New features for lung cancer detection

Abstract

The present invention relates to a method for diagnosing lung cancer in a patient. Furthermore, the present invention relates to a method for monitoring lung cancer in a patient. In addition, the invention relates to kits for carrying out these methods.

Description

Technical Field

[0001] The present invention relates to methods for diagnosing lung cancer in a patient. In addition, the present invention relates to methods for monitoring lung cancer in a patient. In addition, the present invention relates to kits for implementing these methods. Background Art

[0002] Cancer is the uncontrolled growth of abnormal cells anywhere in the body. The abnormal cells are called cancer cells, malignant cells, or tumor cells. Cancer cells can multiply uncontrollably and form clumps of cancer cells.

[0003] The most common types of cancer in men are lung cancer, prostate cancer, colorectal cancer, and stomach cancer. In women, the most common types are breast cancer, colorectal cancer, lung cancer, and cervical cancer.

[0004] Lung or bronchial cancer refers to tumors that originate in the lung parenchyma or endobronchial tubes. It is one of the leading causes of cancer-related death in Europe and the United States. Since 1987, lung cancer has caused more deaths than breast cancer in women. It is estimated that there are 225,000 new cases of lung cancer and about 160,000 deaths from lung cancer in the United States each year. Interestingly, lung cancer was a relatively rare disease in the early 20th century. Its dramatic rise in the following decades was mainly due to the increase in smoking among both men and women.

[0005] Lung cancer is commonly diagnosed using a variety of imaging techniques, such as radiology and / or computed tomography (CT), but there is a clear need for more cost-effective, easier-to-use, and faster technologies.

[0006] Molecular studies have identified several diagnostic markers for lung cancer. However, so far, their diagnostic value for lung cancer has been low. Therefore, more sensitive biomarkers are needed. In addition, there is currently no standard blood or laboratory test that has been proven to help diagnose lung cancer.

[0007] The inventors have identified new RNA molecules that are significantly dysregulated in lung cancer patients compared to healthy controls. It has been shown that the characteristics of these new RNA molecules have a high degree of diagnostic relevance for lung cancer determination. Therefore, these new RNA molecules can be used as biomarkers for lung cancer diagnosis and biomarkers for lung cancer monitoring. Summary of the invention

[0008] In a first aspect, the present invention relates to a method for diagnosing lung cancer in a patient, the method comprising the following steps:

[0009] (i) determining the level of at least one RNA molecule in a blood sample from a patient, wherein the at least one RNA molecule comprises a nucleotide sequence according to SEQ ID NO: 1, or a fragment thereof, or a sequence having at least 80% sequence identity thereto;

[0010] (ii) determining the levels of at least two RNA molecules in a blood sample from the patient, wherein the at least two RNA molecules include a first RNA molecule and a second RNA molecule,

[0011] wherein the first RNA molecule comprises the nucleotide sequence according to SEQ ID NO: 1, or a fragment thereof, or a sequence having at least 80% sequence identity thereto, and the second RNA molecule comprises the nucleotide sequence according to SEQ ID NO: 2, or a fragment thereof, or a sequence having at least 80% sequence identity thereto; or

[0012] (iii) determining the levels of at least two RNA molecules in a blood sample from the patient, wherein the at least two RNA molecules include a first RNA molecule and a second RNA molecule,

[0013] Wherein, the first RNA molecule comprises a nucleotide sequence according to SEQ ID NO:2, a fragment thereof, or a sequence having at least 80% sequence identity thereto, and the second RNA molecule comprises a nucleotide sequence according to SEQ ID NO:3, a fragment thereof, or a sequence having at least 80% sequence identity thereto.

[0014] In a second aspect, the present invention relates to a method for monitoring a patient suspected of having lung cancer or a patient suffering from lung cancer, the method comprising the following steps:

[0015] (i) determining the level of at least one RNA molecule in a blood sample from a patient, wherein the at least one RNA molecule comprises a nucleotide sequence according to SEQ ID NO: 1, or a fragment thereof, or a sequence having at least 80% sequence identity thereto;

[0016] (ii) determining the levels of at least two RNA molecules in a blood sample from the patient, wherein the at least two RNA molecules include a first RNA molecule and a second RNA molecule,

[0017] wherein the first RNA molecule comprises the nucleotide sequence according to SEQ ID NO: 1, or a fragment thereof, or a sequence having at least 80% sequence identity thereto, and the second RNA molecule comprises the nucleotide sequence according to SEQ ID NO: 2, or a fragment thereof, or a sequence having at least 80% sequence identity thereto; or

[0018] (iii) determining the levels of at least two RNA molecules in a blood sample from the patient, wherein the at least two RNA molecules include a first RNA molecule and a second RNA molecule,

[0019] Wherein, the first RNA molecule comprises a nucleotide sequence according to SEQ ID NO:2, or a fragment thereof, or a sequence having at least 80% sequence identity therewith, and the second RNA molecule comprises a nucleotide sequence according to SEQ ID NO:3, or a fragment thereof, or a sequence having at least 80% sequence identity therewith.

[0020] In a third aspect, the present invention relates to the use of:

[0021] (i) use of at least one RNA molecule for diagnosing lung cancer in a patient, or for monitoring a patient suspected of having lung cancer or a patient suffering from lung cancer,

[0022] wherein the at least one RNA molecule comprises a nucleotide sequence according to SEQ ID NO: 1, or a fragment thereof, or a sequence having at least 80% sequence identity thereto;

[0023] (ii) use of at least two RNA molecules for diagnosing lung cancer in a patient, or for monitoring a patient suspected of having lung cancer or a patient suffering from lung cancer, wherein the at least two RNA molecules comprise a first RNA molecule and a second RNA molecule,

[0024] wherein the first RNA molecule comprises the nucleotide sequence according to SEQ ID NO: 1, or a fragment thereof, or a sequence having at least 80% sequence identity thereto, and the second RNA molecule comprises the nucleotide sequence according to SEQ ID NO: 2, or a fragment thereof, or a sequence having at least 80% sequence identity thereto; or

[0025] (iii) at least two RNA molecules for diagnosing lung cancer in a patient, or for monitoring a patient suspected of having lung cancer or a patient suffering from lung cancer, wherein the at least two RNA molecules comprise a first RNA molecule and a second RNA molecule,

[0026] Wherein, the first RNA molecule comprises a nucleotide sequence according to SEQ ID NO:2, or a fragment thereof, or a sequence having at least 80% sequence identity therewith, and the second RNA molecule comprises a nucleotide sequence according to SEQ ID NO:3, or a fragment thereof, or a sequence having at least 80% sequence identity therewith.

[0027] In a fourth aspect, the present invention relates to the use of a kit for diagnosing lung cancer in a patient, or for monitoring a patient suspected of having lung cancer or a patient suffering from lung cancer, the kit comprising:

[0028] (i) means for determining the level of at least one RNA molecule in a blood sample from a patient,

[0029] wherein the at least one RNA molecule comprises a nucleotide sequence according to SEQ ID NO: 1, or a fragment thereof, or a sequence having at least 80% sequence identity thereto;

[0030] (ii) means for determining the levels of at least two RNA molecules in a blood sample from a patient, wherein the at least two RNA molecules comprise a first RNA molecule and a second RNA molecule,

[0031] wherein the first RNA molecule comprises the nucleotide sequence according to SEQ ID NO: 1, or a fragment thereof, or a sequence having at least 80% sequence identity thereto, and the second RNA molecule comprises the nucleotide sequence according to SEQ ID NO: 2, or a fragment thereof, or a sequence having at least 80% sequence identity thereto; or

[0032] (iii) a means for determining the levels of at least two RNA molecules in a blood sample from a patient, wherein the at least two RNA molecules comprise a first RNA molecule and a second RNA molecule,

[0033] Wherein, the first RNA molecule comprises a nucleotide sequence according to SEQ ID NO:2, or a fragment thereof, or a sequence having at least 80% sequence identity therewith, and the second RNA molecule comprises a nucleotide sequence according to SEQ ID NO:3, or a fragment thereof, or a sequence having at least 80% sequence identity therewith.

[0034] This summary of the invention does not necessarily describe all features of the invention. Other embodiments will become apparent upon reading the following detailed description. DETAILED DESCRIPTION

[0035] definition

[0036] Before describing the present invention in detail below, it should be understood that the present invention is not limited to the specific methodology, scheme and reagent described herein, because they will vary. It should also be understood that the terms used herein are only for the purpose of describing specific embodiments and are not intended to limit the scope of the present invention, which will be limited only by the appended claims. Unless otherwise defined, all technical terms and scientific terms used herein have the same meaning as those generally understood by those of ordinary skill in the art.

[0037] Preferably, the terms used herein are as described in "A multilingual glossary of biotechnological terms: (IUPAC Recommendations)", Leuenberger, HGW, Nagel, B. and H., ed. (1995), Helvetica Chimica Acta, CH-4010 Basel, Switzerland.

[0038] Multiple documents are quoted in the full text of this application document. Each document (including all patents, patent applications, scientific publications, manufacturer's specifications, instructions, GenBank accession number sequence submissions, etc.) quoted herein (whether above or below) is incorporated herein by reference in its entirety. Any content herein should not be regarded as admitting that the present invention is not qualified to advance this type of disclosure by means of prior invention. In the case of conflict between the definition or teaching of this type of reference incorporated into and the definition or teaching described in the application document, the text of the application document shall prevail.

[0039] The term "comprise" or variations such as "comprises / comprising" according to the present invention is intended to include the stated integer or group of integers, but not to exclude any other integer or group of integers. The term "consisting essentially of" according to the present invention is intended to include the stated integer or group of integers, while excluding modifications or other integers that would substantially affect or change the stated integer. The term "consisting of" or variations such as "consists of" according to the present invention is intended to include the stated integer or group of integers, and to exclude any other integer or group of integers.

[0040] The terms “a,” “an,” and “the” and similar referents used in the context of describing the invention (especially in the context of the claims) are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context.

[0041] As used herein, the term "about" indicates a certain variation from the quantitative value preceding it. In particular, unless otherwise indicated or inferred, the term "about" allows a variation of ±5% from the quantitative value preceding it. Unless otherwise expressly stated, the use of the term "about" also includes the specific quantitative value itself. For example, the expression "about 80°C" allows a variation of ±4°C, thus referring to a range from 76°C to 84°C.

[0042] As used herein, the term "sequence identity" refers to a measure that allows the expression of nucleotide and amino acid sequence similarity. The percentage of sequence identity can be determined by sequence alignment. Such an alignment can be achieved using several algorithms known in the art, preferably using the mathematical algorithm of Karlin and Altschul (Karlin & Altschul (1993) Proc. Natl. Acad. Sci. USA 90: 5873-5877), using hmmalign (HMMER package) or using the CLUSTAL algorithm (Thompson, JD, Higgins, DG & Gibson, TJ (1994) Nucleic Acids Res. 22, 4673-80) or the CLUSTALW2 algorithm (Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H, Valentin F, Wallace IM, Wilm A, Lopez R, Thompson JD, Gibson TJ, Higgins DG. (2007). Clustal W and Clustal X version 2.0. Bioinformatics, 23, 2947-2948).

[0043] The degree of sequence identity (sequence matching) can be calculated using, for example, BLAST, BLAT or BlastZ (or BlastX). Similar algorithms are incorporated into the BLASTN and BLASTP programs of Altschul et al., (1990) J. Mol. Biol. 215: 403-410. BLAST protein searches are performed by the BLASTP program, which is available, for example, at the following website:

[0044] http: / / blast.ncbi.nlm.nih.gov / Blast.cgi?PROGRAM=blastp&BLAST_PROGRAMS=blastp&PAGE_TYPE=BlastSearch&SHOW_DEFAULTS=on&LINK_LOC=blasthome.

[0045] The preferred algorithm parameters used are the default parameters as they are set on the indicated website:

[0046] Desired threshold = 10, word length = 3, maximum matches in query range = 0, matrix = BLOSUM62, gap costs = presence: 11 extension: 1, compositional adjustments = conditional compositional scoring matrix adjustments, and non-redundant protein sequence database (nr).

[0047] To obtain gapped alignments for comparison purposes, Gapped BLAST was used as described in Altschul et al., (1997) Nucleic Acids Res. 25:3389-3402. When using BLAST and Gapped BLAST programs, the default parameters of the respective programs were used. Sequence matching analysis can be supplemented by established homology mapping techniques such as Shuffle-LAGAN (Brudno M., Bioinformatics 2003b, 19 Suppl 1:154-162) or Markov random fields.

[0048] If not otherwise specifically indicated, when referring to percentages of sequence identity in the present application, these percentages can be calculated relative to the full length of the indicated reference sequence. For example, the statement "a nucleotide sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g., at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity with SEQ ID NO: XYZ" means that the percentage of sequence identity is calculated relative to the total length of SEQ ID NO: XYZ. Variants of the nucleotide sequences according to SEQ ID NO: 1 to SEQ ID NO: 71 are specifically described herein. The variant has at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity with the nucleotide sequence according to SEQ ID NO: 1 to SEQ ID NO: 71.

[0049] If not otherwise specifically indicated, otherwise when calculating the percentage of sequence identity between two sequences, these percentages can also be calculated relative to the total length of the longer of the two sequences. For example, the sentence "a nucleotide sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g., at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity to SEQ ID NO: XYZ" means that the percentage of sequence identity is calculated relative to the longer sequence of the two sequences.

[0050] As used herein, the term "RNA molecule" refers to a polymeric molecule that is essential in various biological functions of gene coding, decoding, regulation and expression. Ribonucleic acid (RNA) and deoxyribonucleic acid (DNA) are nucleic acids. Together with lipids, proteins and carbohydrates, nucleic acids constitute one of the four major macromolecules necessary for all known life forms. Like DNA, RNA is also assembled into a chain of nucleotides, but unlike DNA, RNA is found in nature as a single strand folded to itself, rather than a paired double strand. Cellular organisms use messengers (mRNA) to transmit genetic information (using nitrogenous bases of guanine, uracil, adenine and cytosine, represented by the letters G, U, A and C) to guide the synthesis of specific proteins. Some RNA molecules play an active role in cells by catalyzing biological reactions, controlling gene expression, or sensing and conveying responses to cell signals. One of these active processes is protein synthesis, in which RNA molecules guide the universal function of protein synthesis on ribosomes. This process uses transfer RNA (tRNA) molecules to deliver amino acids to the ribosome, where ribosomal RNA (rRNA) then links the amino acids together to form the encoded protein.

