkers can be diagnostic biomarkers, prognostic biomarkers, or pharmacogenomic biomarkers. In some forms, the identified biomarkers are nucleic acid biomarkers or protein biomarkers. Example

[0303] Embodiment 1:

[0304] Materials and methods

[0305] Establishment, expansion, and differentiation of nasal organoids.

[0306] This study was approved by the Institutional Review Board of the University of Hong Kong / Hospital Authority Hong Kong West Cluster (UW21-695). Ten human nasal organoid (NsO) lines were established using freshly isolated nasal epithelial cells from 9 healthy donors. Briefly, nasal swabs were collected from the turbinate region using specimen collection flocked swabs (iClean, Biomed Diagnostics). After washing and digestion with 10X TrypLE Select (Gibco) at 37°C for 5 minutes, the resulting single cells were embedded in 70% Matrigel and seeded into 24-well suspension culture plates. After solidification, the droplets were incubated in expansion medium (Table 1) at 37°C in a humidified incubator containing 5% CO2. Replenish expansion medium every other day; passage 3D undifferentiated organoids every 1 to 2 weeks at a ratio of 1:3 to 1:10, depending on whether mechanical shearing or enzymatic digestion is used to separate the organoids (Li C, et al. 2022. JoVE, doi: 10.3791 / 63684:e63684).

[0307] To induce maturation of nasal organoids into 3D differentiated nasal organoids (3D dNsO), 3D nasal organoids were first incubated in basal medium (Advanced DMEM / F-12 (Gibco) supplemented with 1% HEPES, 1% GlutaMAX, and 1% penicillin / streptomycin) for 4 days and then incubated with PD medium (PneumaCult-ALI medium (STEMCELL Technologies) supplemented with 10 μM DAPT) for 6-10 days. The medium was replenished every other day. To induce differentiation into differentiated nasal organoid monolayers (dNsO-mono), 3D nasal organoids were treated with 10X TrypLE Select (Invitrogen) at 37°C for 5 minutes and single cells were plated at approximately 4 x 10 5 cells per cm 2The density of PD medium is seeded on the Transwell insert. The cells are cultured in the expansion medium for 1 to 2 days, then replaced with PD medium and incubated for another 8 to 12 days. PD medium is supplied to the top and bottom chambers and replenished every other day. In order to optimize the differentiation of organoid monolayers, after the cells reach complete confluence in PD medium within 1 to 2 days, the medium in the top chamber is replaced with PD medium buffered with PIPES (Sigma Aldrich) to produce a pH of about 6.6, while the medium in the bottom chamber is kept buffered with HEPES (Gibco) to maintain a pH of about 7.4. Organoids are incubated in these buffered PD mediums for 6-10 days to achieve maturity. The transepithelial resistance (TEER) of the organoid monolayer is measured every other day using Millicell ERS-2 volt-ohmmeter (EMD Millipore) to assess epithelial barrier integrity.

[0308] 3D undifferentiated nasal organoids, 3D differentiated nasal organoids and nasal organoid monolayers were harvested and RNA was extracted using the MiniBEST Universal RNA Extraction Kit (Takara), followed by reverse transcription using the transcript first-strand cDNA synthesis kit (Roche) and oligo (dT) primers. The resulting cDNA was used to measure the mRNA expression levels of cellular genes (Table 2) using LightCycler 480SYBR Green I Master Mix (Roche) (Zhou J, et al. 2019. EMBO Mol Med, Vol. 11, doi: 10.15252 / emmm. 201809528). Micrographs and videos of organoids were obtained using a Nikon Eclipse TS100 inverted conventional microscope.

[0309] Table 2: qPCR primer list

[0310]

[0311] Viral infection and detection.

[0312] SARS-CoV-2 isolates HKU-001a (WT, GenBank accession number MT230904), delta variant (B.1.617.2; GenBank OM212471), and omega variant (B.1.1.529; GenBank OM212473) were propagated in Vero E6 / TMPRSS2 cells (JCRB1819) purchased from the JCRB cell bank and titrated by plaque assay (Zhao X, et al. 2021, Stem Cell Reports Vol. 16, pages 493-504, doi: 10.1016 / j.stemcr.2021.02.009; Zhou J, et al. 2020. Nat Med Vol.26, pages1077-1083, doi:10.1038 / s41591-020-0912-6). Differentiated organoids were always used for infection experiments. 3D nasal organoids were mechanically sheared using a glass Pasteur pipette and incubated with virus for 2 hours at 37°C. The seeded organoids were re-embedded in Matrigel and then incubated in basal medium.

[0313] After washing twice with basal medium, nasal organoid monolayers were incubated with virus apically at 37°C for 2 h and then incubated in basal medium. To assess replication kinetics, after plating in organoid monolayers at an MOI of 0.1 or in 3D organoids at an MOI of 1, cell-free medium was harvested at the indicated hours post-infection, RNA was extracted using the MiniBEST Viral RNA / DNA Extraction Kit (Takara), and viral load (viral gene copy number of RdRp genes) was measured by one-step RT-qPCR assay and by TCID 50 Virus titration was performed as described in (Zhao X, et al. 2021, Stem Cell Reports Vol. 16, pages 493-504, doi: 10.1016 / j.stemcr.2021.02.009; Zhou J, et al. 2020. Nat Med Vol. 26, pages 1077-1083, doi: 10.1038 / s41591-020-0912-6). All live virus experiments were performed in a biosafety level 3 laboratory.

[0314] Virus competition assay

[0315] To compare the replication fitness of different SARS-CoV-2 strains, nasal organoid monolayers were infected with a 1:1 mixture of WT and Omicron variant, or a 1:1 mixture of Delta variant and Omicron variant at a total MOI of 0.1, or with plaque-purified respective virus strains at an MOI of 0.1. At the indicated hours post-infection, the cell-free culture medium was harvested, and RNA was extracted using the QIAamp viral RNA mini kit (Qiagen), and viral genes were detected using a one-step probe-based RT-qPCR assay using primer pairs TGGACCTTGAAGGAAAACAGGG (SEQ ID NO: 33) and TGGTTCTAAAGCCGAAAAACCC (SEQ ID NO: 34) (Peacock TP, et al. 2022, bioRxiv, doi: 10.1101 / 2021.12.31.474653:2021.12.31.474653; Lamers MM, et al. 2022, bioRxiv, doi: 10.1101 / 2022.01.19.476898:2022.01.19.476898). The specific probes for WT and delta variants are CTATTTAATTTAGTGCGTGATCT-HEX (SEQ ID NO: 35); the specific probe for Omicron variant is TTATAGTGCGTGAGCCAGAAGA-FAM (SEQ ID NO: 36). The FAM and HEX dyes in each sample were detected simultaneously with the LightCycler 96 system using the endpoint genotyping protocol template. The endpoint fluorescence (EPF) values ​​of each dye in each sample were analyzed using the endpoint genotyping method with LC96 software. The EPF values ​​of samples from organoids infected with purified virus (WT only, delta variant only, or Omicron variant only) were used for normalization. The percentage of each variant was calculated as the FAM / HEX value divided by the sum of FAM and HEX for each sample.

[0316] Immunofluorescence staining and flow cytometry.

[0317] The cellular composition of nasal organoids was characterized using specific antibodies (Table 3) to identify ciliated cells (ACCTUB), goblet cells (MUC5AC), club cells (CC10), and basal cells (P63, CK5), followed by secondary antibodies. Cellular proteins in organoids including ACE2, TMPRSS2, OCLN, and ZO-1 were labeled with the corresponding antibodies. To identify virus-infected cells, virus-inoculated or mock-infected organoids were stained with homemade antibodies against SARS-CoV-2 nucleoprotein (NP) raised in guinea pigs (Zhao X, et al. 2021, Stem Cell Reports Vol. 16, pages 493-504, doi: 10.1016 / j.stemcr.2021.02.009; Zhou J, et al. 2020. Nat Med Vol. 26, pages 1077-1083, doi: 10.1038 / s41591-020-0912-), fixed with 4% PFA for 1 hour at room temperature, permeabilized with 0.5% Triton X-100 for 10 minutes, and blocked with protein blocker (Dako) for 1 hour. To define cell tropism and assess ciliary abundance, infected organoids were co-stained with α-NP and α-ACCTUB. Z-stack scans of nasal organoid monolayers were performed, followed by orthogonal projections to generate cross-sectional images. To examine cell connections, infected organoids were co-stained with α-NP and α-OCLN or α-ZO-1. Nuclei and actin filaments were counterstained with DAPI (Thermo Fisher Scientific) and phalloidin-647 (Sigma-Aldrich), respectively. After staining, ProLong TM Organoids were mounted whole-mount on slides using glass antifade fixative (Invitrogen). Confocal images were acquired using a Carl Zeiss LSM 800 confocal microscope. For image quantification of cilia abundance, the area covered by cilia was manually defined and measured using ImageJ software. Five randomly selected frames were analyzed per group. For image quantification of cell junction proteins, the geometric mean fluorescence intensity of each channel was measured using the Histo function of the ZEN blue software. Logarithmic binning was used; the lower and upper thresholds were set to 1 and 65534, respectively.