[0051] As used herein, the term "small RNA molecule" refers to a polymeric RNA molecule that is typically less than 200 ribonucleotides, preferably less than 50 ribonucleotides in length. Specifically, the length of a small RNA molecule is between 10 and <200 ribonucleotides. More specifically, the length of a small RNA molecule is between 10 and <50 ribonucleotides. An RNA molecule having a nucleotide sequence according to SEQ ID NO: 1 to SEQ ID NO: 79 is a small RNA molecule.

[0052] As used herein, the term "non-coding small RNA molecule" refers to an RNA molecule that is not translated into protein. In particular, non-coding small RNA molecules can be defined by length. The length of non-coding small RNA molecules is generally less than 200 ribonucleotides, preferably less than 50 ribonucleotides. Specifically, the length of non-coding small RNA molecules is between 10 and <200 ribonucleotides. More specifically, the length of small RNA molecules is between 10 and <50 ribonucleotides. Abundant and functionally important types of non-coding RNA include transfer RNA (tRNA), ribosomal RNA (rRNA), microRNA (miRNA), small interfering RNA (siRNA) or piwi interacting RNA (piRNA). RNA molecules having nucleotide sequences according to SEQ ID NO: 1 to SEQ ID NO: 79 are non-coding small RNA molecules. For example, an RNA molecule including a nucleotide sequence according to SEQ ID NO: 2 is a 28S ribosomal RNA (rRNA) fragment, which is significantly upregulated in lung cancer patients compared to healthy controls. Non-coding small RNA molecules include miRNA and isomiR.

[0053] As used herein, the term "miRNA" (also known as "microRNA") refers to a single-stranded RNA molecule. The length of miRNA can be a molecule of 10 to 50 nucleotides (e.g., a molecule of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides in length), excluding optional markers and / or extended sequences (e.g., biotin extension).

[0054] miRNA regulates gene expression and is encoded by genes. They are transcribed from the DNA of the genes, but miRNA is not translated into protein (i.e., miRNA is a non-coding RNA). The gene encoding miRNA is longer than the processed mature miRNA molecule. miRNA is initially transcribed as a longer precursor molecule (>1000 nucleotides long), called a primary miRNA transcript (pri-miRNA). Pri-miRNA has a hairpin structure and is processed by the Drosha enzyme (as part of the micro-processing complex). After Drosha processing, pri-miRNA is only 60-100 nucleotides long and is called a precursor miRNA (pre-miRNA). At this time, pre-miRNA is exported to the cytoplasm, where it encounters the Dicer enzyme. Dicer splits miRNA into two to form a duplex miRNA chain. Traditionally, only one of these miRNA arms is considered important in gene regulation: this arm is destined to be loaded into the RNA-induced silencing complex (RISC) and appears in higher concentrations in the cell. This is often called the "guide" chain and is named miR. The other arm is called the "minor miRNA" or "passenger miRNA" and is often named miR*. Passenger miRNAs were once thought to be completely degraded, but deep sequencing studies have found that some minor miRNAs persist and in fact play functional roles in gene regulation. As a result of these developments, the naming convention has changed. The miR-5p / miR-3p nomenclature has been adopted to replace the miR / miR* naming scheme. According to the new system, the 5' arm of the miRNA is always named miR-5p, while the 3' arm is miR-3p. The current nomenclature is as follows: the prefix "miR" is followed by a dash and a number, the latter of which usually indicates the order of nomenclature. For example, hsa-miR-16 was named before hsa-miR-342 and was probably discovered before hsa-miR-342. Capitalized "miR-" refers to the mature form of miRNA (e.g., hsa-miR-16-5p and hsa-miR-16-3p), while non-capitalized "mir-" refers to pre-miRNA and pri-miRNA (e.g., hsa-miR-16), and "MIR" refers to the genes encoding them. However, since this is a recent change, the literature usually refers to the original miR / miR* name. After processing, the duplex miRNA chain is loaded onto the Argonaute (AGO) protein to form the precursor of RISC. The complex causes the duplex to unravel, and the passenger RNA chain is discarded, leaving a mature RISC carrying a mature single-stranded miRNA. When silencing the expression of its target gene, miRNA remains a part of RISC. Although this is a typical pathway for miRNA biogenesis, many other pathways have been discovered.These pathways include Drosha-independent pathways (e.g., the mirtron pathway, the snoRNA-derived pathway, and the shRNA-derived pathway) and Dicer-independent pathways (e.g., one pathway that relies on AGO for cleavage and another pathway that relies on tRNaseZ).

[0055] As used herein, the term "miRBase" refers to a mature library of validated miRNAs. www.mirbase.org ) is a searchable database of published miRNA sequences and annotations. Each entry in the miRBase sequence database represents the predicted hairpin portion of a miRNA transcript (referred to as mir in the database), as well as information about the sequence and position of the mature miRNA sequence (referred to as miR). Both hairpin and mature sequences are available for searching and browsing, and entries can also be retrieved by name, keywords, references, and annotations. All sequence and annotation data are also available for download. In October 2018, miRbase version 22.1 was released. This is the current version [check].

[0056] As used herein, the term "isomiR" (or "miRNA isomer") refers to a miRNA with slight variations in sequence, which is caused by changes in the cleavage site during miRNA biogenesis. In particular, imprecise cleavage by Dicer and Drosha or turnover of miRNAs can lead to miRNAs that are heterogeneous in length and / or sequence. isomiRs (miRNA isomers) can be divided into three main categories: 3'isomiRs (trimmed or one or more nucleotides added at the 3' position), 5'isomiRs (trimmed or one or more nucleotides added at the 5' position), and polymorphic isomiRs (some nucleotides in the sequence differ from the wild-type mature miRNA sequence). It is conceivable that increased expression of miRNA variants or individual isomiRs leads to loss or attenuation of the function of the corresponding wild-type mature miRNA, or leads to the regulation of different transcriptomes. Recent studies have shown that isomiRs may play a vital role in a variety of cancers, tissues, and cell types. Therefore, it is absolutely necessary to detect miRNAs as well as isomiRs to accurately reflect the underlying biological situation and make correct diagnostic and therapeutic decisions.

[0057] RNA can be isolated from a sample using any of a variety of procedures known in the art, for example, Applied Biosystems ABI 6100 Nucleic Acid PrepStation (Life Technologies, Foster City, CA) and ABI 6700 fully automated nucleic acid workstation (Life Technologies, Foster City, CA), mirVana TM RNA isolation kit (Life Technologies, Austin, TX), PAXgene Blood RNA Kit (Qiagen, Hilden, Germany), etc.

[0058] As used herein, the term "total RNA" refers to the isolated RNA (including small (non-coding) RNA, in particular RNA molecules as described herein) present in a blood sample. Preferably, the total RNA comprises a small (non-coding) RNA fraction or a small (non-coding) RNA enriched fraction. For example, the total RNA (including a small (non-coding) RNA fraction or a small (non-coding) RNA enriched fraction) is obtained by: lysis of blood cells in a blood cell preparation (e.g., Trizol), followed by RNA purification, e.g., by phenol / chloroform extraction and / or separation-based techniques (e.g., glass fiber filter columns, silica gel membrane columns). Examples of kits for RNA separation and purification include miRNeasy kits (Qiagen), PAXgene Blood miRNA kits (Qiagen), mirVana PARIS kits (Life Technologies), PARIS kits (Life Technologies), TempusSpin RNA isolation kits (Life Technologies).

[0059] As used herein, the term "lung cancer" refers to a disease consisting of uncontrolled cell growth in lung tissue. This growth may lead to metastasis, that is, invasion of adjacent tissues and infiltration outside the lungs. The vast majority of primary lung cancers are carcinomas of the lungs that originate from epithelial cells. Lung cancer is the most common cause of cancer-related death in men and women. The most common symptoms are shortness of breath, cough (including coughing up blood) and weight loss.

[0060] Lung cancer can be classified as stage I, stage II, stage III, or stage IV lung cancer. Specifically, lung cancer can be staged as follows:

[0061] Stage I means the cancer is small. It has not spread to the lymph nodes or other distant organs. Stage I is the early stage of lung cancer. Stage I can be divided into IA and IB.

[0062] Stage IA means the cancer is equal to or smaller than 3 cm.

[0063] Stage IB means the cancer is between 3 cm and 4 cm. It may also grow into structures such as the main airways of the lungs (mainstream bronchi) or the membrane that covers the lungs (visceral pleura).

[0064] Stage II is still an early stage of lung cancer. Stage II is divided into stage IIA and stage IIB. Part of the affected lung may have collapsed.

[0065] Stage IIA means the cancer is between 4 cm and 5 cm in size, but there are no cancer cells in any lymph nodes.

[0066] Stage IIB means the cancer is up to 5 cm in size and there are cancer cells in the lymph nodes near the affected lung. Or, it is between 5 cm and 7 cm, but there are no cancer cells in any lymph nodes. Or, the cancer is not in any lymph nodes but has spread to one or more of the following areas: the chest wall (ribs, muscles, or skin), the nerves close to the lungs (phrenic nerves), or the layers covering the heart (mediastinal pleura and parietal pericardium). Or, the cancer is smaller than 7 cm, but there is more than one tumor in the same lobe of the lung.

[0067] Stage III can be divided into stage IIIA, stage IIIB, and stage IIIC. It is sometimes called locally advanced lung cancer.

[0068] In stage IIIA, the cancer is up to 5 cm in size and has spread to lymph nodes in the center of the chest on the same side as the tumor. Or, the cancer is between 5 cm and 7 cm, and there is more than one tumor in the same lobe of the lung. Or, the cancer has spread to one or more of the following areas immediately outside the lung: the chest wall (ribs, muscle, or skin), nerves close to the lungs (phrenic nerves), layers covering the heart (mediastinal pleura and parietal pericardium), or lymph nodes in or near a lung. Or, the cancer is larger than 7 cm. It has not spread to lymph nodes, but has spread to one or more of the following areas: the muscle under the lung (diaphragm), the center area of ​​the chest (mediastinum), the heart, major blood vessels, the airways (trachea), the nerves to the voice box (larynx), the food pipe (esophagus), the spine, or the area where the airways separate (carina). Or, the cancer is in more than one lobe of the same lung, and there may also be cancer cells in lymph nodes close to the affected lung.

[0069] Stage IIIB can also mean different situations. The cancer is smaller than 5 cm and has spread to lymph nodes in one of these places: the chest on the side opposite the affected lung, the neck, or above the collarbone. Or, the cancer is between 5 cm and 7 cm and has spread to lymph nodes in the center of the chest. Or, the cancer is any size, has spread to lymph nodes in the center of the chest, and has spread to one or more of the following areas: the chest wall, the muscle under the lungs (diaphragm), or the layers covering the heart (mediastinal pleura and parietal pericardium). Or, the cancer has spread to lymph nodes in the center of the chest. A lung tumor is larger than 7 cm or has spread to major structures in the chest, such as the heart, airway (trachea), food pipe (esophagus), or major blood vessels.

[0070] Stage IIIC means the cancer is between 5 cm and 7 cm in size, or has spread to one or more of the following: the nerves near the lungs (phrenic nerves) or the layer covering the heart (parietal pericardium), and has spread to lymph nodes in the following: in the center of the chest, on the side opposite the affected lung; or at the top of the lung on the same or opposite side; or above the collarbone. Or, there is more than one tumor in different lobes of the same lung. Alternatively, stage IIIC can mean the cancer is larger than 7 cm, or has spread to one of the following: the muscle under the lungs (diaphragm), the center of the chest (mediastinum), the heart, the major blood vessels, the airway (trachea), the nerve to the larynx (recurrent laryngeal nerve), the food pipe (esophagus), the spine, or the area where the airways are separated (crista), and has spread to lymph nodes in the following: in the center of the chest, on the side opposite the affected lung; or at the top of the lung on the same or opposite side; or above the collarbone. Or, there are tumors in more than one lobe of the lung.

[0071] Stage IV means that the lung cancer has spread. It can be labeled as advanced lung cancer. It is divided into stages IVA and IVB.

[0072] Stage IVA can mean any of the following: cancer in both lungs, cancer in the layer covering the lungs (pleura) or the layer covering the heart (pericardium), or fluid around the lungs or heart that contains cancer cells. Or, it can mean there is a single area of ​​cancer that has spread outside the chest to lymph nodes or organs, such as the liver or bones.

[0073] Stage IVB means the cancer has spread to several areas of one or more organs.

[0074] In one embodiment, the lung cancer is non-small cell lung cancer (NSCLC) or small cell lung cancer (SCLS). In a preferred embodiment, the lung cancer is non-small cell lung cancer (NSCLC). In a more preferred embodiment, NSCLC is lung adenocarcinoma (LUAD) or lung squamous cell carcinoma (LUSC).

[0075] As used herein, the term "small cell lung cancer (SCLC)" refers to a highly malignant cancer that arises in the lungs. Small cell carcinomas of the lungs typically arise in the central respiratory tract and infiltrate the submucosal layer, causing narrowing of the bronchial airways. Common symptoms include cough, dyspnea, weight loss, and weakness. Small cell carcinomas have a shorter doubling time, higher growth fractions, and earlier development of metastases compared to non-small cell carcinomas. SCLC accounts for approximately 15% of all lung cancers.

[0076] Small cell lung cancer can be divided into two clinicopathological stages, called limited stage (LS) and extensive stage (ES). The stage is usually determined by whether metastases are present, whether the tumor appears to be confined to the chest cavity, and whether the entire tumor burden in the chest can be contained within a single radiation therapy portal. Generally, if the tumor is confined to one lung and the lymph nodes near that lung, the cancer is called LS. If the cancer has spread beyond this portal, the cancer is called ES.

[0077] As used herein, the term "non-small cell lung cancer (NSCLC)" refers to any type of epithelial lung cancer other than small cell lung cancer (SCLC). NSCLC accounts for about 85% of all lung cancers. As a category, NSCLC is relatively insensitive to chemotherapy compared to small cell lung cancer. Where possible, they are mainly treated by surgical resection with the intent of curing, although chemotherapy is increasingly used both before surgery (neoadjuvant chemotherapy) and after surgery (adjuvant chemotherapy). In one embodiment, NSCLC is squamous cell carcinoma, large cell carcinoma, or adenocarcinoma.