[0318] For flow cytometry analysis, organoids were treated with 10mM EDTA (Invitrogen) at 37°C for 30-60 minutes and dissociated into single cells, then fixed with 4% PFA for 15 minutes at room temperature, permeabilized with 0.1% Triton X-100 for 5 minutes at 4°C, and then immunostained with specific antibodies (Table 3) and corresponding isotype controls for gating. To determine the infection rate, after inoculation with an MOI of 1, organoids were dissociated into single cells, fixed with 4% PFA, and then immunostained with α-double-stranded RNA antibodies (dsRNA, 10010500, Scicons); mock-infected organoids were used for gating. Analyzed using a BD FACSCanto II analyzer or LSR Fortessa. FlowJo software was used for data processing.

[0319] Table 3: Antibody list

[0320]

[0321] Scanning electron microscopy

[0322] After infection with the indicated viruses at an MOI of 5 or mock infection, nasal organoid monolayers were fixed and mounted after sequential fixation in 2.5% glutaraldehyde and 1% osmium. Sample processing was performed by the Electron Microscopy Unit of the University of Hong Kong. A LEO 1530FEG scanning electron microscope was used for image acquisition.

[0323] Statistical analysis.

[0324] Statistical analysis was performed using GraphPad Prism 9.0. Student's t-test or ANOVA test was used to determine statistical significance as specified in the Figure Description. The data in the figure represent technical replicates, i.e., the mean and standard deviation of a representative experiment. The number of technical replicates is indicated in the legend. Experiments were performed 2 to 4 times independently in multiple organoid lines, as indicated in the legend. *p≤0.05, **p≤0.01, ***p≤0.001.

[0325] result

[0326] Derivation, differentiation, and characterization of nasal organoids

[0327] Nasal epithelial cells were collected from the inferior turbinate of healthy donors using flocked swabs. Nasal epithelial cells were embedded in Matrigel and then covered with organoid expansion medium supplemented with favorable genes (including R-spondin, Noggin, FGF7 and FGF10), which is the same medium used to derive human lung organoids ( Figure 1A). Cystic organoids appeared on day 2 or 3 and gradually increased in size. Nasal organoids were passaged every 10-12 days over 6 months. More than 10 nasal organoid lines from different donors were established with a 100% success rate, demonstrating the robustness and reproducibility of the protocol. Unlike lung organoids, which always had a central lumen throughout their expansion culture, nasal organoids typically developed a small central lumen later in each passage; most nasal organoids were solid cellular spheres lacking a discernible central lumen.

[0328] The derived nasal organoids were propagated in three dimensions (3D) in expansion medium by maintaining the clonogenic potential of adult stem or progenitor cells and directing the nasal organoids to an immature state. To mimic the mature nasal epithelium, a range of conditions and defined differentiation protocols were tested to generate differentiated 3D organoids and organoid monolayers ( Figure 1A ). Briefly, after 10 days of growth of 3D undifferentiated nasal organoids in expansion medium, differentiation was initiated by incubating with basal medium for 4 days to expand the central lumen. This is an indispensable step because solid organoids without a central lumen may not develop sufficient mucociliary differentiation; few motile cilia were observed in these solid organoids. Subsequently, the basal medium was replaced with proximal differentiation (PD) medium, which is the same differentiation medium used for airway organoid maturation (18), and further incubated for 6 days to produce fully differentiated nasal organoids. To date, dense and motile cilia were easily discernible in each differentiated nasal organoid (data not shown). Organoids grown three-dimensionally in Matrigel typically develop apical polarity because the extracellular matrix provided by Matrigel in this article controls epithelial polarity (24, 31).

[0329] Compared to undifferentiated nasal organoids, 3D differentiated nasal organoids showed significant upregulation of cell type markers for basal cells (P63, CK5) and ciliated cells (FOXJ1, SNTN), as well as the SARS-CoV-2 cell receptor ACE2 ( Figure 1B ). Differentiated nasal organoids housed all airway epithelial cell types, namely ciliated cells, basal cells, goblet cells, and club cells (data not shown). A nasal organoid with the tip facing outward is intentionally shown to highlight the dense ACCTUB+ cilia. The expression of compartment-specific genes was also examined in 3D differentiated nasal organoids compared to 3D differentiated airway organoids derived from three different donors. Nasal-enriched and tracheal / bronchial-enriched genes were significantly higher in differentiated nasal and airway organoids, respectively ( Figure 1C-1H ), indicating that nasal organoids derived from nasal cells do retain compartment-specific gene expression profiles, consistent with observations in natural bronchi and nasal epithelial cells revealed by single-cell sequencing studies ( 6 , 7 ).

[0330] The airway epithelium lining the human respiratory tract forms a physical barrier to protect against invading microorganisms, which is particularly important for the nasopharyngeal epithelium as it represents the front line to the external environment. To better mimic the exposure of the nasal epithelium to invading pathogens, differentiated nasal organoids (also called organoid monolayers) in 2D format were generated. Briefly, single cells dissociated from 3D undifferentiated nasal organoids were seeded onto transwell inserts and incubated in expansion medium for 2 days, which allowed cells to attach and expand. They were then switched to PD medium and incubated for 8 days to produce a confluent monolayer of differentiated nasal organoids. In 3D differentiated nasal organoids, basal cell (P63, CK5), ciliated cell (FOXJ1, SNTN) markers, and ACE2 receptors were significantly upregulated in differentiated nasal organoid monolayers ( Fig. 1I ). Four airway epithelial cell types were present in the organoid monolayer (data not shown). Ciliated cells, the major cell population in the human nasal epithelium, were significantly enriched in the organoid monolayer. Beating cilia were easily discernible under a microscope (data not shown). Transepithelial electrical resistance (TEER) is a reliable indicator of epithelial integrity and is an essential characteristic of a physical barrier. TEER was measured during the 10-day differentiation culture. TEER increased and reached a plateau on day 6 (data not shown). Therefore, at the end of day 10 differentiation culture, mature nasal organoid monolayers formed a complete epithelial barrier on transwell inserts ( Figure 1J ). Overall, expandable nasal organoids were established with a high success rate from readily available nasal epithelial cells. The expansion medium maintained long-term expansion of the nasal organoids by directing the organoids to an immature state. The differentiation protocol enabled the generation of differentiated nasal organoids in both 3D and 2D forms that faithfully mimicked the nasal epithelium. These 3D differentiated nasal organoids and 2D form organoid monolayers remained stable for approximately two weeks and one month, respectively, and are suitable for a variety of experimental manipulations.

[0331] Optimization of Differentiated Nasal Organoid Monolayers

[0332] The surface fluid of the human airway (including the nasal mucosa) is slightly acidic, with an average pH of 6.6 (32). In addition, the low pH of the airway surface fluid is one of the determinants of active SARS-CoV-2 infection (33,34). However, in the differentiation culture of organoid monolayers as described above, the proximal differentiation (PD) medium in the top and bottom chambers was buffered with HEPES at pH 7.4 (the physiological pH of interstitial fluid). It was hypothesized that the slightly acidic medium in the top chamber and the physiologically alkaline medium in the bottom chamber could better mimic the in vivo environment and produce more physiologically relevant nasal organoids. To this end, after the cells reached confluence on the transwell insert, the HEPES buffer in the top culture medium (i.e., PD medium) was replaced with PIPES buffer to produce a pH of 6.6, while the original HEPES was retained in the bottom culture medium at pH 7.4. That is, the organoid monolayer was incubated in the modified differentiation medium at pH 6.6 / 7.4 (top / bottom) or the original differentiation medium at pH 7.4 / 7.4 ( Figure 2A ). Nasal organoids incubated in differentiation medium at pH 6.6 / 7.4 showed higher TEER than those at pH 7.4 / 7.4, indicating the formation of a reinforced epithelial barrier ( Figure 2B ).