[0078] As used herein, the term "diagnosing lung cancer" means determining whether a patient shows signs of or has lung cancer.

[0079] As used herein, the term "monitoring a patient suspected of having lung cancer" means determining whether a patient suspected of having lung cancer develops lung cancer over time.

[0080] As used herein, the term "monitoring a patient having lung cancer" means determining the progression of lung cancer in a patient over time, e.g., whether lung cancer is worsening in the patient, is not worsening / stable in the patient, or the patient is improving over time.

[0081] As used herein, the term "(therapeutic) treatment / therapy" refers to any treatment / therapy that improves a patient's health status and / or prolongs (increases) a patient's lifespan. The treatment / therapy may eliminate a patient's disease, prevent, inhibit or slow the progression of a patient's disease, reduce the frequency or severity of a patient's symptoms, and / or reduce recurrence in a patient currently suffering from or previously suffering from a disease.

[0082] As used herein, the term "lung cancer therapy" refers to any regimen, method and / or agent that can be used for the prevention, management, treatment and / or alleviation of lung cancer. In particular, as used herein, the term "lung cancer therapy" means achieving one or more of the following: (i) tumor growth inhibition and / or tumor cell death, (ii) reduction in tumor markers, (iii) reduction in tumor lesions and metastases, (iv) reduction in tumor burden as demonstrated by imaging studies (such as computed tomography (CT), magnetic resonance imaging (MRI), positron emission tomography (PET), etc.), and (v) reduction in tumor burden as demonstrated by patient self-report or clinical assessment.

[0083] Specifically, lung cancer therapy includes but is not limited to drug therapy, supportive therapy and / or other therapies known to those skilled in the art (e.g., medical staff) for prevention, management, treatment and / or alleviation of lung cancer. More specifically, lung cancer therapy includes but is not limited to surgery, chemotherapy, targeted therapy, immunotherapy, oncolytic virus therapy, vaccine therapy, radiotherapy, laser therapy, thermotherapy and administration of drugs, or a combination thereof, such as a combination of chemotherapy and immunotherapy.

[0084] As used herein, the term "patient" refers to any subject who wishes to know whether she or he suffers from lung cancer. In particular, as used herein, the term "patient" refers to a subject suspected of being affected by lung cancer. The patient may be diagnosed as being affected by lung cancer, i.e., being ill, or may be diagnosed as not being affected by lung cancer, i.e., being healthy. The patient may further become a monitored subject to determine whether lung cancer develops / further develops in the subject over time. In particular, the patient may be monitored in the form of longitudinal monitoring. Therefore, over time, the course of lung cancer (particularly after or during treatment) can be observed in the patient. The patient may also be retested for lung cancer, and the patient may be diagnosed as being diagnosed as developing lung cancer over time or not developing lung cancer.

[0085] It should be noted that a patient diagnosed as healthy (ie, not having lung cancer) may have another disease or condition that is not tested / unknown.

[0086] The patient can be any mammal, including humans and other mammals, for example, animals such as rabbits, mice, rats or monkeys. Human subjects are particularly preferred.

[0087] As used herein, the term "(control) subject" refers to a subject known to be unaffected by lung cancer (i.e., healthy) (negative control). As used herein, the term "(control) subject" also refers to a subject known to be affected by lung cancer (i.e., diseased) (positive control).

[0088] It should be noted that a known healthy (control) subject (ie, not suffering from lung cancer) may have another disease or condition that is not tested / unknown.

[0089] The (control) subject may be any mammal, including humans and further mammals, for example, animals such as rabbits, mice, rats or monkeys. Human subjects are particularly preferred.

[0090] As used herein, the term "blood sample" includes whole blood or a blood fraction. Preferably, the blood fraction is selected from the group consisting of a blood cell fraction, plasma and serum. More preferably, the blood cell fraction includes / contains red blood cells, white blood cells and / or platelets. Even more preferably, the blood cell fraction is a white blood cell fraction or a mixture of red blood cells, white blood cells and platelets.

[0091] The volume of the blood sample is preferably between 0.01 mL and 20 mL, more preferably between 0.1 mL and 10 mL, even more preferably between 0.5 mL and 8 mL, and most preferably between 1 mL and 5 mL.

[0092] The blood sample can be provided by taking blood from a patient or (control) subject, but can also be provided by using a previously separated sample. For example, a blood sample can be collected from a patient or (control) subject by conventional blood collection techniques.

[0093] Blood samples can also be obtained from patients or (control) subjects before therapeutic treatment begins, during therapeutic treatment and / or after therapeutic treatment. If a blood sample is obtained from at least one (control) subject, for example, from at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 400, 500 or 1000 (control) subjects, it is designated as a "reference blood sample". Preferably, the reference blood sample and the blood sample of the patient to be tested are from the same source, for example, both are whole blood samples or blood cell fractions. Further preferably, both are from the same species, for example, from humans. Also (alternatively or additionally) preferably, the reference blood sample of the (control) subject and the blood sample of the patient to be tested are measured identically, for example, both have the same volume. It is particularly preferred that the reference blood sample and the blood sample are from (control) subjects / patients of the same sex and similar age.

[0094] Whole blood samples can be collected by blood collection tubes. For example, they are collected in PAXgene Blood RNA tubes, Tempus Blood RNA tubes, EDTA tubes, sodium citrate tubes, heparin tubes or ACD tubes (citrate dextrose). Alternatively, whole blood samples can be collected in blood collection tubes containing cell-free nucleic acid stabilizing chemicals or cell crowding agents, such as glutaraldehyde, formaldehyde or the like (e.g., Streck cfRNA BCT tubes, Streck cfDNABCT tubes), etc., and cell crowding agents such as polyethylene glycol (PEG) (e.g., Norgen cfDNA / cfRNA storage tubes), etc.

[0095] As used herein, blood samples, particularly whole blood samples, can also be collected by means of blood spot technology, for example, using the Mitra Microsampling Device. This technology requires a smaller sample volume, which is usually 45 μL-60 μL or less for humans. For example, whole blood can be drawn from a patient by finger puncture with a needle or lancet. Therefore, the whole blood sample can have the form of a blood drop. The blood drop is then placed on an absorbent probe (e.g., a hydrophilic polymer material such as cellulose), which is capable of absorbing whole blood. Once the sampling is completed, the blood spot is dried in the air before being transferred or mailed to a laboratory for processing. Because the blood is dry, it is not considered dangerous. Therefore, no special precautions are required during handling or transportation. Once the analysis site is reached, the desired component (e.g., RNA molecule described herein) is extracted from the dried blood spot into the supernatant, which is then further analyzed. In this way, the level of RNA molecules is determined. This technology is suitable for monitoring patients with lung cancer at home (based on home care / home sampling) or for screening purposes.

[0096] In the methods described herein, the level of RNA molecules in the patient's blood sample is determined or the level of RNA molecules is determined. As used herein, the term "level" refers to the amount (e.g., measured in grams, moles, or ion counts) or concentration (e.g., absolute or relative concentrations, such as reads per million (RPM) or NGS counts) of RNA molecules. As used herein, the term "level" also includes scaled, normalized, or scaled and normalized amounts or values ​​(e.g., RPM). In particular, the level of RNA molecules is determined by sequencing (preferably next generation sequencing, such as ABI SOLID, Illumina GenomeAnalyzer, Roche 454GS FL, BGISEQ), nucleic acid hybridization (e.g., microarray or beads), nucleic acid amplification (e.g., PCR, RT-PCR, qRT-PCR, or high-throughput RT-PCR), polymerase extension, mass spectrometry, flow cytometry (e.g., LUMINEX), or any combination thereof. Specifically, the level of RNA molecules is the expression level of the RNA molecules.

[0097] Those skilled in the art will appreciate that in many embodiments described herein, the determined RNA molecule level is compared to an appropriate "reference level" of RNA molecules. Specifically, the level of RNA molecules is compared to the reference level of the RNA molecules. More specifically, the reference level of RNA molecules is determined in a (control) subject's blood sample. Even more specifically, the reference level is determined empirically by measuring a plurality of reference blood samples of subjects known to have lung cancer or by measuring a plurality of reference blood samples of subjects known not to have lung cancer. Typically, as will be appreciated by those skilled in the art, the reference level is determined under conditions comparable to those used to determine or analyze the RNA molecule levels in a patient's blood sample.

[0098] In the methods described herein, the level of at least one RNA molecule is compared to a reference level of the at least one RNA molecule. The reference level is a level determined by measuring a reference blood sample. For example, if the level of an RNA molecule having a nucleotide sequence according to SEQ ID NO: 1 is determined in a patient's blood sample, this level is compared to a reference level of an RNA molecule having a nucleotide sequence according to SEQ ID NO: 1 determined in a reference blood sample.

[0099] Alternatively, in the methods described herein, the levels of at least two RNA molecules are compared to reference levels of the at least two RNA molecules. The reference level is a level determined by measuring a reference blood sample. For example, if the level of an RNA molecule having a nucleotide sequence according to SEQ ID NO: 1 and the level of an RNA molecule having a nucleotide sequence according to SEQ ID NO: 2 in a patient's blood sample are determined, then the two levels are compared to their respective reference levels, that is, the level of the RNA molecule having a nucleotide sequence according to SEQ ID NO: 1 is compared to the reference level of the RNA molecule having a nucleotide sequence according to SEQ ID NO: 1 determined in the reference blood sample, and the level of the RNA molecule having a nucleotide sequence according to SEQ ID NO: 2 is compared to the reference level of the RNA molecule having a nucleotide sequence according to SEQ ID NO: 2 determined in the reference blood sample.

[0100] Reference level can also be cut-off or threshold level.Usually, cut-off or threshold level can be determined by experiment, experience or theory.As recognized by those of ordinary skill in the art, cut-off or threshold level can also be arbitrarily selected according to existing experiment and / or clinical condition.According to the function of test and benefit / risk balance (clinical results of false positive and false negative), cut-off or threshold level must be determined to obtain optimal sensitivity and specificity.Cut-off or threshold level can also be cut-off or threshold score, or can also be converted into cut-off or threshold score.

[0101] Usually, the best sensitivity and specificity (and the cut-off or threshold level / score therefrom) can be determined using the receiver operating characteristic (ROC) curve based on experimental data. For example, after determining the RNA molecule level in the reference group, the RNA molecule level measured in the test sample can be statistically processed using algorithmic analysis, and a classification standard with significance for sample classification is obtained thereby. The ROC curve is mainly used in clinical biomarker testing. The ROC curve is a comprehensive index of a continuous variable reflecting the true positive rate (sensitivity) and the false positive rate (1-specificity). It reveals the relationship between sensitivity and specificity using an image fusion method. A series of different cut-off or threshold levels / scores are set as continuous variables to calculate a series of sensitivity and specificity values. Then the curve is drawn with sensitivity as the ordinate and with specificity as the abscissa.

[0102] An important measurement is the area under the ROC curve value (AUC value). If this area is equal to 1.0, then the test is 100% accurate (100% accuracy) because the sensitivity and specificity are both 1.0, so there are no false positives and false negatives. An indistinguishable test has an AUC value of 0.5. AUC values ​​are usually between 0.5 and 1.0, but according to information theory, if the results are interpreted in reverse, AUC values ​​below 0.5 can also be just as good. Therefore, according to the present invention, AUC values ​​close to 1 (e.g., 0.95) and AUC values ​​close to 0 (e.g., 0.05) both represent equally good measurements for clinical trials. In other words, when AUC values ​​are greater than 0.5, as the AUC value approaches 1, the diagnostic results get better and better. Alternatively, when AUC values ​​are less than 0.5, as the AUC value approaches 0, the diagnostic results get better and better.

[0103] As used herein, the term "classifier" refers to a prediction model that allows a given sample to be classified into a predetermined category based on certain features of the sample to distinguish between samples or characterize the sample. For example, a classifier can predict whether a patient with an unknown diagnosis belongs to one of two given categories, i.e., a class of sick subjects or a class of healthy subjects, with relatively high sensitivity and specificity. The output can be given as a probability of belonging to any class between 0-1. Specifically, a classifier allows distinguishing between patients with lung cancer and patients who do not have lung cancer (i.e., are healthy with respect to lung cancer).

[0104] As used herein, the term "point-of-care testing (POCT)" refers to a medical diagnostic test performed at or near a point of care as a time and place of individual care. This is in contrast to the model that is historically completely or primarily confined to medical laboratories, which requires samples to be sent from the point of care and then wait for hours or days to obtain results, during which time care must continue without the desired information. Point-of-care testing is a simple medical test that can be performed at the bedside. The driving concept behind POCT is to deliver the test to the individual to be tested conveniently and in a timely manner. This increases the likelihood that individuals, doctors, and care teams will receive results faster, so that clinical management decisions can be made in a timely manner. POCT is usually accomplished by using transportable, portable, and handheld instruments and test kits. When there is no handheld device, a small bench analyzer or fixed together can also be used, with the purpose of collecting samples and obtaining results at or near the individual's location within a very short period of time, so that the treatment plan can be adjusted as needed before the individual leaves the hospital.

[0105] In the context of the present invention, the term "kit of parts (short: kit)" is understood as any combination of at least some of the components identified herein, which are combined into spatially coexisting functional units and may include additional components.

[0106] Embodiments of the present invention

[0107] The present invention will now be further described. In the following paragraphs, different aspects of the present invention are defined in more detail. Unless clearly indicated otherwise, each aspect so defined may be combined with any other aspect. Especially, unless clearly indicated otherwise, any feature indicated as preferred or advantageous may be combined with any other feature indicated as preferred or advantageous.

[0108] The inventors have identified new RNA molecules that are significantly dysregulated in lung cancer patients compared to healthy controls. It has been shown that the characteristics of these new RNA molecules have a high diagnostic relevance for lung cancer determination. Therefore, these new RNA molecules can be used as biomarkers for lung cancer diagnosis and biomarkers for lung cancer monitoring.