[0333] We then examined the cellular composition and expression of ACE2 and TMPRSS2 in all differentiated nasal organoids, including 3D differentiated organoids and organoid monolayers that underwent differentiation at pH 6.6 / 7.4 or pH 7.4 / 7.4, and compared this with that in 3D undifferentiated nasal organoids. We found that ciliated cells represented the major cell population in nasal organoid monolayers ( Figure 2G-2J ). Goblet cells were significantly enriched in pH 6.6 / 7.4 nasal organoid monolayers compared to pH 7.4 / 7.4 and 3D differentiated nasal organoids ( Figure 2K-2N Interestingly, the proportion of basal cells was highest in 3D differentiated nasal organoids ( Figure 2C-2F ). In contrast to ciliated cells, rod-shaped cells were significantly reduced after differentiation culture. Notably, the differentiation process increased ACE2+ cells in all variants of organoids; at pH 6.6 / 7.4, the percentage of ACE2+ cells was highest in nasal organoid monolayers. In addition, TMPRSS2+ cells were significantly more abundant in organoid monolayers compared to differentiated and undifferentiated 3D organoids ( Figures 3A-3J ). Overall, among all differentiated organoids, nasal organoid monolayers differentiated in pH 6.6 / 7.4 most adequately phenocopy native nasal epithelium to model SARS-CoV-2 infection.

[0334] SARS-CoV-2 replication in nasal organoids and higher replicative fitness of emerging variants

[0335] The kinetics of SARS-CoV-2 replication in differentiated nasal organoids derived from four different donors were examined. Both differentiated 3D nasal organoids and organoid monolayers sustained SARS-CoV-2 replication, as indicated by increased viral RdRp gene copy numbers and infectious titers ( Figures 3A-3D ), although organoids derived from different donors showed variable replication capacity. The higher replication fitness of SARS-CoV-2 in organoid monolayers than in their 3D counterparts may be attributed to the higher expression of ACE2 and TMPRSS2 in the former than in the latter. Figures 3A-3J Immunostaining revealed numerous SARS-CoV-2-infected cells in the nasal organoid monolayer; viral NPs either colocalized or did not colocalize with ACCTUB+ ciliated cells in both en face and cross-sectional images (data not shown).

[0336] The Delta and Omicron variants surpassed the previous circulating strains after their emergence. To elucidate the virus-host interactions underlying their enhanced transmissibility relative to the ancestral virus, the ancestral wild-type (WT) strain, Delta, and Omicron strains were inoculated onto monolayers of nasal organoids induced to differentiate at pH 6.6 / 7.4, as these differentiated nasal organoids are the best model for SARS-CoV-2 infection. Quantification of viral load in the culture medium and viral titration showed that the Omicron variant had a higher replication fitness than the Delta variant, followed by the WT strain ( Figure 4E and 4F The Omicron variant showed significantly higher viral titers of approximately 2 log units than the WT strain. The infection rate, i.e., the percentage of virus-infected cells 24 h after high MOI inoculation, was examined. Flow cytometric analysis showed that the Omicron variant was significantly more infectious than the Delta variant; the lowest infection rate was found in the WT strain ( Figure 4G ).

[0337] Pairwise competition assay in nasal organoid monolayers. The Omicron variant quickly outcompeted the Delta variant ( Figure 4H When the Omicron variant was co-inoculated with the WT strain, its replication advantage was even more significant ( Fig. 4I The replication fitness of the three virus strains in differentiated airway organoid monolayers was compared. Airway organoids replicated the three virus strains with similar capacity, but the replication advantage of Omicron was not as significant as in nasal organoid monolayers ( Figure 4J and 4K The higher replication capacity of the Omicron variant compared to the WT virus was verified in airway organoids by competition assay. The growth of the Omicron variant was not as prominent as in nasal organoids ( Figure 4L). In contrast, replication kinetics and competition assays in Vero E6 / TMPRSS2 cells revealed that the Delta and Omicron variants had lower replication fitness than the WT strain ( Figure 4M-4P ), which contradicts the higher infectivity and transmissibility of these variants observed in humans.

[0338] Overall, the three virus strains displayed different replication fitness and infectivity in differentiated nasal organoid monolayers, which accurately reproduced the highest transmissibility of Omicron observed in real-life epidemiological observations. Furthermore, nasal organoids more adequately reproduced the variable transmissibility than airway organoids.

[0339] Preferential infection of ciliated cells by SARS-CoV-2

[0340] Infected nasal organoid monolayers were examined by confocal imaging to elucidate the cellular pathology of SARS-CoV-2 infection. Ciliated cells were evenly distributed in mock-infected nasal organoid monolayers, with dense ACCTUB+ cilia at the apical end of ciliated cells (data not shown). WT-infected or delta-infected or mock-infected dNsO-mono were co-stained with α-NP (red) and α-ACCTUB (green stain) 24 h after inoculation (1 MOI). Nuclei and actin filaments were counterstained with DAPI (blue) and phalloidin-647 (white). Remaining cilia on infected ciliated cells were examined. Cilia damage and ciliated cell loss were observed in SARS-CoV-2-infected nasal organoids, consistent with observations reported in cultured human airway epithelial cells (11). The dense, hair-like cilia at the apical end of normal ciliated cells were destroyed and / or deformed into fibrous masses (data not shown). In organoids infected with the WT virus, two small clusters of cilia remained on ciliated cells, while most cilia were destroyed. In organoids infected with the delta variant, ciliary damage was more prominent than in organoids infected with the WT strain. Image analysis in 5 randomly selected frames showed that the proportion of ACCTUB+ cells was significantly reduced in virus-infected organoids, especially those infected with the delta variant ( Figure 5A Flow cytometric analysis confirmed the results of the image analysis. While WT virus infection modestly depleted ACCTUB+ ciliated cells in nasal organoid monolayers, infection with the delta variant or Omicron resulted in further and significant depletion ( Figure 5B Consistently, flow cytometric analysis of airway organoid monolayers infected with WT and delta variants showed similar results ( Figure 5C). Scanning electron microscopy was performed to examine the cytopathological changes in more detail. In uninfected nasal organoids, dense cilia with smooth apical surfaces of ciliated cells were observed (data not shown). 24 hours after inoculation (1 MOI), mock-infected, WT-infected, or Delta-infected dNsO-mono were applied to scanning electron microscopy. However, in organoids infected with the WT strain and the Delta variant, cilia became shorter, tangled, and deformed (data not shown). Therefore, SARS-CoV-2 preferentially infects ciliated cells in nasal organoids and airway organoids, leading to cilia damage and loss.

[0341] SARS-CoV-2 infection disrupts cell adhesion to enhance viral transmission

[0342] In addition to mucociliary clearance provided by ciliated and goblet cells, the formation of tight junctions between adjacent epithelial cells represents a subcellular host defense against invading pathogens and maintain homeostasis in the human airway. At the same time, viruses have developed multiple mechanisms to disassemble tight junctions to facilitate infection or exploit specific cell junction targets for cellular entry (35). Mock-infected, WT-infected, or Delta-infected dNsO-mono were costained with (A) α-NP (green) and α-OCLN (red), or (B) α-NP (green) and α-ZO-1 (red) 24 h after inoculation (1 MOI). Nuclei and actin filaments were counterstained with DAPI (blue) and phalloidin-647 (white). The zonula occludens (ZO) family connects tight junction proteins such as occludin and claudin to the actin cytoskeleton. Occlusin (OCLN) and ZO-1 proteins outline each cell in a mock-infected nasal organoid monolayer, indicating that these adhesion molecules form intact tight junctions. Altered cell junctions were observed in organoids infected with WT and delta viruses. In organoids infected with the WT strain, ZO-1 and OCLN were diffused or reduced in areas within or near virus-infected cells, while infection with the delta variant resulted in widespread breakdown of cell junctions throughout the monolayer, not limited to infected cells, suggesting a possible paracrine effect. Quantification of signal intensity in 3 randomly selected frames revealed significant elimination of OCLN and ZO-1 in nasal organoids infected with the WT virus compared to mock-infected organoids. Organoids inoculated with the delta variant exhibited further reductions in ZO-1 ( Figure 6B )、OCLN( Fig. 6A ) and cytoskeletal F-actin ( Figure 6C Flow cytometric analysis confirmed SARS-CoV-2-induced disruption of OCLNs, as well as the more disruptive effects of the delta and omicron variants in nasal organoid monolayers ( Fig.6D ). By immunostaining ( Figure 6E-6G) and flow cytometry analysis ( Figure 6H ) The disruptive effect of SARS-CoV-2 infection on cell junctions was further verified in airway organoid monolayers. Thus, SARS-CoV-2 disrupted the tight junctions of nasal and airway organoids and breached the epithelial barrier.

[0343] discuss

[0344] The mucosal epithelium lining the nasopharyngeal compartment is the entry point and primary target for respiratory pathogens, including SARS-CoV-2; at the same time, nasal epithelial cells express the highest levels of SARS-CoV-2 entry factors among multiple human tissues studied (36). The high susceptibility of nasal epithelial cells to SARS-CoV-2, robust viral replication in these cells, and subsequent viral shedding constitute the biological basis of viral pathogenesis and its high transmissibility. Therefore, it is necessary to establish an in vitro model of the nasal epithelium to elucidate SARS-CoV-2 infection and virus-host interactions. In this study, a robust human nasal epithelial organoid culture system was established and characterized to simulate SARS-CoV-2 upper respiratory tract infection. It is a two-phase culture system, namely expansion and differentiation culture ( Figure 1A ). Expansion medium maintains long-term expansion of nasal organoids for more than 6 months by directing 3D undifferentiated organoids to an immature state. Defined differentiation protocol to generate differentiated 3D nasal organoids and organoid monolayers ( Figure 1B and 1I ). The differentiated nasal organoids closely mimic the native nasal epithelium. That is, the nasal organoid culture system is able to efficiently reconstruct and stably expand the human nasal epithelium in culture plates for a variety of experimental applications.

[0345] Optimize differentiation conditions to generate highly differentiated nasal organoid monolayers by simulating the slightly acidic surface fluid on the nasal mucosa ( Figure 2A Among all the differentiation forms of nasal organoids, organoid monolayers induced to differentiate in the apical chamber with slightly acidic medium (pH 6.6) showed a more enhanced epithelial barrier ( Figure 2B ) and higher expression of ACE2 (the cell receptor infected by SARS-CoV-2) ( Figures 3A-3J Notably, the optimized nasal organoid monolayers accurately reproduced the higher infectivity and improved replicative fitness of the Omicron variant compared to previously circulating variants, as measured by flow cytometric analysis of infection rates, viral titration assays for viral proliferation, and competition assays ( Figure 4E-4I ).

[0346] A notable advance has been the source of cells used to derive nasal organoids. Nasal epithelial cells are obtained from the inferior turbinates of healthy donors using flocked swabs, a noninvasive procedure that differs from the derivation of lung organoids using cells from bronchoalveolar lavage or resected tissue, which requires invasive procedures by physicians and surgeons. More importantly, previous studies on human intestinal organoids, the first adult stem cell-derived organoid model, have shown that epithelial organoids generated from different intestinal segments retain the structural and functional characteristics from which they were derived (29) because tissue identity is imprinted in adult stem cells and maintained in these organoids during long-term expansion culture (37). Therefore, nasal epithelial cells would be the optimal source for deriving physiologically relevant nasal organoids. Indeed, nasal organoids exhibit compartment-specific gene expression profiles ( Figures 3A-3J ). More importantly, nasal organoids retain the genotypic and phenotypic characteristics of the original cells, which allows the generation of personalized nasal organoids and provides a simple and robust in vitro model of the upper respiratory epithelium for various applications in personalized medicine.

[0347] Interestingly, the success rate of nasal organoid derivation was high, exceeding expectations. This excellent efficiency was demonstrated in a previous study in which nasal cells from healthy individuals and COVID-19 patients were collected by nasal brushing. Of all the harvested cells, approximately 60% were ciliated cells and goblet cells, while suprabasal cells and club cells accounted for approximately 30% of the cells (5). Suprabasal cells are an intermediate cell population between basal cells and club cells (6). Basal / suprabasal cells and club cells have been reported to be progenitor cells for respiratory epithelial regeneration (38-40). These progenitor cells have the ability to clonally expand in vitro and proliferate to form organoids (40-42). In this study, expansion medium supplemented with R-spondin, Noggin, and FGF maintained the clonogenicity of these progenitor cells and enabled the continuous expansion of undifferentiated nasal organoids for approximately 6 months. The simple cell acquisition procedure circumvents the relatively short expandability of nasal organoids, highlighting nasal organoids as a robust and personalized in vitro model of the nasal epithelium. Notably, in nasal organoids, the Omicron variant exhibited significantly higher replication fitness and infection rates than earlier circulating variants and surpassed the latter in competition assays, suggesting that nasal organoids are able to reproduce the infectivity of emerging SARS-CoV-2 variants ( Figure 4E-4I ). In contrast, the Omicron and Delta variants showed lower replication fitness than the WT strain in VeroE6 / TMPRSS2 cells ( Figure 4M-4P ), highlighting the strength of biologically relevant nasal organoids ( 43 ).

[0348] SARS-CoV-2 appears to target both ciliated and non-ciliated cells. Subsequent studies have suggested that those "non-ciliated" cells that are infected, at least in part, are caused by viral infection-mediated damage and / or depletion of cilia ( Figures 5A-5C ). In single-cell RNA sequencing studies of SARS-CoV-2 infection in cultured primary nasal and airway epithelial cells and in COVID-19 patients, SARS-CoV-2 cellular tropism in ciliated cells, resulting ciliary damage, and ciliated cell depletion have been documented (4,5,10,11,13,14). Ciliated cells are a major target of SARS-CoV-2. Thus, the higher replicative fitness of the Omicron and Delta variants in nasal organoid monolayers resulted in a more pronounced depletion of ciliated cells ( Figure 5B ). Mucociliary clearance driven by motile cilia represents an important host defense against pathogens. Cilia damage caused by SARS-CoV-2 will inevitably impair mucociliary clearance, leading to exaggerated tissue pathology. Cellular adhesion, including tight junctions, represents an additional layer of host defense against invading pathogens. Using imaging analysis and quantitative flow cytometry analysis, we demonstrated that the more infectious Omicron and Delta variants disrupt tight junctions more severely than earlier variants ( Figures 6A-6H ). Overall, the SARS-CoV-2 virus, especially the more transmissible variants, damages ciliated cells, leading to impaired mucociliary clearance and breaks down tight junctions to disrupt the epithelial barrier. These pathological changes make uninfected cells more vulnerable, thereby facilitating viral spread and transmission.

[0349] In conclusion, a robust nasal organoid culture system and fully characterized organoids were established and characterized. Nasal organoids were stably passaged for more than 6 months, providing a renewable source of nasal epithelial cells. Although not limiting, the following are exemplary features of the nasal organoids generated in the current study: (1) nasal organoids are derived from nasal epithelial cells obtained via nasal swabs, (2) the organoids have long-term expansion, i.e., they can be serially passaged for up to six months or longer, (3) the organoids generate multiple cell types, including ciliated cells, basal cells, goblet cells, and club cells, (4) the organoids are extensively characterized by: light microscopy for bright field images and videos of beating cilia, RT-qPCR for cell type-specific markers and compartment-specific markers, IF staining for cell type identification and tight junction formation, scanning electron microscopy for ultrastructural images of cilia, TEER for barrier integrity, and flow cytometry for cell type composition and expression of host-dependent factors, (5) the organoid types generated include 3D dNSO, 2D dNSO (pH 7.4), and 2D optimized dNSO (pH 6.6 / 7.4); and (6) the replication kinetics of the organoids were extensively characterized via RT-qPCR and TCID50 - approximately 3-4 log10 units for the ancestral virus and approximately 5-6 log10 units for the delta variant / Omicron variant. 2D and 3D nasal organoid monolayers were optimized by mimicking the natural microenvironment of the nasal epithelium. It has been demonstrated that the optimized nasal organoid monolayers fully reproduce the high infectivity of SARS-CoV-2 in the upper respiratory tract, particularly the highly transmissible delta variant and Omicron variant. These optimized nasal organoid monolayers outperform most, if not all, existing respiratory organoid models. A robust organoid system was generated that is capable of stably expanding and reconstructing human nasal epithelium in culture plates. The nasal organoid culture system provides an unlimited source of physiologically active nasal epithelial cells for studying respiratory pathogens, circumventing the limitations of cultured primary nasal epithelial cells. More importantly, the simple procedure for obtaining nasal cells and the zero-failure establishment efficiency allow researchers to easily establish personalized nasal organoids, which will pave new avenues for many exciting organoid-based studies to fight the COVID-19 epidemic.