[0109] Thus, in a first aspect, the present invention relates to an (in vitro) method for diagnosing / detecting / determining lung cancer in a patient, said method comprising the following steps:

[0110] (i) determining the level of at least one RNA molecule in a blood sample from a patient, wherein the at least one RNA molecule comprises / has a nucleotide sequence according to SEQ ID NO: 1, or is a fragment thereof, or has a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto;

[0111] (ii) determining the levels of at least two RNA molecules in a blood sample from the patient, wherein the at least two RNA molecules include a first RNA molecule and a second RNA molecule,

[0112] wherein the first RNA molecule comprises / has the nucleotide sequence according to SEQ ID NO: 1, or a fragment thereof, or has a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto, and the second RNA molecule comprises / has the nucleotide sequence according to SEQ ID NO: 1, or a fragment thereof, or has a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto. NO:2, or a fragment thereof, or a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto; or

[0113] (iii) determining the levels of at least two RNA molecules in a blood sample from the patient, wherein the at least two RNA molecules include a first RNA molecule and a second RNA molecule,

[0114] wherein the first RNA molecule comprises the nucleotide sequence according to SEQ ID NO: 2, or a fragment thereof, or a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto, and the second RNA molecule comprises the nucleotide sequence according to SEQ ID NO: 2, or a fragment thereof, or a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto; IDNO: 3, or a fragment thereof, or a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g., at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto.

[0115] Preferably,

[0116] The first RNA molecule comprises the nucleotide sequence according to SEQ ID NO: 1, and the second RNA molecule comprises the nucleotide sequence according to SEQ ID NO: 2; or

[0117] The first RNA molecule comprises the nucleotide sequence according to SEQ ID NO:2 and the second RNA molecule comprises the nucleotide sequence according to SEQ ID NO:3.

[0118] In particular, the at least two RNA molecules are included in a group. In other words, the at least two RNA molecules represent a feature. The feature can include, for example, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46 , 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78 or 79 RNA molecules, specifically, 2, 5, 6, 10, 18, 38 or 54 RNA molecules (RNA molecule signatures).

[0119] In embodiment (i),

[0120] determining the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising / having a nucleotide sequence according to SEQ ID NO:2 to SEQ ID NO:71, an RNA molecule comprising / having a fragment thereof, and an RNA molecule comprising / having a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto; or

[0121] The level of at least one additional RNA molecule is determined, wherein the additional RNA molecule is selected from the group consisting of an RNA molecule comprising / having a nucleotide sequence according to SEQ ID NO:2 to SEQ ID NO:79, an RNA molecule comprising / having a fragment thereof, and an RNA molecule comprising / having a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto.

[0122] Thus, the level of the RNA molecule comprising the nucleotide sequence according to SEQ ID NO: 1, a fragment thereof or a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto and the level of at least one additional RNA molecule selected from the group consisting of the following RNA molecules: comprising the nucleotide sequence according to SEQ ID NO: 2 to SEQ ID NO: 3 NO:71, an RNA molecule comprising a fragment thereof, and an RNA molecule comprising a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g., at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto; or

[0123] The level of at least one additional RNA molecule selected from the group consisting of RNA molecules comprising nucleotide sequences according to SEQ ID NO:2 to SEQ ID NO:79, RNA molecules comprising fragments thereof, and RNA molecules comprising sequences having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g., at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto is determined in a blood sample from the patient.

[0124] Specifically, the levels of RNA molecules in the blood sample are determined, the RNA molecules comprising:

[0125] (i) a nucleotide sequence according to SEQ ID NO: 1 to SEQ ID NO: 71 or SEQ ID NO: 1 to SEQ ID NO: 79,

[0126] (ii) a nucleotide sequence that is a fragment of the nucleotide sequence according to (i), preferably a nucleotide sequence that is a fragment that is between 1 and 12, more preferably between 1 and 8, and most preferably between 1 and 5 or between 1 and 3 (e.g. 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12) nucleotides shorter than the nucleotide sequence according to (i); or

[0127] (iii) a nucleotide sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g., at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity with the nucleotide sequence according to (i) or the nucleotide sequence fragment according to (ii).

[0128] In embodiment (ii),

[0129] determining the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising / having a nucleotide sequence according to SEQ ID NO: 3 to SEQ ID NO: 71, an RNA molecule comprising / having a fragment thereof, and an RNA molecule comprising / having a sequence having at least 80% sequence identity thereto; or

[0130] Determine the level of at least one additional RNA molecule selected from the group consisting of: an RNA molecule comprising an RNA molecule having a nucleotide sequence according to SEQ ID NO: 3 to SEQ ID NO: 79, an RNA molecule comprising a fragment thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto.

[0131] Therefore, the levels of the following are determined in a blood sample from the patient:

[0132] The levels of said RNA molecules comprising the nucleotide sequence according to SEQ ID NO: 1, a fragment thereof or a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto, and ... NO:2, a fragment thereof, or a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g., at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto; and

[0133] the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 3 to SEQ ID NO: 71, an RNA molecule comprising fragments thereof, and an RNA molecule comprising a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto; or

[0134] The level of at least one additional RNA molecule selected from the group consisting of RNA molecules comprising nucleotide sequences according to SEQ ID NO:3 to SEQ ID NO:79, RNA molecules comprising fragments thereof, and RNA molecules comprising sequences having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g., at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto is determined in a blood sample from the patient.

[0135] Specifically, the levels of RNA molecules in the blood sample are determined, the RNA molecules comprising:

[0136] (i) a nucleotide sequence according to SEQ ID NO: 1 to SEQ ID NO: 71 or SEQ ID NO: 1 to SEQ ID NO: 79;

[0137] (ii) a nucleotide sequence that is a fragment of the nucleotide sequence according to (i), preferably a nucleotide sequence that is a fragment that is between 1 and 12, more preferably between 1 and 8, and most preferably between 1 and 5 or between 1 and 3 (e.g. 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12) nucleotides shorter than the nucleotide sequence according to (i); or

[0138] (iii) a nucleotide sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g., at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity with the nucleotide sequence according to (i) or the nucleotide sequence fragment according to (ii).

[0139] Preferably,

[0140] (i) determining the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 19, SEQ ID NO: 35, SEQ ID NO: 39, SEQ ID NO: 48, an RNA molecule comprising fragments thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto;

[0141] (ii) determining the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO:23, SEQ ID NO:39, SEQ ID NO:48, an RNA molecule comprising fragments thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto;

[0142] (iii) determining the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:9, an RNA molecule comprising fragments thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto;

[0143] (iv) determining the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:11, SEQ ID NO:18, RNA molecules including fragments thereof, and RNA molecules including a sequence having at least 80% sequence identity thereto;

[0144] (v) determining the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 19, SEQ ID NO: 35, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 43, SEQ ID NO: 48, SEQ ID NO: 49, RNA molecules including fragments thereof, and RNA molecules including a sequence having at least 80% sequence identity thereto;

[0145] (vi) determining the level of at least one additional RNA molecule selected from the group consisting of: an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 17, SEQ ID NO: 23, SEQ ID NO: 35, SEQ ID NO: 39, SEQ ID NO: 45, SEQ ID NO: 48, SEQ ID NO: 52, SEQ ID NO: 53, an RNA molecule comprising fragments thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto;

[0146] (vii) determining the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:19, SEQ ID NO:25, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:38, RNA molecules including fragments thereof and RNA molecules including a sequence having at least 80% sequence identity thereto;

[0147] (viii) determining the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO:3, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:18, SEQ ID NO:28, an RNA molecule comprising fragments thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto;

[0148] (ix) determining the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 3 to SEQ ID NO: 54, an RNA molecule comprising fragments thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto; or

[0149] (x) determining the level of at least one additional RNA molecule selected from the group consisting of the following RNA molecules: comprising determining the level of at least one additional RNA molecule selected from the group consisting of SEQ ID NO:3, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:26, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:31, SEQ ID NO:34, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, RNA molecules having the nucleotide sequence of SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:71, including RNA molecules of fragments thereof, and RNA molecules including sequences having at least 80% sequence identity therewith.

[0150] More preferably, the level of an RNA molecule is determined, said RNA molecule comprising a nucleotide sequence according to:

[0151] (i) SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:19, SEQ ID NO:35, SEQ ID NO:39, and SEQ ID NO:48,

[0152] (ii) SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:23, SEQ ID NO:39, and SEQ ID NO:48,

[0153] (iii) SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:6, SEQ ID NO:7, and SEQ ID NO:9,

[0154] (iv) SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:11, and SEQ ID NO:18,

[0155] (v) SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:19, SEQ ID NO:35, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:43, SEQ ID NO:48, and SEQ ID NO:49,

[0156] (vi) SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:17, SEQ ID NO:23, SEQ ID NO:35, SEQ ID NO:39, SEQ ID NO:45, SEQ ID NO:48, SEQ ID NO:52, and SEQ ID NO:53,

[0157] (vii) SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:19, SEQ ID NO:25, SEQ ID NO:29, SEQ ID NO:30, and SEQ ID NO:38,

[0158] (viii) SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:18 and SEQ ID NO:28,

[0159] (ix) SEQ ID NO: 1 to SEQ ID NO: 54, or

[0160] (x) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 21, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:26, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:31, SEQ ID NO:34, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70 and SEQ ID NO:71.

[0161] In embodiment (iii), the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising / having a nucleotide sequence according to SEQ ID NO: 1, SEQ ID NO: 4 to SEQ ID NO: 79, an RNA molecule comprising / having a fragment thereof, and an RNA molecule comprising / having a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto is determined.

[0162] Therefore, in a blood sample from a patient it is determined that:

[0163] levels of RNA molecules comprising the nucleotide sequence according to SEQ ID NO: 2, a fragment thereof or a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto; and

[0164] the levels of RNA molecules comprising the nucleotide sequence according to SEQ ID NO: 3, a fragment thereof or a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto;

[0165] and, the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising the nucleotide sequence according to SEQ ID NO: 1, SEQ ID NO: 4 to SEQ ID NO: 79, an RNA molecule comprising fragments thereof, and an RNA molecule comprising a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto.

[0166] Specifically, the levels of RNA molecules are determined in a blood sample, said RNA molecules comprising:

[0167] (i) the nucleotide sequence according to SEQ ID NO: 1 to SEQ ID NO: 79;

[0168] (ii) a nucleotide sequence that is a fragment of the nucleotide sequence according to (i), preferably a nucleotide sequence that is a fragment that is between 1 and 12 nucleotides, more preferably between 1 and 8 nucleotides, and most preferably between 1 and 5 or between 1 and 3 nucleotides (e.g. 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 nucleotides shorter than the nucleotide sequence according to (i); or

[0169] (iii) a nucleotide sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g., at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity with the nucleotide sequence according to (i) or the nucleotide sequence fragment according to (ii).

[0170] Preferably,

[0171] (i) determining the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO:7, SEQ ID NO:11, SEQ ID NO:14, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:21, SEQ ID NO:28, SEQ ID NO:56, SEQ ID NO:72 to SEQ ID NO:79, an RNA molecule comprising fragments thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto; or

[0172] (ii) determining the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO:7, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:75, an RNA molecule comprising a fragment thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto.

[0173] More preferably, the level of an RNA molecule is determined, said RNA molecule comprising a nucleotide sequence according to:

[0174] (i) SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:7, SEQ ID NO:11, SEQ ID NO:14, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:21, SEQ ID NO:28, SEQ ID NO:56, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, and SEQ ID NO:79; or

[0175] (ii) SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:7, SEQ ID NO:17, SEQ ID NO:18 and SEQ ID NO:75.

[0176] The above (6) signature is obtained in a blood sample sampled / collected using the Mitra microsampling device, said (6) signature comprising RNA molecules comprising nucleotide sequences according to SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 17, SEQ ID NO: 18 and SEQ ID NO: 75. The RNA molecules are isolated from the dried blood spots and subsequently used for molecular biological analysis, in particular for determining the levels of these RNA molecules.

[0177] In a preferred embodiment (i), the level of the at least one RNA molecule is compared to a reference. In particular, the level of the at least one RNA molecule is compared to a reference level of the RNA molecule.

[0178] The above comparison allows diagnosis of lung cancer in a patient, particularly in a patient suspected of having lung cancer. A patient can be diagnosed as having lung cancer (ie, diseased), or diagnosed as not having lung cancer (ie, healthy).

[0179] The reference (e.g., reference level) can be any reference (e.g., reference level) that allows determining whether a patient suffers from lung cancer. The reference level can be obtained from a (control) subject (i.e., a subject different from the patient to be tested, such as a healthy subject and / or a subject known to have lung cancer) or from the same patient. In the latter case, the patient can be retested for lung cancer, for example in the form of longitudinal monitoring. It can be determined that the patient is currently affected by lung cancer or is still not affected by lung cancer.

[0180] More particularly, the reference level is the level of at least one RNA molecule determined empirically by measuring a plurality of reference blood samples from:

[0181] From known healthy subjects (not suffering from lung cancer), and / or

[0182] From subjects known to have lung cancer.

[0183] For example,

[0184] The reference level is determined from at least 2, at least 10, at least 50, at least 100, at least 200, at least 300, at least 400, at least 500, at least 1000, at least 1500, at least 2000, at least 5000 reference samples from healthy subjects; and / or

[0185] The reference level is determined from at least 2, at least 10, at least 50, at least 100, at least 200, at least 300, at least 400, at least 500, at least 1000, at least 1500, at least 2000, at least 5000 reference samples from subjects known to have lung cancer.

[0186] Specifically, the reference level is an average reference level. It is determined by measuring the reference level of a control subject (e.g., a healthy subject or a subject with lung cancer / known to have lung cancer) and calculating its "average" value (e.g., mean, median, or mode). Preferably, the reference blood sample is from the same source (e.g., blood cells, serum, or plasma) as the blood sample separated from the patient to be tested. Further preferably, the reference level is obtained from a control subject of the same sex (e.g., female or male) and / or similar age / life stage (e.g., adult or elderly) as the patient to be tested. In particular, the reference level represents the average value of RNA molecules in a healthy population and / or the reference level represents the average value of RNA molecules in a subject population with lung cancer / known to have lung cancer.

[0187] Preferably, the reference level is the level of at least one RNA molecule determined empirically by measuring a plurality of reference blood samples from known healthy (not suffering from lung cancer) subjects, wherein

[0188] A level of an RNA molecule selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 15, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 49, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65 NO:69, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:77 and / or SEQ ID NO:78; and / or

[0189] A level of an RNA molecule selected from the group consisting of SEQ ID NO:4, SEQ ID NO:10, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:35, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:42, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:52, SEQ ID NO:61, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, NO:76 and / or SEQ ID NO:79.

[0190] Alternatively or additionally, the reference level is the level of at least one RNA molecule determined empirically by measuring a plurality of reference blood samples from subjects known to have lung cancer, wherein

[0191] A level of an RNA molecule selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 15, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 49, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65 NO:62, SEQ ID NO:69, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:77 and / or SEQ ID NO:78; and / or

[0192] A level of an RNA molecule selected from the group consisting of SEQ ID NO:4, SEQ ID NO:10, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:35, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:42, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:52, SEQ ID NO:61, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:74, SEQ ID NO:75 NO:75, SEQ ID NO:76 and / or SEQ ID NO:79.

[0193] Specifically, the level of the RNA molecule is at least 0.6 times or 0.7 times higher / lower than the reference level, more specifically at least 0.8 times or 0.9 times, even more specifically at least 1.2 times or 1.5 times, and more specifically at least 2.0 times or 3.0 times. For example, the level of the RNA molecule is at least 0.6 times, at least 0.7 times, at least 0.8 times, at least 0.9 times, at least 1.0 times, at least 1.1 times, at least 1.2 times, at least 1.3 times, at least 1.4 times, at least 1.5 times, at least 1.6 times, at least 1.7 times, at least 1.8 times, at least 1.9 times, at least 2.0 times, at least 2.1 times, at least 2.2 times, at least 2.3 times, at least 2.4 times, at least 2.5 times, at least 2.6 times, at least 2.7 times, at least 2.8 times, at least 2.9 times, or at least 3.0 times higher / lower than the reference level.

[0194] In a preferred embodiment (ii), the levels of at least two RNA molecules are compared to a reference. In particular, the levels of at least two RNA molecules are compared to a reference level of said RNA molecules.

[0195] The above comparison allows diagnosis of lung cancer in patients, particularly patients suspected of having lung cancer. Patients can be diagnosed as having lung cancer (ie, sick), or diagnosed as not having lung cancer (ie, healthy).

[0196] A reference (e.g., a reference level) can be a reference (e.g., a reference level) that allows a determination of whether a patient has lung cancer. The reference level can be obtained from a (control) subject (i.e., a subject different from the patient to be tested, such as a healthy subject and / or a subject known to have lung cancer) or from the same patient. In the latter case, the patient can be retested for lung cancer, for example in the form of longitudinal monitoring. It can be determined that the patient is currently affected by lung cancer or is still not affected by lung cancer.

[0197] More particularly, the reference level is the level of at least two RNA molecules determined empirically by measuring a plurality of reference blood samples from:

[0198] From known healthy subjects (not suffering from lung cancer), and / or

[0199] From subjects known to have lung cancer.

[0200] For example,

[0201] The reference level is determined from at least 2, at least 10, at least 50, at least 100, at least 200, at least 300, at least 400, at least 500, at least 1000, at least 1500, at least 2000, at least 5000 reference samples from healthy subjects; and / or

[0202] The reference level is determined from at least 2, at least 10, at least 50, at least 100, at least 200, at least 300, at least 400, at least 500, at least 1000, at least 1500, at least 2000, at least 5000 reference samples from subjects known to have lung cancer.

[0203] Specifically, reference level is an average reference level. They are determined by measuring the reference level of a control subject (e.g., a healthy subject or a subject with lung cancer / known to have lung cancer) and calculating its "average" value (e.g., mean, median, or mode). In particular, the reference level represents the mean value of RNA molecules in a healthy population and / or the reference level represents the mean value of RNA molecules in a subject population with lung cancer / known to have lung cancer. In this respect, it should be noted that for every RNA molecule, the level is determined and then compared with the respective reference level of the same RNA molecule.

[0204] Preferably, the reference level is the level of at least two RNA molecules determined empirically by measuring a plurality of reference blood samples from known healthy (not suffering from lung cancer) subjects, wherein

[0205] A level of an RNA molecule selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 15, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 49, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65 NO:69, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:77 and / or SEQ ID NO:78; and / or

[0206] A level of an RNA molecule selected from the group consisting of SEQ ID NO:4, SEQ ID NO:10, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:35, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:42, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:52, SEQ ID NO:61, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, NO:76 and / or SEQ ID NO:79.

[0207] Alternatively or additionally, the reference level is the level of at least two RNA molecules determined empirically by measuring a plurality of reference blood samples from subjects known to have lung cancer, wherein

[0208] A level of an RNA molecule selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 15, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 49, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65 NO:62, SEQ ID NO:69, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:77 and / or SEQ ID NO:78; and / or

[0209] A level of an RNA molecule selected from the group consisting of SEQ ID NO:4, SEQ ID NO:10, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:35, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:42, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:52, SEQ ID NO:61, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:74, SEQ ID NO:75 NO:75, SEQ ID NO:76 and / or SEQ ID NO:79.

[0210] Specifically, the level of the RNA molecule is at least 0.6 times or 0.7 times higher / lower than the reference level, more specifically at least 0.8 times or 0.9 times, even more specifically at least 1.2 times or 1.5 times, and more specifically at least 2.0 times or 3.0 times. For example, the level of the RNA molecule is at least 0.6 times, at least 0.7 times, at least 0.8 times, at least 0.9 times, at least 1.0 times, at least 1.1 times, at least 1.2 times, at least 1.3 times, at least 1.4 times, at least 1.5 times, at least 1.6 times, at least 1.7 times, at least 1.8 times, at least 1.9 times, at least 2.0 times, at least 2.1 times, at least 2.2 times, at least 2.3 times, at least 2.4 times, at least 2.5 times, at least 2.6 times, at least 2.7 times, at least 2.8 times, at least 2.9 times, or at least 3.0 times higher / lower than the reference level.

[0211] In a preferred embodiment (iii), the levels of at least two RNA molecules are compared to a reference. In particular, the levels of at least two RNA molecules are compared to a reference level of said RNA molecules.

[0212] The above comparison allows diagnosis of lung cancer in patients, particularly patients suspected of having lung cancer. Patients can be diagnosed as having lung cancer (ie, sick), or diagnosed as not having lung cancer (ie, healthy).

[0213] A reference (e.g., a reference level) can be a reference (e.g., a reference level) that allows a determination of whether a patient has lung cancer. The reference level can be obtained from a (control) subject (i.e., a subject different from the patient to be tested, such as a healthy subject and / or a subject known to have lung cancer) or from the same patient. In the latter case, the patient can be retested for lung cancer, for example in the form of longitudinal monitoring. It can be determined that the patient is currently affected by lung cancer or is still not affected by lung cancer.

[0214] More particularly, the reference level is the level of at least two RNA molecules determined empirically by measuring a plurality of reference blood samples from:

[0215] From known healthy subjects (not suffering from lung cancer), and / or

[0216] From subjects known to have lung cancer.

[0217] For example,

[0218] The reference level is determined from at least 2, at least 10, at least 50, at least 100, at least 200, at least 300, at least 400, at least 500, at least 1000, at least 1500, at least 2000, at least 5000 reference samples from healthy subjects; and / or

[0219] The reference level is determined from at least 2, at least 10, at least 50, at least 100, at least 200, at least 300, at least 400, at least 500, at least 1000, at least 1500, at least 2000, at least 5000 reference samples from subjects known to have lung cancer.

[0220] Specifically, reference level is an average reference level. They are determined by measuring the reference level of a control subject (e.g., a healthy subject or a subject with lung cancer / known to have lung cancer) and calculating its "average" value (e.g., mean, median, or mode). In particular, the reference level represents the mean value of RNA molecules in a healthy population and / or the reference level represents the mean value of RNA molecules in a subject population with lung cancer / known to have lung cancer. In this respect, it should be noted that for each RNA molecule, the level is determined and then compared with the respective reference level of the same RNA molecule.

[0221] Preferably, the reference level is the level of at least two RNA molecules determined empirically by measuring a plurality of reference blood samples from known healthy (not suffering from lung cancer) subjects, wherein

[0222] A level of an RNA molecule selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 15, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 49, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65 NO:69, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:77 and / or SEQ ID NO:78; and / or

[0223] A level of an RNA molecule selected from the group consisting of SEQ ID NO:4, SEQ ID NO:10, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:35, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:42, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:52, SEQ ID NO:61, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, NO:76 and / or SEQ ID NO:79.

[0224] Alternatively or additionally, the reference level is the level of at least two RNA molecules determined empirically by measuring a plurality of reference blood samples from subjects known to have lung cancer, wherein

[0225] A level of an RNA molecule selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 15, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 49, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65 NO:62, SEQ ID NO:69, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:77 and / or SEQ ID NO:78; and / or

[0226] A level of an RNA molecule selected from the group consisting of SEQ ID NO:4, SEQ ID NO:10, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:35, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:42, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:52, SEQ ID NO:61, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:74, SEQ ID NO:75 NO:75, SEQ ID NO:76 and / or SEQ ID NO:79.

[0227] Specifically, the level of the RNA molecule is at least 0.6 times or 0.7 times higher / lower than the reference level, more specifically at least 0.8 times or 0.9 times, even more specifically at least 1.2 times or 1.5 times, and more specifically at least 2.0 times or 3.0 times. For example, the level of the RNA molecule is at least 0.6 times, at least 0.7 times, at least 0.8 times, at least 0.9 times, at least 1.0 times, at least 1.1 times, at least 1.2 times, at least 1.3 times, at least 1.4 times, at least 1.5 times, at least 1.6 times, at least 1.7 times, at least 1.8 times, at least 1.9 times, at least 2.0 times, at least 2.1 times, at least 2.2 times, at least 2.3 times, at least 2.4 times, at least 2.5 times, at least 2.6 times, at least 2.7 times, at least 2.8 times, at least 2.9 times, or at least 3.0 times higher / lower than the reference level.

[0228] In alternative or additional embodiments (i), the level of at least one RNA molecule is used in a mathematical calculation to obtain a numerical value (z). In particular, the level of at least one RNA molecule is used in a mathematical calculation by multiplying each RNA molecule level by a corresponding factor (weight), adding all the resulting products, and adding a constant (bias) to obtain a numerical value (z). The result of this calculation (x) is used as an input to the Logistic function 1 / (1+exp(-x)) to obtain z. This mathematical calculation is called Logistic regression, in which weights and biases are optimized based on the data (RNA levels) to predict the outcome (cancer or health).

[0229] Preferably, the value (z) is compared to an (empirically determined) cut-off score (y) that allows the patient to be classified as a patient with lung cancer or a patient without lung cancer (healthy).

[0230] Regarding implementation method (i):

[0231] More preferably, the value (z) for SEQ ID NO: 1 is calculated as follows: z = f(1.00*x1 + -5.24), f(x) = 1 / (1 + exp(-x)))), wherein x1 is the normalized log2-RPM expression value of SEQ ID NO: 1, RPM stands for reads per million, the cutoff score (y) is 0.5, and

[0232] Wherein, a value (z)>0.5 indicates that the patient has lung cancer, or

[0233] A value (z) < 0.5 indicates that the patient is healthy (does not have lung cancer).

[0234] In alternative or additional embodiments (ii) and / or (iii), the levels of at least two RNA molecules are used in a mathematical calculation to obtain a numerical value (z). In particular, the levels of at least two RNA molecules are used in a mathematical calculation by multiplying each level by a corresponding factor (weight), adding all the resulting products, and adding a constant (bias) to obtain a numerical value (z). The result of this calculation (x) is used as an input to the Logistic function 1 / (1+exp(-x)) to obtain z. This mathematical calculation is called Logistic regression, in which the weights and biases are optimized based on the data (RNA levels) to predict the outcome (cancer or health).

[0235] Specifically, the value is obtained by adding the weighted levels of at least two RNA molecules, for example at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78 or 79 RNA molecules (e.g., 71 or 79 RNA molecules). In this regard, the method further comprises the step of determining a value by summing the weighted levels of at least two RNA molecules, such as at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38 , 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78 or 79 RNA molecules (e.g., 71 or 79 RNA molecules).

[0236] With respect to the at least two RNA molecules, it is meant

[0237] an RNA molecule having a nucleotide sequence according to SEQ ID NO: 1 and SEQ ID NO: 2 and optionally at least one RNA molecule having a nucleotide sequence according to SEQ ID NO: 3 to SEQ ID NO: 71; or

[0238] RNA molecules having a nucleotide sequence according to SEQ ID NO: 1 and SEQ ID NO: 2 and optionally at least one RNA molecule having a nucleotide sequence according to SEQ ID NO: 3 to SEQ ID NO: 79.

[0239] Alternatively, with respect to the at least two RNA molecules, it refers to RNA molecules having nucleotide sequences according to SEQ ID NO:2 and SEQ ID NO:3, and optionally at least one RNA molecule having a nucleotide sequence according to SEQ ID NO:1, SEQ ID NO:4 to SEQ ID NO:79.

[0240] The at least two RNA molecules may also be designed as RNA molecule features.

[0241] Preferably, the value is compared to an (empirically determined) cut-off score (y). The cut-off score (y) allows to classify the patient as a patient with lung cancer or a patient without lung cancer (healthy).

[0242] Regarding implementation method (ii):

[0243] More preferably, with respect to features: SEQ ID NO: 1 and SEQ ID NO: 2, the value (z) is calculated as follows:

[0244] z=f(0.95*x1+0.71*x2+-5.71), f(x)=1 / (1+exp(-x)))),,

[0245] where x1 and x2 are the normalized log2-RPM expression values ​​of SEQ ID NO: 1 and SEQ ID NO: 2, RPM stands for reads per million, the cutoff score (y) is 0.5, and

[0246] Wherein, a value (z)>0.5 indicates that the patient has lung cancer, or

[0247] A value (z) < 0.5 indicates that the patient is healthy (does not have lung cancer).

[0248] Even more preferably, with respect to features: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 19, SEQ ID NO: 35, SEQ ID NO: 39 and SEQ ID NO: 48, the value (z) is calculated as follows:

[0249] z=f(0.94*x1+0.86*x2+-0.07*x19+-0.33*x35+-0.15*x39+-0.33*x48+-3.86), f(x)=1 / (1+exp(-x)))),

[0250] wherein x1, x2, x19, x35, x39, and x48 are the normalized log2-RPM expression values ​​of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 19, SEQ ID NO: 35, SEQ ID NO: 39, and SEQ ID NO: 48, respectively, RPM stands for reads per million, with a cutoff score (y) of 0.5, and

[0251] Wherein, a value (z)>0.5 indicates that the patient has lung cancer, or

[0252] A value (z) < 0.5 indicates that the patient is healthy (does not have lung cancer).