[0350] References

[0351] 1.Chan JF,Yuan S,Kok KH,To KK,Chu H,Yang J,Xing F,Liu J,Yip CC,PoonRW,Tsoi HW,Lo SK,Chan KH,Poon VK,Chan WM,Ip JD,Cai JP,Cheng VC,Chen H,Hui CK,Yuen KY.2020.A familial cluster of pneumonia associated with the 2019novelcoronavirus indicating person-to-person transmission:a study of afamilycluster.Lancet 395:514-523.

[0352] 2.Zhu N,Zhang D,Wang W,Li X,Yang B,Song J,Zhao X,Huang B,Shi W,Lu R,Niu P,Zhan F,Ma X,Wang D,Xu W,Wu G,Gao GF,Tan W,China Novel Coronavirus I,Research T.2020.A Novel Coronavirus from Patients with Pneumonia in China,2019.N Engl J Med 382:727-733.

[0353] 3.Gandhi RT,Lynch JB,Del Rio C.2020.Mild or Moderate Covid-19.N EnglJMed 383:1757-1766.

[0354] 4.Ziegler CGK,Miao VN,Owings AH,Navia AW,Tang Y,Bromley JD,Lotfy P,Sloan M,Laird H,Williams HB,George M,Drake RS,Christian T,Parker A,SindelCB,Burger MW,Pride Y,Hasan M,AbrahamGE,3rd,Senitko M,Robinson TO,Shalek AK,Glover SC,Horwitz BH,Ordovas-Montanes J.2021.Impaired localintrinsic immunityto SARS-CoV-2 infection in severe COVID-19.Cell184:4713-4733 e22.

[0355] 5.Ahn JH,Kim J,Hong SP,Choi SY,Yang MJ,Ju YS,Kim YT,Kim HM,RahmanMDT,Chung MK,Hong SD,Bae H,Lee CS,Koh GY.2021.Nasal ciliatedcells are primarytargets for SARS-CoV-2 replication in the early stage of COVID-19.J ClinInvest 131.

[0356] 6.Deprez M,Zaragosi LE,Truchi M,Becavin C,Ruiz Garcia S,Arguel MJ,Plaisant M,Magnone V,Lebrigand K,Abelanet S,Brau F,Paquet A,Pe'er D,MarquetteCH,Leroy S,Barbry P.2020.A Single-Cell Atlas of the Human HealthyAirways.Am JRespir Crit Care Med 202:1636-1645.

[0357] 7.Vieira Braga FA,Kar G,Berg M,Carpaij OA,Polanski K,Simon LM,BrouwerS,Gomes T,Hesse L,Jiang J,Fasouli ES,Efremova M,Vento-Tormo R,Talavera-Lopez C,Jonker MR,Affleck, KFir,Palit,Palecka,PMS HV,MahbubaniKT,Cvejic A,Meyer KB,Saeb-Parsy K,Luinge M,Brandsma CA,Timens W,Angelidis I,Strunz M,Koppelman GH,van Oosterhout AJ,Schiller HB,Theis FJ,van den Berge M,Nawijn MC,Teichmann SA 2019. Identification of human lung cells. novelcell states in health and in asthma.Nat Med25:1153-1163.

[0358] 8.Campbell F,Archer B,Laurenson-Schafer H,Jinnai Y,Konings F,Batra N,Peacock B,Vandemaele K,Van Kerkhove MD,Jombart T,Morgan O,le Polain deWarouxO.2021.Increased transmissibility and global spread of SARS-CoV-2 variants as concerns of June 2021.Euro Surveillance 26.

[0359] 9.Brandal LT,MacDonald E,Veneti L,Ravlo T,Lange H,Naseer U,FeruglioS,Bragstad K,Hungnes O,Odeskaug LE,Hagen F,Hanch-Hansen KE,Lind A,WatleSV,Taxt AM,Johansen M,Vold L,Avitzland P,Naygarden K,Madsen EH.2021.Outbreakcaused by the SARS-CoV-2 Omicron variant in Norway,November toDecember2021.Euro Surveill 26.

[0360] 10.Ravindra NG,Alfajaro MM,Gasque V,Huston NC,Wan H,Szigeti-Buck K,Yasumoto Y,Greaney AM,Habet V,Chow RD,Chen JS,Wei J,Filler RB,Wang B,Wang G,Niklason LE,Montgomery RRSC,Chen,Chen S,Williams A,Iwasaki A,HorvathTL,Foxman EF,Pierce RW,Pyle AM,van Dijk D,Wilen CB.2021.Single-celllongitudinal analysis of SARS-CoV-2 infection in human airwayepitheliumidentifies target cells,alterations in gene expression,PLS and BiolS state. 19:e3001143.

[0361] 11. Robinot R, Hubert M, de Melo GD, Lazarini F, Bruel T, Smith N, Levallois S, Larrous F, Fernandes J, Gellenoncourt S, Rigaud S, Gorgette O, Thouvenot C, Trebeau C, Mallet A, Dumenil G, Gobaa S, Etournay R, Lledo PM, Lecuit M, Bourhy H, Duffy D, Michel V, Schwartz O, Chakrabarti LA. 2021. SARS-CoV-2 infection induces the dedifferentiation of multiciliated cells and impairs mucociliary clearance. Nat Commun 12:4354.

[0362] 12.Gamage AM,Tan KS,Chan WOY,Liu J,Tan CW,Ong YK,Thong M,AndiappanAK,Anderson DE,Wang Y,Wang LF.2020.Infection of human NasalEpithelial Cellswith SARS-CoV-2 and a 382-nt deletion of isolated ORF isolated viral killers and host transcriptional profiles.PLoS Pathog 16:e1009130.13.Pizzorno A,Padey B,Julien T,Trouillet-Assant S,Traversier A,Errazuriz-CerdaE,Fouret J,Dubois J,Gaymard A,Lescure FX,Duliere P,Constant S,PoissyJ,Lina B,Yazdanpanah Y,Terrier O,Rosa-CalatravaM.2020.Characterization andTreatment of SARS-CoV-2 in Nasal and BronchialHuman Airway Epithelia.CellRep Med 1:100059.

[0363] 14.Zhu N,Wang W,Liu Z,Liang C,Wang W,Ye F,Huang B,Zhao L,Wang H,ZhouW,Deng Y,Mao L,Su C,Qiang G,Jiang T,Zhao J,Wu G,Song J,TanW. inhumanairway epithelial cells.Nat Commun 11:3910.

[0364] 15.Hou YJ,Okuda K,Edwards CE,Martinez DR,Asakura T,Dinnon KH,3rd,KatoT,Lee RE,Yount BL,Mascenik TM,Chen G,Olivier KN,Ghio A,Tse LV,Leist SR,Gralinski LE,Schafer A,Dang H,Gilmore R,Nakano S,Sun L,Fulcher ML,Livraghi-Butrico A,Nicely NI,Cameron M,Cameron C,Kelvin DJ,de Silva A,Margolis DM,Markmann A,Bartelt L,Zumwalt R,Martinez FJ,Salvatore SP,Borczuk A,Tata PR,Sontake V,Kimple A,Jaspers I,O'Neal WK,Randell SH,Boucher RC,BaricRS.2020.SARS-CoV-2 Reverse Genetics Reveals a VariableInfection Gradient inthe Respiratory Tract.Cell 182:429-446 e14.

[0365] 16.Hatton CF,Botting RA,Duenas ME,Haq IJ,Verdon B,Thompson BJ,Spegarova JS,Gothe F,Stephenson E,Gardner AI,Murphy S,Scott J,Garnett JP,Carrie S,Powell J,Khan CMA,Huang L,Hussain R,Coxhead J,Davey T,SimpsonAJ,Haniffa M,Hambleton S,Brodlie M,Ward C,Trost M,Reynolds G,DuncanCJA.2021.Delayed induction of type I and III interferons mediates nasalepithelial cellpermissiveness to SARS-CoV-2.Nat Commun 12:7092.

[0366] 17.Hayflick L,Moorhead PS.1961.The serial cultivation of humandiploid cellstrains.Exp Cell Res 25:585-621.

[0367] 18.Zhou J,Li C,Sachs N,Chiu MC,Wong BH,Chu H,Poon VK,Wang D,Zhao X,Wen L,Song W,Yuan S,Wong KK,Chan JF,To KK,Chen H,Clevers H,YuenKY.2018.Differentiated human airway organoids to assess infectivity ofemerginginfluenza virus.Proc Natl Acad Sci U S A 115:6822-6827.

[0368] 19.Sachs N,Papaspyropoulos A,Zomer-van Ommen DD,Heo I,Bottinger L,KlayD,Weeber F,Huelsz-Prince G,Iakobachvili N,Amatngalim GD,de Ligt J,vanHoeck A,Proost N,Viveen MC,Lyubimova A,Derakhven S,KorTehshan J,Begthel H,Dekkers JF,Kumawat K,Ramos E,van Oosterhout MF,Offerhaus GJ,WienerDJ,Olimpio EP,Dijkstra KK,Smit EF,van der Linden M,Jaksani S,van deVen M,Jonkers J,Rios AC,Voest EE,Voest EECH,van Moorpent,EnCh E,vanOudenaarden A,Coenjaerts FE,Meyaard L,Bont LJ,Peters PJ,Tans SJ,van ZonJS,BojSF,Vries RG,Beekman JM,Clevers H.2019.Long-term expanding humanairwayorganoids for disease modeling.EMBO J 38.

[0369] 20.Mallapaty S.2021.The mini lungs and other organoids helping tobeat COVID.Nature 593:492-494.

[0370] 21.Li C,Chiu MC,Yu Y,Liu X,Xiao D,Huang J,Wan Z,ZhouJ.2022.Establishing Human Lung Organoids and Proximal Differentiation toGenerateMature Airway Organoids.JoVE doi:doi:10.3791 / 63684:e63684.

[0371] 22.Chiu MC,Li C,Liu X,Yu Y,Huang J,Wan Z,Xiao D,Chu H,Cai JP,Zhou B,Sit KY,Au WK,Wong KK,Li G,Chan JF,To KK,Chen Z,Jiang S,Clevers H,Yuen KY,ZhouJ202022 model of respiratory bipotential organ. epitheliumrecapitulateshigh infectivity of SARS-CoV-2 Omicron variant.Cell Discov 8:57.23.Lamers MM,Beumer J,van der Vaart J,Knoops K,Puschhof J,Breugem TI,Ravelli RBG,Paul vanSchayck J,Kytyn AZQD,Donukyne HZD, E,Riesebosch S,Kuijpers HJH,Schipper D,van de Wetering WJ,de Graaf M,Koopmans M,Cuppen E,Peters PJ,Haagmans BL,Clevers H.2020.SARS-CoV-2productively infects human gutenterocytes.Science 369:54.54.

[0372] 24.Mykytyn AZ,Breugem TI,Riesebosch S,Schipper D,van den Doel PB,RottierRJ,Lamers MM,Haagmans BL.2021.SARS-CoV-2 entry into humanairwayorganoids is serine protease-mediated and facilitated by the multibasic site 10.Elife.

[0373] 25.Chaturvedi S,Vasen G,Pablo M,Chen X,Beutler N,Kumar A,Tanner E,IllouzS,Rahgoshay D,Burnett J,Holguin L,Chen PY,Ndjamen B,Ott M,Rodick R,Rogers T,Smith DM,Weinberger LS.2021.Identification of a therapeuticinterferingparticle-A single-dose SARS-CoV-2 antiviral intervention with ahigh barrier toresistance.Cell 184:6022-6036 e18.

[0374] 26.Wang D,Li C,Chiu MC,Yu Y,Liu X,Zhao X,Huang J,Cheng Z,Yuan S,PoonV,Cai JP,Chu H,Chan JF,To KK,Yuen KY,Zhou J.2022.SPINK6 inhibitshumanairway serine proteases and restricts influenza virus activation.EMBOMol Med14:e14485.

[0375] 27.Sato T,Stange DE,Ferrante M,Vries RG,Van Es JH,Van den Brink S,VanHoudt WJ,Pronk A,Van Gorp J,Siersema PD,Clevers H.2011.Long-termexpansionof epithelial organoids from human colon,adenoma,adenocarcinoma,andBarrett'sepithelium.Gastroenterology 141:1762-72.

[0376] 28.Sato T,Vries RG,Snippert HJ,van de Wetering M,Barker N,Stange DE,van EsJH,Abo A,Kujala P,Peters PJ,Clevers H.2009.Single Lgr5 stem cellsbuildcrypt-villus structures in vitro without a mesenchymal niche.Nature 459:262-5.

[0377] 29.Kayisoglu O,Weiss F,Niklas C,Pierotti I,Pompaiah M,Wallaschek N,GermerCT,Wiegering A,Bartfeld S.2021.Location-specific cell identity ratherthanexposure to GI microbiota defines many innate immune signalling cascadesin the gutepithelium.Gut 70:687-697.

[0378] 30.Pan Y,Zhang D,Yang P,Poon LLM,Wang Q.2020.Viral load of SARS-CoV-2in clinical samples.Lancet Infect Dis 20:411-412.

[0379] 31.Co JY,Margalef-Catala M,Li X,Mah AT,Kuo CJ,Monack DM,AmievaMR.2019.Controlling Epithelial Polarity:A Human Enteroid Model for Host-PathogenInteractions.Cell Rep 26:2509-2520 e4.

[0380] 32.Fischer H,Widdicombe JH.2006.Mechanisms of acid and base secretionby theairway epithelium.J Membr Biol 211:139-50.

[0381] Curr MolMeddoi:10.2174 / 1566524021666210816095557 33.Sharma NK,Sarode SC.2021.Low pH and temperature of airway surfaceliquidare key determinants that potentiate SARS-CoV-2 infectivity.

[0382] 34. Jimenez L, Campos Elbow A, Sampaio VS, Oliveira AER, Ferreira LKK, Davanzo GG, de Brito Monteiro L, Victor Virgilio-da-Silva J, Borba MGS, Fabiano de Souza G, Zini N, de Andrade Gandolfi F, Muraro SP, Luiz Proenca-Modena Acid pH Increases SARS-CoV-2 Infection and the Risk of Death by COVID-19.Front Med(Lausanne)8:6

[0383] 35.Linfield DT,Raduka A,Aghapour M,Rezaee F.2021.Airway tightjunctions astargets of viral infections.Tissue Barriers 9:1883965.

[0384] 36.Loss W,Huang N,Bécavin C,Berg M,Queen R,Litvinukova M,Talavera-López C,Maatz H,Reichart D,Sampaziotis F,Worlock KB,Yoshida M,Barnes JL,Banovich NE,Barbry P,Brazma A,Collin J,Deusai TJ,Dusai TE,Eickelberg O,Falk C,Farzan M,Glass I,Gupta RK,Haniffa M,Horvath P,Hubner N,Hung D,Kaminski N,Krasnow M,Kropski JA,Kuhnemund M,Lako M,Lee H,Leroy S,Linnarson S,LundebergJ,Meyer K,Mia,Mio,ZB,Nawiz,Z. MC,Nikolic MZ,Noseda M,Ordovas-MontanesJ,Audit GY,Pe'er D,Powell J,Quake S,Rajagopal J,Tata PR,et al.2020.SARS-CoV-2entry factors are highly expressed innasal epithelial cells together withinnate immune genes.Nature Medicine-2688:68.