[0253] Alternatively, for features: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 23, SEQ ID NO: 39 and SEQ ID NO: 48, the value (z) is calculated as follows:

[0254] y=f(0.44*x1+0.83*x2+0.45*x23+-0.07*x39+-0.25*x48+-4.34), f(x)=1 / (1+exp(-x)))),

[0255] wherein x1, x2, x23, x39, and x48 are the normalized log2-RPM expression values ​​of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 23, SEQ ID NO: 39, and SEQ ID NO: 48, respectively, RPM stands for reads per million, with a cutoff score (y) of 0.5, and

[0256] Wherein, a value (z)>0.5 indicates that the patient has lung cancer, or

[0257] A value (z) < 0.5 indicates that the patient is healthy (does not have lung cancer).

[0258] Alternatively, for features: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 7 and SEQ ID NO: 9, the value (z) is calculated as follows:

[0259] z=f(0.84*x1+0.60*x2+0.85*x6+0.23*x7+0.30*x9+-6.44), f(x)=1 / (1+exp(-x)))),

[0260] wherein x1, x2, x6, x7, and x9 are the normalized log2-RPM expression values ​​of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 7, and SEQ ID NO: 9, respectively, RPM stands for reads per million, the cutoff score (y) is 0.5, and

[0261] Wherein, a value (z)>0.5 indicates that the patient has lung cancer, or

[0262] A value (z) < 0.5 indicates that the patient is healthy (does not have lung cancer).

[0263] Alternatively, for features: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 7, and SEQ ID NO: 11, and SEQ ID NO: 18, the value (z) is calculated as follows:

[0264] y=f(0.19*x1+0.62*x2+0.87*x6+0.32*x7+0.40*x11+0.65*x18+-6.12), f(x)=1 / (1+exp(-x)))),

[0265] wherein x1, x2, x6, x7, x11, and x18 are the normalized log2-RPM expression values ​​of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 11, and SEQ ID NO: 18, respectively, RPM stands for reads per million, with a cutoff score (y) of 0.5, and

[0266] Wherein, a value (z)>0.5 indicates that the patient has lung cancer, or

[0267] A value (z) < 0.5 indicates that the patient is healthy (does not have lung cancer).

[0268] Still even more preferably, with respect to features: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 19, SEQ ID NO: 35, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 43, SEQ ID NO: 48 and SEQ ID NO: 49, the value (z) is calculated as follows:

[0269] z=f(0.93*x1+0.83*x2+-0.09*x19+-0.33*x35+-0.11*x38+-0.13*x39+-0. 12*x40+0.17*x43+-0.29*x48+0.10*x49+-4.41), f(x)=1 / (1+exp(-x)))),

[0270] wherein x1, x2, x19, x35, x38, x39, x40, x43, x48 and x49 are the normalized log2-RPM expression values ​​of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 19, SEQ ID NO: 35, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 43, SEQ ID NO: 48 and SEQ ID NO: 49, respectively, RPM stands for reads per million, the cutoff score (y) is 0.5, and

[0271] Wherein, a value (z)>0.5 indicates that the patient has lung cancer, or

[0272] A value (z) < 0.5 indicates that the patient is healthy (does not have lung cancer).

[0273] Alternatively, for features: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 17, SEQ ID NO: 23, SEQ ID NO: 35, SEQ ID NO: 39, SEQ ID NO: 45, SEQ ID NO: 48, SEQ ID NO: 52 and SEQ ID NO: 53, the value (z) is calculated as follows:

[0274] z=f(0.52*x1+0.93*x2+-0.22*x17+0.43*x23+-0.22*x35+-0.08*x39+-0.0 6*x45+-0.22*x48+-0.32*x52+0.02*x53+-1.32), f(x)=1 / (1+exp(-x)))),

[0275] wherein x1, x2, x17, x23, x35, x39, x45, x48, x52, and x53 are the normalized log2-RPM expression values ​​of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 17, SEQ ID NO: 23, SEQ ID NO: 35, SEQ ID NO: 39, SEQ ID NO: 45, SEQ ID NO: 48, SEQ ID NO: 52, and SEQ ID NO: 53, respectively, RPM stands for reads per million, with a cutoff score (y) of 0.5, and

[0276] Wherein, a value (z)>0.5 indicates that the patient has lung cancer, or

[0277] A value (z) < 0.5 indicates that the patient is healthy (does not have lung cancer).

[0278] Alternatively, for features: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 19, SEQ ID NO: 25, SEQ ID NO: 29, SEQ ID NO: 30 and SEQ ID NO: 38, the value (z) is calculated as follows:

[0279] z=f(0.83*x1+0.77*x2+0.69*x6+0.31*x7+0.34*x9+-0.03*x19+-0.58* x25+-0.33*x29+-0.28*x30+-0.19*x38+3.17), f(x)=1 / (1+exp(-x)))),

[0280] wherein x1, x2, x6, x7, x9, x19, x25, x29, x30 and x38 are the normalized log2-RPM expression values ​​of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 19, SEQ ID NO: 25, SEQ ID NO: 29, SEQ ID NO: 30 and SEQ ID NO: 38, respectively, RPM stands for reads per million, the cutoff score (y) is 0.5, and

[0281] Wherein, a value (z)>0.5 indicates that the patient has lung cancer, or

[0282] A value (z) < 0.5 indicates that the patient is healthy (does not have lung cancer).

[0283] Alternatively, for features: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 18 and SEQ ID NO: 28, the value (z) is calculated as follows:

[0284] z=f(0.24*x1+0.74*x2+0.19*x3+0.68*x6+0.36*x7+0.26*x11+0.26*x12+-0.42*x14+0.66*x18+-0.94*x28+4.76), f(x)=1 / (1+exp(-x)))),

[0285] wherein x1, x2, x3, x6, x7, x11, x12, x14, x18 and x28 are the normalized log2-RPM expression values ​​of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 18 and SEQ ID NO: 28, respectively, RPM stands for reads per million, the cutoff score (y) is 0.5, and

[0286] Wherein, a value (z)>0.5 indicates that the patient has lung cancer, or

[0287] A value (z) < 0.5 indicates that the patient is healthy (does not have lung cancer).

[0288] Most preferably, with respect to (54) feature: SEQ ID NO: 1 to SEQ ID NO: 54, the value (z) is calculated as follows:

[0289] z=f(0.45*x1+0.83*x2+0.74*x3+0.50*x4+-0.48*x5+0.74*x6+0.48*x7+0.55* x8+0.64*x9+-0.72*x10+0.39*x11+0.25*x12+0.35*x13+-0.34*x14+-0.43*x15 +-0.40*x16+-0.34*x17+0.14*x18+-0.32*x19+-0.52*x20+-0.28*x21+-0.32* x22+-0.28*x23+0.20*x24+-0.33*x25+-0.24*x26+0.26*x27+0.44*x28+-0.11* x29+-0.12*x30+-0.10*x31+0.25*x32+-0.26*x33+0.16*x34+-0.15*x35+-0.2 4*x36+0.10*x37+-0.11*x38+-0.08*x39+0.08*x40+0.05*x41+-0.10*x42+0.06 *x43+0.06*x44+0.12*x45+-0.06*x46+0.10*x47+-0.02*x48+0.01*x49+-0.04* x50+0.02*x51+0.01*x52+0.04*x53+0.05*x54+0.21), f(x)=1 / (1+exp(-x)))),

[0290] wherein x1 to x54 are each the normalized log2-RPM expression values ​​of SEQ ID NO: 1 to SEQ ID NO: 54, RPM stands for reads per million, the cutoff score (y) is 0.5, and

[0291] Wherein, a value (z)>0.5 indicates that the patient has lung cancer, or

[0292] A value (z) < 0.5 indicates that the patient is healthy (does not have lung cancer).

[0293] Alternatively, with respect to feature (38): SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 34, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 70 and SEQ ID NO: 71, the value (z) is calculated as follows:

[0294] z = f(0.05*x1 + 0.83*x2 + 0.27*x3 + 0.89*x6 + 0.35*x7 + 0.29*x8 + -0.56*x10 + 0.14*x11 + 0.13*x12 + -0.16*x14 + -0.21*x16 + -0.29*x17 + 0.37*x18 + -0.21*x21 + -0.26*x22 + -0.15*x24 + -0.26*x26 + -0.74*x28 + -0.17*x29 + -0.17*x31 + 0.17*x34 + 0.16*x55 + 0.18*x56 + 0.19*x57 + 0.08*x58 + 0.27*x59 + 0.39*x60 + 0.50*x61 + 0.24*x62 + -0.10*x63 + -0.19*x64 + -0.12*x65 + -0.54*x66 + -0.07*x67 + -0.20*x68 + -0.25*x69 + 0.81*x70 + -0.19*x71 + 0.33), where f(x) = 1 / (1 + exp(-x))),

[0295] Among them, x1, x2, x3, x6, x7, x8, x10, x11, x12, x14, x16, x17, x18, x21, x22, x24, x26, x28, x29, x31, x34, x55 to x71 are respectively SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 34, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70 and SEQ ID NO:71, where RPM stands for reads per million, and the cutoff score (y) is 0.5, and

[0296] Wherein, a value (z)>0.5 indicates that the patient has lung cancer, or

[0297] A value (z) < 0.5 indicates that the patient is healthy (does not have lung cancer).

[0298] Regarding implementation method (iii),

[0299] More preferably, with respect to (2) feature: SEQ ID NO: 2 and SEQ ID NO: 3, the value (z) is calculated as follows:

[0300] z=f(0.800*x2+1.342*x3+-8.733), f(x)=1 / (1+exp(-x)))),

[0301] Wherein, x2 and x3 are the log2-RPM expression values ​​of SEQ ID NO: 2 and SEQ ID NO: 3, respectively, RPM stands for reads per million, and the cutoff score (y) is 0.5, and

[0302] Wherein, a value (z)>0.5 indicates that the patient has lung cancer, or

[0303] A value (z) < 0.5 indicates that the patient is healthy (does not have lung cancer).

[0304] Even more preferably, with respect to (18) features: SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 11, SEQ ID NO: 14, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 21, SEQ ID NO: 28, SEQ ID NO: 56, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 77, SEQ ID NO: 78 and SEQ ID NO: 79, the value (z) is calculated as follows:

[0305] z=f(0.792*x2+0.54*x3+0.521*x7+0.26*x11+-0.284*x14+-0.306*x17+0.399*x18+-0.429*x21+-0.693*x28+0.295* x56+0.452*x72+0.38*x73+-0.3*x74+-0.297*x75+-0.219*x76+0.157*x77+0.0658*x78+-0.0421*x79+5.203), f(x)=1 / (1exp(-x)))),

[0306] wherein x2, x3, x7, x11, x14, x17, x18, x21, x28, x56, x72, x73, x74, x75, x76, x77, x78, x79 are the log2-RPM expression values ​​of SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 11, SEQ ID NO: 14, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 21, SEQ ID NO: 28, SEQ ID NO: 56, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 79, respectively, RPM stands for reads per million, the cutoff score (y) is 0.5, and

[0307] Wherein, a value (z)>0.5 indicates that the patient has lung cancer, or

[0308] A value (z) < 0.5 indicates that the patient is healthy (does not have lung cancer).

[0309] Even more preferably, with respect to (6) feature (Mitra sample): SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 17, SEQ ID NO: 18 and SEQ ID NO: 75, the value (z) is calculated as follows:

[0310] z=f(19.621*x2+0.638*x3+1.171*x7+-0.492*x17+-2.400*x18+1.049*x75+3.185), f(x)=1 / (1+exp(-x)))),

[0311] wherein x2, x3, x7, x17, x18, x75 are the log2-RPM expression values ​​of SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 75, respectively, RPM stands for reads per million, the cutoff score (y) is 0.5, and

[0312] Wherein, a value (z)>0.5 indicates that the patient has lung cancer, or

[0313] A value (z) < 0.5 indicates that the patient is healthy (does not have lung cancer).

[0314] In a second aspect, the invention relates to an (in vitro) method for monitoring a patient suspected of having lung cancer or a patient suffering from lung cancer, the method comprising the following steps:

[0315] (i) determining the level of at least one RNA molecule in a blood sample from a patient, wherein the at least one RNA molecule comprises / has a nucleotide sequence according to SEQ ID NO: 1, or is a fragment thereof, or has a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto;

[0316] (ii) determining the levels of at least two RNA molecules in a blood sample from the patient, wherein the at least two RNA molecules include a first RNA molecule and a second RNA molecule,

[0317] wherein the first RNA molecule comprises / has the nucleotide sequence according to SEQ ID NO: 1, or a fragment thereof, or has a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto, and the second RNA molecule comprises / has the nucleotide sequence according to SEQ ID NO: 1, or a fragment thereof, or has a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto, NO:2, or a fragment thereof, or a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto; or

[0318] (iii) determining the levels of at least two RNA molecules in a blood sample from the patient, wherein the at least two RNA molecules include a first RNA molecule and a second RNA molecule,

[0319] wherein the first RNA molecule comprises / has the nucleotide sequence according to SEQ ID NO: 2, or a fragment thereof, or has a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto, and the second RNA molecule comprises / has the nucleotide sequence according to SEQ ID NO: 2, or a fragment thereof, or has a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto, NO:3, or a fragment thereof, or a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g., at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto.

[0320] Preferably,

[0321] The first RNA molecule comprises a nucleotide sequence according to SEQ ID NO: 1, and the second RNA molecule comprises a nucleotide sequence according to SEQ ID NO: 2, or

[0322] The first RNA molecule comprises a nucleotide sequence according to SEQ ID NO:2, and the second RNA molecule comprises a nucleotide sequence according to SEQ ID NO:3.

[0323] In particular, the at least two RNA molecules are included in a group. In other words, the at least two RNA molecules represent a feature. The feature may include, for example, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46 , 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78 or 79 RNA molecules, specifically, 2, 5, 6, 10, 18, 38 or 54 RNA molecules (RNA molecule signatures).