[0385] 37.Zachos NC,Kovbasnjuk O,Foulke-Abel J,In J,Blutt SE,de Jonge HR,EstesMK,Donowitz M.2016.Human Enteroids / Colonoids and IntestinalOrganoidsFunctionally Recapitulate Normal Intestinal Physiology and Pathophysiology. 291:3759-66.

[0386] 38.Hogan BL,Barkauskas CE,Chapman HA,Epstein JA,Jain R,Hsia CC,NiklasonL,Calle E,Le A,Randell SH,Rock J,Snitow M,Krummel M,Stripp BR,Vu T,White ES,Whitsett JA,Morrisey EE.2014.Repair and regeneration of therespiratorysystem:complexity,plasticity,and mechanisms of lung stem cellfunction.Cell StemCell 15:123-38.

[0387] 39.Pardo-Saganta A,Law BM,Tata PR,Villoria J,Saez B,Mou H,Zhao R,Rajagopal J.2015.Injury induces direct lineage segregation of functionallydistinctairway basal stem / progenitor cell subpopulations.Cell Stem Cell 16:184-97.

[0388] 40.Salahudeen AA,Choi SS,Rustagi A,Zhu J,van Unen V,de la OS,FlynnRA,Margalef-Catala M,Santos AJM,Ju J,Batish A,Usui T,Zheng GXY,Edwards CE,Wagar LE,Luca V,Anchang B,Nagendran M,Nguyen K,Hart DJ,Terry JM,Belgrader P,Ziraldo SB,Mikkelsen TS,Harbury PB,Glenn JS,Garcia KC,DavisMM,Baric RS,Sabatti C,Amieva MR,Blish CA,Desai TJ,Kuo CJ.2020.Progenitor identificationand SARS-CoV-2 infection in human distal lung organoids.Nature 588:670-6

[0389] 41.Lee JH,Tammela T,Hofree M,Choi J,Marjanovic ND,Han S,Canner D,WuK,Paschini M,Bhang DH,Jacks T,Regev A,Kim CF.2017.AnatomicallyandFunctionally Distinct Lung Mesenchymal Populations Marketed by Lgr5 andLgr6.Cell170:1149–1163e12.

[0390] 2016. BMP signaling and cellular dynamics during regeneration of airway epithelium from basal progenitors.Development 143:764-73.

[0391] [ PubMed ] 43.Zhao H, Lu L, Peng Z, Chen LL, Meng X, Zhang C, Ip JD, Chan WM, Chu AW, Chan KH, Jin DY, Chen H, Yuen KY, To KK cells.Emerg Microbes Infect 11:277–283.

[0392] 44.Rajan A,Weaver AM,Aloisio GM,Jelinski J,Johnson HL,Venable SF,McBride T,Aideyan L,Piedra FA,Ye X,Melicoff-Portillo E,Yerramilli MRK,ZengXL,Mancini MA,Stossi F,Maresso AW,Kotkar SA,Estes MK,Blutt S,AvadhanulaV,PiedraPA.2022.The Human Nose Organoid Respiratory Virus Model:an ExVivo HumanChallenge Model To Study Respiratory Syncytial Virus(RSV)andSevere AcuteRespiratory Syndrome Coronavirus 2(SARS-CoV-2)Pathogenesis andEvaluateTherapeutics.mBio doi:10.1128 / bio.03511–21:e0351121.

[0393] 45.Zhou J,Wang D,Wong BH,Li C,Poon VK,Wen L,Zhao X,Chiu MC,Liu X,YeZ,Yuan S,Sze KH,Chan JF,Chu H,To KK,Yuen KY.2019.Identificationandcharacterization of GLDC as host susceptibility gene to severeinfluenza.EMBO MolMed 11.

[0394] 46.Zhao X,Li C,Liu X,Chiu MC,Wang D,Wei Y,Chu H,Cai JP,Hau-Yee ChanI,Kak-Yuen Wong K,Fuk-Woo Chan J,Kai-Wang To K,Yuen KY,Zhou J.2021.HumanIntestinal Organoids Recapitulate Enteric Infections ofEnterovirusandCoronavirus.Stem Cell Reports 16:493-504.

[0395] 47.Zhou J,Li C,Liu X,Chiu MC,Zhao X,Wang D,Wei Y,Lee A,Zhang AJ,ChuH,Cai JP,Yip CC,Chan IH,Wong KK,Tsang OT,Chan KH,Chan JF,To KK,ChenH,YuenKY.2020.Infection of bat and human intestinal organoids by SARS-CoV-2.Nat Med26:1077-1083.

[0396] 48. Peacock TP, Brown JC, Zhou J, Thakur N, Newman J, Kugathasan R, SukhovaK, Kaforou M, Bailey D, Barclay WS. 2022. The SARS-CoV-2 variant, Omicron, shows rapid replication in human primary nasal epithelial cultures and efficiently uses the endosomal route of entry.bioRxivdoi:10.1101 / 2021.12.31.474653:2021.12.31.474653.

[0397] 49. Lamers MM, Mykytyn AZ, Breugem TI, Groen N, Knoops K, Schipper D, vanAcker R, van den Doel PB, Bestebroer T, Koopman CD, Reusken C, Muraro MJ, GeurtsvanKessel CH, van Royen ME, Peters PJ, Zhang J, Haagmans BL.2022.SARS-CoV-2Omicron efficiently infects human airway, but not alveolar epithelium.bioRxivdoi:10.1101 / 2022.01.19.476898:2022.01.19.476898.

[0398] It should be understood that the disclosed methods and compositions are not limited to the specific methods, protocols and reagents described, as these may vary. It should also be understood that the terminology used herein is only for the purpose of describing specific embodiments and is not intended to limit the scope of the present invention, which will only be limited by the appended claims.

[0399] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those generally understood by those skilled in the art to which the disclosed methods and compositions belong. Although any methods and materials similar or equivalent to the methods and compositions described herein can be used to practice or test the methods and compositions of the present invention, particularly useful methods, devices and materials are as described. Nothing herein should be construed as admitting that the present invention is not entitled to such disclosures due to prior inventions. It is not recognized that any reference constitutes prior art. The discussion of the references states the claims of their authors, and the applicant reserves the right to question the accuracy and relevance of the cited documents. It should be clearly understood that although many publications are cited herein, such citations do not constitute an admission that any of these documents form part of the common general knowledge in the art.

[0400] Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the methods and compositions described herein. Such equivalents are intended to be encompassed by the appended claims.

Claims

1. An in vitro generated organoid comprising a population of differentiated nasal epithelial cells having cellular heterogeneity and molecular markers similar to mature nasal epithelial tissue.

2. The organoid of claim 1, wherein the population of differentiated nasal epithelial cells are human nasal epithelial cells.

3. The organoid according to claim 1 or 2, wherein the differentiated nasal epithelial cell population expresses one or more molecular markers selected from the group comprising: angiotensin converting enzyme-2 (ACE2), transmembrane serine protease 2 (TMPRSS2), forkhead box G1 (FOXG1), SIX3, paired box-7 (PAX7), P63, keratin 5 (CK5), Sentan (SNTN), mucin 5AC (MUC5AC) and CC10.

4. The organoid according to any one of claims 1-3, wherein the differentiated nasal epithelial cell population expresses lower levels of trachea / bronchus-related genes selected from the group consisting of FOLR1, LMO3 and IRX2.

5. The organoid of any one of claims 1-4, wherein the cellular heterogeneity comprises a mixture of basal cells, ciliated cells, goblet cells, and club cells.

6. The organoid of any one of claims 1-5, wherein the differentiated nasal epithelial cell population is organized into a three-dimensional structure and encapsulated within a hydrogel or embedded within a biocompatible scaffold that provides structural support and promotes tissue organization.

7. The organoid of claim 6, wherein the differentiated nasal epithelial cell population comprises a percentage of about 12% to about 35% basal cells, a percentage of about 35% to about 45% ciliated cells, a percentage of about 5% to about 10% goblet cells, and a percentage of about 0.1% to about 5% club cells.

8. The organoid of claim 6 or 7, wherein ACE2 is expressed by about 20% to about 45% of the differentiated nasal epithelial cell population, and TMPRSS2 is expressed by about 40% to about 55% of the differentiated nasal epithelial cell population.

9. The organoid culture system of any one of claims 1-8, wherein the differentiated nasal epithelial cell population is organized into a two-dimensional (2D) monolayer.