[0324] In embodiment (i),

[0325] determining the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising / having a nucleotide sequence according to SEQ ID NO: 2 to SEQ ID NO: 71, an RNA molecule comprising / having a fragment thereof, and an RNA molecule comprising / having a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto; or

[0326] The level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising / having a nucleotide sequence according to SEQ ID NO: 2 to SEQ ID NO: 79, an RNA molecule comprising / having a fragment thereof, and an RNA molecule comprising / having a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto is determined.

[0327] Therefore, in a blood sample from a patient it is determined that:

[0328] The level of an RNA molecule comprising the nucleotide sequence according to SEQ ID NO: 1, a fragment thereof or a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto, and

[0329] the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 2 to SEQ ID NO: 71, an RNA molecule comprising fragments thereof, and an RNA molecule comprising a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto; or

[0330] The level of at least one additional RNA molecule selected from the group consisting of RNA molecules comprising nucleotide sequences according to SEQ ID NO:2 to SEQ ID NO:79, RNA molecules comprising fragments thereof, and RNA molecules comprising sequences having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g., at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto is determined in a blood sample from the patient.

[0331] Specifically, the levels of RNA molecules in a blood sample are determined, the RNA molecules comprising:

[0332] (i) a nucleotide sequence according to SEQ ID NO: 1 to SEQ ID NO: 71 or SEQ ID NO: 1 to SEQ ID NO: 79;

[0333] (ii) a nucleotide sequence that is a fragment of the nucleotide sequence according to (i), preferably a nucleotide sequence that is a fragment that is between 1 and 12, more preferably between 1 and 8, and most preferably between 1 and 5 or between 1 and 3 (e.g. 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12) nucleotides shorter than the nucleotide sequence according to (i); or

[0334] (iii) a nucleotide sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g., at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity with the nucleotide sequence according to (i) or the nucleotide sequence fragment according to (ii).

[0335] In embodiment (ii),

[0336] determining the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising / having a nucleotide sequence according to SEQ ID NO: 3 to SEQ ID NO: 71, an RNA molecule comprising / having a fragment thereof, and an RNA molecule comprising / having a sequence having at least 80% sequence identity thereto; or

[0337] Determine the level of at least one additional RNA molecule selected from the group consisting of: an RNA molecule comprising / having a nucleotide sequence according to SEQ ID NO: 3 to SEQ ID NO: 79, an RNA molecule comprising / having a fragment thereof, and an RNA molecule comprising / having a sequence having at least 80% sequence identity thereto.

[0338] Thus, the levels of RNA molecules comprising the nucleotide sequence according to SEQ ID NO: 1, a fragment thereof or a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto, as well as comprising the nucleotide sequence according to SEQ ID NO: 1, a fragment thereof or a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto are determined in a blood sample from a patient. NO:2, a fragment thereof, or an RNA molecule having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto, and

[0339] the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 3 to SEQ ID NO: 71, an RNA molecule comprising fragments thereof, and an RNA molecule comprising a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto; or

[0340] The level of at least one additional RNA molecule selected from the group consisting of RNA molecules comprising nucleotide sequences according to SEQ ID NO:3 to SEQ ID NO:79, RNA molecules comprising fragments thereof, and RNA molecules comprising sequences having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g., at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto is determined in a blood sample from the patient.

[0341] Specifically, the levels of RNA molecules in a blood sample are determined, the RNA molecules comprising:

[0342] (i) a nucleotide sequence according to SEQ ID NO: 1 to SEQ ID NO: 71 or SEQ ID NO: 1 to SEQ ID NO: 79,

[0343] (ii) a nucleotide sequence that is a fragment of the nucleotide sequence according to (i), preferably a nucleotide sequence that is a fragment that is between 1 and 12 nucleotides, more preferably between 1 and 8 nucleotides, and most preferably between 1 and 5 or between 1 and 3 nucleotides (e.g. 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 nucleotides shorter than the nucleotide sequence according to (i), or

[0344] (iii) a nucleotide sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g., at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity with the nucleotide sequence according to (i) or the nucleotide sequence fragment according to (ii).

[0345] Preferably,

[0346] (i) determining the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 19, SEQ ID NO: 35, SEQ ID NO: 39, SEQ ID NO: 48, an RNA molecule comprising a fragment thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto;

[0347] (ii) determining the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO:23, SEQ ID NO:39, SEQ ID NO:48, an RNA molecule comprising a fragment thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto;

[0348] (iii) determining the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:9, an RNA molecule comprising a fragment thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto;

[0349] (iv) determining the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:11, SEQ ID NO:18, an RNA molecule comprising a fragment thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto;

[0350] (v) determining the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 19, SEQ ID NO: 35, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 43, SEQ ID NO: 48, SEQ ID NO: 49, an RNA molecule comprising a fragment thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto;

[0351] (vi) determining the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 17, SEQ ID NO: 23, SEQ ID NO: 35, SEQ ID NO: 39, SEQ ID NO: 45, SEQ ID NO: 48, SEQ ID NO: 52, SEQ ID NO: 53, an RNA molecule comprising a fragment thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto;

[0352] (vii) determining the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:19, SEQ ID NO:25, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:38, an RNA molecule comprising a fragment thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto;

[0353] (viii) determining the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO:3, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:18, SEQ ID NO:28, an RNA molecule comprising a fragment thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto;

[0354] (ix) determining the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 3 to SEQ ID NO: 54, an RNA molecule comprising a fragment thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto; or

[0355] (x) determining the level of at least one additional RNA molecule selected from the group consisting of the following RNA molecules: comprising determining the level of at least one additional RNA molecule selected from the group consisting of SEQ ID NO:3, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:26, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:31, SEQ ID NO:34, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, RNA molecules having the nucleotide sequence of SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:71, including RNA molecules of fragments thereof, and RNA molecules including sequences having at least 80% sequence identity therewith.

[0356] More preferably, the level of an RNA molecule comprising a nucleotide sequence according to:

[0357] (i) SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:19, SEQ ID NO:35, SEQ ID NO:39 and SEQ ID NO:48,

[0358] (ii) SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:23, SEQ ID NO:39 and SEQ ID NO:48,

[0359] (iii) SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:6, SEQ ID NO:7 and SEQ ID NO:9,

[0360] (iv) SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:11 and SEQ ID NO:18,

[0361] (v) SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:19, SEQ ID NO:35, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:43, SEQ ID NO:48, and SEQ ID NO:49,

[0362] (vi) SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:17, SEQ ID NO:23, SEQ ID NO:35, SEQ ID NO:39, SEQ ID NO:45, SEQ ID NO:48, SEQ ID NO:52, and SEQ ID NO:53,

[0363] (vii) SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:19, SEQ ID NO:25, SEQ ID NO:29, SEQ ID NO:30, and SEQ ID NO:38,

[0364] (viii) SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:18, and SEQ ID NO:28,

[0365] (ix) SEQ ID NO:1 to SEQ ID NO:54, or

[0366] (x) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 21, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:26, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:31, SEQ ID NO:34, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70 and SEQ ID NO:71.

[0367] In embodiment (iii), the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule according to the nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 4 to SEQ ID NO: 79, an RNA molecule comprising / having a fragment thereof, and an RNA molecule comprising / having a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto is determined.

[0368] Thus, the level of RNA molecules comprising the nucleotide sequence according to SEQ ID NO: 2, a fragment thereof or a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto, as well as comprising the nucleotide sequence according to SEQ ID NO: 2, a fragment thereof or a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto, are determined in a blood sample from a patient. NO:3, a fragment thereof or a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto, and the level of at least one additional RNA molecule selected from the group consisting of the following RNA molecules: comprising the nucleotide sequence according to SEQ ID NO:1, SEQ ID NO:4 to SEQ ID NO:5 NO:79, RNA molecules comprising fragments thereof, and RNA molecules comprising sequences having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g., at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto.

[0369] Specifically, the level of an RNA molecule comprising the following nucleotide sequence in a blood sample is determined:

[0370] (i) a nucleotide sequence according to SEQ ID NO: 1 to SEQ ID NO: 79,

[0371] (ii) a nucleotide sequence that is a fragment of the nucleotide sequence according to (i), preferably a nucleotide sequence that is a fragment that is between 1 and 12 nucleotides, more preferably between 1 and 8 nucleotides, and most preferably between 1 and 5 or between 1 and 3 nucleotides (e.g. 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 nucleotides shorter than the nucleotide sequence according to (i), or

[0372] (iii) a nucleotide sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g., at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity with the nucleotide sequence according to (i) or the nucleotide sequence fragment according to (ii).

[0373] Preferably,

[0374] (i) determining the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO:7, SEQ ID NO:11, SEQ ID NO:14, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:21, SEQ ID NO:28, SEQ ID NO:56, SEQ ID NO:72 to SEQ ID NO:79, an RNA molecule comprising fragments thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto; or

[0375] (ii) determining the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO:7, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:75, an RNA molecule comprising a fragment thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto.

[0376] More preferably, determining the level of said RNA molecule comprises a nucleotide sequence according to:

[0377] (i) SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:7, SEQ ID NO:11, SEQ ID NO:14, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:21, SEQ ID NO:28, SEQ ID NO:56, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, and SEQ ID NO:79; or

[0378] (ii) SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:7, SEQ ID NO:17, SEQ ID NO:18 and SEQ ID NO:75.

[0379] In a preferred embodiment (i), the level of the at least one RNA molecule is compared to a reference. In particular, the level of the at least one RNA molecule is compared to a reference level of the RNA molecule.

[0380] The above comparison allows monitoring / determining the course of lung cancer in a patient suffering from lung cancer. It can determine that the lung cancer in the patient is getting worse, the lung cancer in the patient is not getting worse / is stable, or the lung cancer in the patient is improving. The above comparison also allows monitoring / determining whether the lung cancer in the patient is progressing.

[0381] A reference (e.g., a reference level) can be any reference (e.g., a reference level) that allows monitoring or detection of lung cancer in a patient. It can be obtained from a (control) subject (i.e., a subject different from the patient to be tested, e.g., a subject with lung cancer / known to have lung cancer or a healthy subject).

[0382] More particularly, the reference level is the level of said at least one RNA molecule determined empirically by measuring a plurality of reference blood samples from:

[0383] From known healthy subjects (not suffering from lung cancer), and / or

[0384] From subjects known to have lung cancer.

[0385] For example,

[0386] The reference level is determined from at least 2, at least 10, at least 50, at least 100, at least 200, at least 300, at least 400, at least 500, at least 1000, at least 1500, at least 2000, at least 5000 reference samples from healthy subjects; and / or

[0387] The reference level is determined from at least 2, at least 10, at least 50, at least 100, at least 200, at least 300, at least 400, at least 500, at least 1000, at least 1500, at least 2000, at least 5000 reference samples from subjects known to have lung cancer.

[0388] Specifically, the reference level is an average reference level. It is determined by measuring the reference level of a control subject (e.g., a healthy subject or a subject with lung cancer / known to have lung cancer) and calculating its "average" value (e.g., mean, median, or mode). Preferably, the reference blood sample is from the same source (e.g., blood cells, serum, or plasma) as the blood sample of the patient to be tested, which is separated. Further preferably, the reference level is obtained from a control subject (e.g., a healthy subject or a subject with lung cancer / known to have lung cancer) of the same gender (e.g., female or male) and / or similar age / life stage (e.g., adult or elderly) as the patient to be tested. In particular, the reference level represents the mean value of RNA molecules in a healthy population and / or the reference level represents the mean value of RNA molecules in a subject population with lung cancer / known to have lung cancer.

[0389] In preferred embodiments (ii) and / or (iii), the levels of the at least two RNA molecules are compared with a reference. In particular, the levels of the at least two RNA molecules are compared with a reference level of the RNA molecules.

[0390] The above comparison allows diagnosis of lung cancer in patients, particularly patients suspected of having lung cancer. Patients can be diagnosed as having lung cancer (ie, sick), or diagnosed as not having lung cancer (ie, healthy).

[0391] A reference (e.g., a reference level) can be a reference (e.g., a reference level) that allows a determination to be made whether a patient has lung cancer. The reference level can be obtained from a (control) subject (i.e., a subject different from the patient to be tested, such as a healthy subject and / or a subject known to have lung cancer) or from the same patient. In the latter case, the patient can be retested for lung cancer, for example in the form of longitudinal monitoring. It can be determined that the patient is currently affected by lung cancer or is still not affected by lung cancer.

[0392] More particularly, the reference level is the level of said at least two RNA molecules determined empirically by measuring a plurality of reference blood samples from:

[0393] From known healthy subjects (not suffering from lung cancer), and / or

[0394] From subjects known to have lung cancer.

[0395] For example,

[0396] The reference level is determined from at least 2, at least 10, at least 50, at least 100, at least 200, at least 300, at least 400, at least 500, at least 1000, at least 1500, at least 2000, at least 5000 reference samples from healthy subjects; and / or

[0397] The reference level is determined from at least 2, at least 10, at least 50, at least 100, at least 200, at least 300, at least 400, at least 500, at least 1000, at least 1500, at least 2000, at least 5000 reference samples from subjects known to have lung cancer.

[0398] Specifically, the reference level is an average reference level. It is determined by measuring the reference level of a control subject (e.g., a healthy subject or a subject with lung cancer / known to have lung cancer) and calculating its "average" value (e.g., mean, median, or mode). In particular, the reference level represents the mean value of RNA molecules in a healthy population and / or the reference level represents the mean value of RNA molecules in a subject population with lung cancer / known to have lung cancer. In this respect, it should be noted that for each RNA molecule, the level is determined and then compared with the respective reference level of the same RNA molecule.

[0399] Concerning the diagnosis / detection / determination of lung cancer in patients and respective reference levels ((control) subjects known not to have lung cancer (ie healthy) and / or (control) subjects known to have lung cancer), the first aspect of the present invention is concerned.

[0400] As already mentioned above, the reference level may be any level that allows monitoring or detection of lung cancer in a patient. It may be obtained from a (control) subject (i.e. a subject different from the patient to be tested, such as a subject known to have lung cancer or a healthy subject). It may also be obtained from the same individual. Alternatively, the reference level may be a level that allows monitoring or detection of lung cancer in a patient. They may be obtained from a (control) subject (i.e. a subject different from the patient to be tested, such as a subject known to have lung cancer or a healthy subject). They may also be obtained from the same individual.