10. The organoid culture system of claim 8, wherein the differentiated nasal epithelial cell population is incubated in a culture medium having a slightly acidic pH of about 6.0 to about 6.9, preferably about 6.6, for a period of time during differentiation.

11. The organoid culture system of claim 9 or 10, wherein the differentiated nasal epithelial cell population comprises a percentage of about 1% to about 10% basal cells, a percentage of about 75% to about 92% ciliated cells, a percentage of about 4% to about 22% goblet cells, and a percentage of about 0.05% to about 2% club cells.

12. The organoid culture system of any one of claims 9-11, wherein ACE2 is expressed by about 30% to about 50% of the differentiated nasal epithelial cell population, and TMPRSS2 is expressed by about 85% to about 100% of the differentiated nasal epithelial cell population.

13. The organoid according to any one of claims 1-12, wherein the population of differentiated nasal epithelial cells is derived from undifferentiated nasal cells obtained non-invasively from a subject, wherein the subject is preferably a human.

14. The organoid of any one of claims 1-13, wherein the population of differentiated nasal epithelial cells is genetically modified to increase or decrease the expression of specific genes involved in nasal tissue development, function, or disease.

15. The organoid of any one of claims 1-14, wherein the population of differentiated nasal epithelial cells exhibits functional properties including mucus production, ciliary beating, and response to olfactory stimulation.

16. A method for generating three-dimensional (3D) organoids of nasal epithelium, the method comprising the steps of: (i) attaching cells to a support structure that promotes (3D) organoid formation, wherein the cells are turbinate cells that are capable of differentiating into nasal epithelial cells; (ii) culturing the turbinate cells on a support structure in an expansion medium for a period of time to produce 3D human nasal undifferentiated cells, wherein the period of time is about 8 days to about 12 days, preferably about 10 days; (iii) culturing the 3D nasal undifferentiated cells on a support structure in a basal medium for a period of time to expand the central cavity, wherein the period of time is about 3 days to about 5 days, preferably about 4 days; (iv) culturing the 3D nasal undifferentiated cells on the support structure produced in step (iii) in a proximal differentiation medium for a period of time to produce 3D differentiated organoids of human nasal epithelium, wherein the period of time is about 5 days to about 7 days, preferably about 6 days.

17. The method of claim 16, wherein the expansion medium comprises a basal medium comprising one or more buffers, one or more growth factors, a ROCK inhibitor, a TGFβ inhibitor, a MAPK inhibitor, a WNT agonist, a BMP-4 inhibitor, one or more supplements, and one or more antibiotics; wherein the basal medium is Dulbecco's modified Eagle's medium (DMEM), Advanced DMEM / F12, RPMI-1640 or minimum essential medium (MEM); wherein the buffer is HEPES buffer, which is present in an amount ranging from 0.5% to about 1.5%, preferably about 1.0%; wherein the one or more growth factors are selected from the group comprising epidermal growth factor (EGF) and fibroblast growth factor (FGF), wherein the growth factor is preferably FGF-7 at a concentration of about 3 ng / ml to about 7 ng / ml, preferably about 5 ng / ml, and FGF-10 at a concentration of about 15 ng / ml to about 25 ng / ml, preferably about 20 ng / ml; wherein the ROCK inhibitor is Y-27632 at a concentration of about 3 μM to about 7 μM, preferably about 5 μM; wherein the TGF-β inhibitor is A8301 at a concentration of about 400 nM to about 600 nM, preferably about 500 nM; wherein the MAPK inhibitor is SB202190 at a concentration of about 0.5 μM to about 1.5 μM, preferably 1.0 μM; wherein the WNT agonist is R Spondin 1, which is present in an amount of about 8% to about 12%, preferably about 10%; wherein the BMP-4 inhibitor is Noggin, which is present at a concentration of about 8% to about 12%, preferably about 10%; wherein the one or more supplements are selected from the group comprising: an amount of about 0.5% to about 1.5%, preferably about 1% B27 supplement, N-acetylcysteine ​​at a concentration of about 1.0 mM to about 1.5 mM, preferably about 1.25 mM, and niacinamide at a concentration of about 7 mM to about 13 mM, preferably about 10 mM; and Wherein the one or more antibiotics are selected from the group comprising: penicillin-streptomycin in an amount of about 0.5% to about 1.5%, preferably about 1.0% and primocin in a concentration of about 75 μg / ml to about 125 μg / ml, preferably about 100 μg / ml.

18. The method according to claim 16 or 17, wherein the support structure comprises a material selected from the group consisting of: Collagen, hyaluronic acid extracellular matrix, synthetic hydrogel, decellularized extracellular matrix, alginate, poly(lactic-co-glycolic acid) (PLGA) or electrospun fibers, preferably 19. The method according to any one of claims 16-18, wherein the basal medium is supplemented with about 1% HEPES buffer, about and Advanced DMEM / F-12 with approximately 1% penicillin-streptomycin.

20. The method of any one of claims 16-19, wherein the proximal differentiation medium comprises a basal medium supplemented with a γ-secretase inhibitor at a concentration of about 7 μM to about 13 μM, preferably about 10 μM, and wherein the proximal differentiation medium has a pH of about 7.2 to about 7.6, preferably about 7.

4.

21. The method of any one of claims 16-20, further comprising replenishing the expansion medium once a day, three times a week, or four times a week.

22. The method of any one of claims 16-21, further comprising re-plating and passage the 3D human nasal undifferentiated cells one or more times.

23. A method for deriving a two-dimensional (2D) organoid monolayer of nasal epithelium from the 3D nasal undifferentiated cells produced by step (ii) of claim 16, the method comprising: (a) dissociating the 3D nasal undifferentiated cells into a plurality of single nasal undifferentiated cells; (b) transferring the plurality of single nasal undifferentiated cells to a dual chamber support structure and culturing the plurality of single nasal undifferentiated cells in an expansion medium for a period of time to allow cell attachment and expansion, wherein the period of time is about 1 day to about 3 days; and (c) Expanded nasal undifferentiated cells were cultured in first and second proximal differentiation media for a total of about 8 days to generate confluent two-dimensional (2D) organoid monolayers.

24. The method of claim 23, wherein the dual chamber support structure comprises a top chamber and a bottom chamber, and wherein the single nasal undifferentiated cell adheres to the top chamber of the support structure.

25. The method according to claim 23 or 24, wherein the culturing of step (c) comprises: adding the first proximal differentiation medium to the top chamber and the bottom chamber, wherein the first proximal differentiation medium has a pH of about 7.2 to about 7.6, preferably about 7.4; incubating the nasal undifferentiated cells for about 2 days; replacing the first proximal differentiation medium in the top chamber with the second proximal differentiation medium, wherein the second proximal differentiation medium has a pH of about 6.4 to about 6.8, preferably about 6.6; and The nasal undifferentiated cells were incubated for about 6 days.

26. A method for screening an agent for an effect on the nasal epithelium, the method comprising contacting an in vitro produced organoid according to any one of claims 1-15 with the agent, and determining the effect of the agent on the survival, proliferation, differentiation, morphological parameters, genetic parameters or functional parameters of the in vitro produced organoid.

27. The method of claim 26, wherein the agent is an antiviral agent, an antibacterial agent, an antifungal agent, or an antiallergic agent, wherein the effect of the agent indicates that the agent is safe for treating respiratory tract infections.

28. The method of claim 26 or 27, wherein the agent is a nucleic acid or an analog thereof, a polypeptide or an analog thereof, an antibody, a chemical, a small molecule and / or any combination thereof.

29. A kit for generating a two-dimensional monolayer or three-dimensional organoid of human nasal epithelium, the kit comprising a combination of two or more of: (i) an expansion medium for deriving 3D undifferentiated nasal cells, the expansion medium comprising a basal medium comprising one or more buffers, growth factors, a ROCK inhibitor, a TGFβ inhibitor, a MAPK inhibitor, a WNT agonist, a BMP-4 inhibitor, one or more supplements, and one or more antibiotics; (ii) a basal medium comprising a HEPES buffer, and Advanced DMEM / F-12 with antibiotics; (iii) one or more proximal differentiation media comprising a basal medium supplemented with a γ-secretase inhibitor; and (iv) one or more supports or support structures.

Images