[0401] Thus, in an alternative or additional embodiment (i), the monitoring comprises determining the level of the at least one RNA molecule in a blood sample obtained from the patient at a first time point and in at least one additional blood sample obtained from the (same) patient at a later time point, and comparing the levels determined at different time points.

[0402] This process allows for monitoring lung cancer in patients (healthy or suffering from lung cancer) over long periods of time, such as multiple months or years, for example 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months or 11 months, 1 year, 2 years, 3 years, 4 years or 5 years.

[0403] The time period between the first time point and the later time point is preferably at least 1 day, at least 2 days, at least 3 days, at least 4 days, at least 5 days, at least 6 days, at least 7 days (1 week), at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 1 month, at least 2 months, at least 3 months, at least 4 months, at least 5 months, at least 6 months, at least 7 months, at least 8 months, at least 9 months, at least 10 months, at least 11 months, at least 12 months (1 year), at least 24 months (2 years), at least 3 years, at least 4 years, at least 5 years, at least 6 years, at least 7 years, at least 8 years, at least 9 years or at least 10 years. For example, individuals can be routinely checked, for example, once or twice a year. Patients can be (re)tested at 2, 3, 4, 5, 6, 7, 8, 9 or 10 time points (first time point and additional time).

[0404] In alternative or additional embodiments (ii) and / or (iii), the monitoring comprises determining the levels of the at least two RNA molecules in a blood sample obtained from the patient at a first time point and in at least one additional blood sample obtained from the (same) patient at a later time point, and comparing the levels determined at different time points.

[0405] In this regard, it should be noted that for each RNA molecule, the levels at the first time point and at a later time point are determined and then further compared to each other.

[0406] This process allows for monitoring lung cancer in patients (healthy or suffering from lung cancer) over long periods of time, such as multiple months or years, for example 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months or 11 months, 1 year, 2 years, 3 years, 4 years or 5 years.

[0407] The time period between the first time point and the later time point is preferably at least 1 day, at least 2 days, at least 3 days, at least 4 days, at least 5 days, at least 6 days, at least 7 days (1 week), at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 1 month, at least 2 months, at least 3 months, at least 4 months, at least 5 months, at least 6 months, at least 7 months, at least 8 months, at least 9 months, at least 10 months, at least 11 months, at least 12 months (1 year), at least 24 months (2 years), at least 3 years, at least 4 years, at least 5 years, at least 6 years, at least 7 years, at least 8 years, at least 9 years or at least 10 years. For example, individuals can be routinely checked, for example, once or twice a year. Patients can be (re)tested at 2, 3, 4, 5, 6, 7, 8, 9 or 10 time points (first time point and additional time).

[0408] In preferred embodiments (i), (ii) and / or (iii), the level of an RNA molecule selected from the group consisting of

[0409] (i) increases over time indicating that the patient has developed lung cancer or that lung cancer in the patient is getting worse,

[0410] (ii) no change over time indicating that the patient is stable or the lung cancer has not progressed in the patient, or

[0411] (iii) Decreases over time indicating that lung cancer in patients is improving:

[0412] SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:15, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:36, SEQ ID NO:38, SEQ ID NO:41, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:49, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:62, SEQ ID NO:69, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:77 and / or SEQ ID NO:78.

[0413] Specifically,

[0414] (i) the patient is healthy at a first time point, and said level increasing over time indicates that the patient develops lung cancer;

[0415] (ii) the patient already had lung cancer at a first time point, and the level increasing over time indicates that the lung cancer in the patient is worsening;

[0416] (iii) the patient already had lung cancer at the first time point, and the level not changing over time indicates that the lung cancer has not progressed in the patient; or

[0417] (iv) the patient already had lung cancer at the first time point, and the level decreasing over time indicates that the lung cancer in the patient is improving.

[0418] More specifically, the patient receives, has received or has received therapeutic treatment for lung cancer.

[0419] Even more specifically, the therapeutic treatment of lung cancer is selected from the group consisting of surgery, chemotherapy, targeted therapy, immunotherapy, oncolytic virus therapy, vaccine therapy, radiation therapy, laser therapy, thermotherapy and administration of drugs, or a combination thereof.

[0420] In preferred embodiments (i), (ii) and / or (iii), the level of an RNA molecule selected from the group consisting of

[0421] (i) decreases over time indicating that the patient has developed lung cancer or that lung cancer in the patient is getting worse,

[0422] (ii) no change over time indicating that the patient is stable or the lung cancer has not progressed in the patient, or

[0423] (iii) Increases over time indicating that lung cancer in patients is improving:

[0424] SEQ ID NO:4, SEQ ID NO:10, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO: 35, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 52, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76 and / or SEQ ID NO:79.

[0425] Specifically,

[0426] (i) the patient is healthy at a first time point and said levels decreasing over time indicate that the patient has developed lung cancer;

[0427] (ii) the patient already had lung cancer at a first time point, and the level decreasing over time indicates that the lung cancer in the patient is worsening;

[0428] (iii) the patient already had lung cancer at the first time point, and the level not changing over time indicates that the lung cancer has not progressed in the patient; or

[0429] (iv) the patient already had lung cancer at a first time point, and the level increasing over time indicates that the lung cancer in the patient is improving.

[0430] More specifically, the patient receives, has received or has received therapeutic treatment for lung cancer.

[0431] Even more specifically, the therapeutic treatment of lung cancer is selected from the group consisting of surgery, chemotherapy, targeted therapy, immunotherapy, oncolytic virus therapy, vaccine therapy, radiation therapy, laser therapy, thermotherapy and administration of drugs, or a combination thereof.

[0432] In alternative or additional preferred embodiments (i), (ii) and / or (iii),

[0433] The level of the at least one RNA molecule is specifically used in mathematical calculations to obtain values ​​at different time points (i.e. a first time point and a later time point), which are then compared to each other; or

[0434] The levels of the at least two RNA molecules are specifically used in mathematical calculations to obtain values ​​at different time points (ie a first time point and a later time point), which are then compared to each other.

[0435] Perform the mathematical calculations as described above.

[0436] Specifically, the numerical value is obtained by adding the weighted levels of the at least two RNA molecules, for example, at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, , 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78 or 79 RNA molecules (e.g., 71 or 79 RNA molecules).

[0437] With respect to the at least two RNA molecules, it is meant:

[0438] an RNA molecule having a nucleotide sequence according to SEQ ID NO: 1 and SEQ ID NO: 2 and optionally at least one RNA molecule having a nucleotide sequence according to SEQ ID NO: 3 to SEQ ID NO: 71; or

[0439] RNA molecules having a nucleotide sequence according to SEQ ID NO: 1 and SEQ ID NO: 2 and optionally at least one RNA molecule having a nucleotide sequence according to SEQ ID NO: 3 to SEQ ID NO: 79.

[0440] Alternatively, with respect to the at least two RNA molecules, it refers to RNA molecules having nucleotide sequences according to SEQ ID NO:2 and SEQ ID NO:3 and optionally at least one RNA molecule having a nucleotide sequence according to SEQ ID NO:1, SEQ ID NO:4 to SEQ ID NO:79.

[0441] The at least two RNA molecules may also be designed as RNA molecule features.

[0442] Preferably, the value is compared to an empirically determined cut-off score.

[0443] Regarding implementation method (i):

[0444] More preferably, the value (z) of SEQ ID NO: 1 is calculated as follows: z = f(1.00*x1+-5.24), f(x) = 1 / (1+exp(-x)))),,

[0445] Where x1 is the normalized log2-RPM expression value of SEQ ID NO: 1, RPM stands for reads per million, the cutoff score (y) is 0.5, and

[0446] wherein the value (z)>0.5 and further increases with time, indicating worsening of lung cancer in the patient, or

[0447] Therein, a value (z) > 0.5 and does not further increase over time, indicating that the lung cancer in the patient is stable.

[0448] Regarding implementation method (ii),

[0449] More preferably, with respect to features: SEQ ID NO: 1 and SEQ ID NO: 2, the value (z) is calculated as follows:

[0450] z=f(0.95*x1+0.71*x2+-5.71), f(x)=1 / (1+exp(-x)))),

[0451] Where x1 and x2 are the normalized log2-RPM expression values ​​of SEQ ID NO: 1 and SEQ ID NO: 2, RPM stands for reads per million, the cutoff score (y) is 0.5, and

[0452] wherein the value (z)>0.5 and further increases with time, indicating worsening of lung cancer in the patient, or

[0453] Therein, a value (z) > 0.5 and does not further increase over time, indicating that the lung cancer in the patient is stable.

[0454] Even more preferably, with respect to features: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 19, SEQ ID NO: 35, SEQ ID NO: 39 and SEQ ID NO: 48, the value (z) is calculated as follows:

[0455] z=f(0.94*x1+0.86*x2+-0.07*x19+-0.33*x35+-0.15*x39+-0.33*x48+-3.86), f(x)=1 / (1+exp(-x)))),

[0456] wherein x1, x2, x19, x35, x39, and x48 are the normalized log2-RPM expression values ​​of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 19, SEQ ID NO: 35, SEQ ID NO: 39, and SEQ ID NO: 48, respectively, RPM stands for reads per million, the cutoff score (y) is 0.5, and

[0457] wherein the value (z)>0.5 and further increases with time, indicating worsening of lung cancer in the patient, or

[0458] Therein, a value (z) > 0.5 and does not further increase over time, indicating that the lung cancer in the patient is stable.

[0459] Alternatively, for features: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 23, SEQ ID NO: 39 and SEQ ID NO: 48, the value (z) is calculated as follows:

[0460] y=f(0.44*x1+0.83*x2+0.45*x23+-0.07*x39+-0.25*x48+-4.34), f(x)=1 / (1+exp(-x)))),

[0461] wherein x1, x2, x23, x39, and x48 are the normalized log2-RPM expression values ​​of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 23, SEQ ID NO: 39, and SEQ ID NO: 48, respectively, RPM stands for reads per million, the cutoff score (y) is 0.5, and

[0462] Wherein, a value (z) > 0.5 and further increases with time, indicating that the lung cancer in the patient is worsening, or

[0463] Therein, a value (z) > 0.5 and does not further increase over time, indicating that the lung cancer in the patient is stable.

[0464] Alternatively, for features: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 7 and SEQ ID NO: 9, the value (z) is calculated as follows:

[0465] z=f(0.84*x1+0.60*x2+0.85*x6+0.23*x7+0.30*x9+-6.44), f(x)=1 / (1+exp(-x)))),

[0466] wherein x1, x2, x6, x7, and x9 are the normalized log2-RPM expression values ​​of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 7, and SEQ ID NO: 9, respectively, RPM stands for reads per million, the cutoff score (y) is 0.5, and

[0467] wherein the value (z)>0.5 and further increases with time, indicating worsening of lung cancer in the patient, or

[0468] Therein, a value (z) > 0.5 and does not further increase over time, indicating that the lung cancer in the patient is stable.

[0469] Alternatively, for features: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 7, and SEQ ID NO: 11, and SEQ ID NO: 18, the value (z) is calculated as follows:

[0470] y=f(0.19*x1+0.62*x2+0.87*x6+0.32*x7+0.40*x11+0.65*x18+-6.12), f(x)=1 / (1+exp(-x)))),

[0471] wherein x1, x2, x6, x7, x11, and x18 are the normalized log2-RPM expression values ​​of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 11, and SEQ ID NO: 18, respectively, RPM stands for reads per million, the cutoff score (y) is 0.5, and

[0472] wherein the value (z)>0.5 and further increases with time, indicating worsening of lung cancer in the patient, or

[0473] Therein, a value (z) > 0.5 and does not further increase over time, indicating that the lung cancer in the patient is stable.

[0474] Still even more preferably, with respect to features: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 19, SEQ ID NO: 35, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 43, SEQ ID NO: 48 and SEQ ID NO: 49, the value (z) is calculated as follows:

[0475] z=f(0.93*x1+0.83*x2+-0.09*x19+-0.33*x35+-0.11*x38+-0.13*x39+-0. 12*x40+0.17*x43+-0.29*x48+0.10*x49+-4.41), f(x)=1 / (1+exp(-x)))),

[0476] wherein x1, x2, x19, x35, x38, x39, x40, x43, x48 and x49 are the normalized log2-RPM expression values ​​of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 19, SEQ ID NO: 35, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 43, SEQ ID NO: 48 and SEQ ID NO: 49, respectively, RPM stands for reads per million, the cutoff score (y) is 0.5, and

[0477] wherein the value (z)>0.5 and further increases with time, indicating worsening of lung cancer in the patient, or

[0478] Therein, a value (z) > 0.5 and does not further increase over time, indicating that the lung cancer in the patient is stable.

[0479] Alternatively, for features: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 17, SEQ ID NO: 23, SEQ ID NO: 35, SEQ ID NO: 39, SEQ ID NO: 45, SEQ ID NO: 48, SEQ ID NO: 52 and SEQ ID NO: 53, the value (z) is calculated as follows:

[0480] z=f(0.52*x1+0.93*x2+-0.22*x17+0.43*x23+-0.22*x35+-0.08*x39+-0.0 6*x45+-0.22*x48+-0.32*x52+0.02*x53+-1.32), f(x)=1 / (1+exp(-x)))),

[0481] wherein x1, x2, x17, x23, x35, x39, x45, x48, x52, and x53 are the normalized log2-RPM expression values ​​of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 17, SEQ ID NO: 23, SEQ ID NO: 35, SEQ ID NO: 39, SEQ ID NO: 45, SEQ ID NO: 48, SEQ ID NO: 52, and SEQ ID NO: 53, respectively, RPM stands for reads per million, the cutoff score (y) is 0.5, and

[0482] wherein the value (z)>0.5 and further increases with time, indicating worsening of lung cancer in the patient, or

[0483] Therein, a value (z) > 0.5 and does not further increase over time, indicating that the lung cancer in the patient is stable.

[0484] Alternatively, for features: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 19, SEQ ID NO: 25, SEQ ID NO: 29, SEQ ID NO: 30 and SEQ ID NO: 38, the value (z) is calculated as follows:

[0485] z=f(0.83*x1+0.77*x2+0.69*x6+0.31*x7+0.34*x9+-0.03*x19+-0.58* x25+-0.33*x29+-0.28*x30+-0.19*x38+3.17), f(x)=1 / (1+exp(-x)))),

[0486] wherein x1, x2, x6, x7, x9, x19, x25, x29, x30 and x38 are the normalized log2-RPM expression values ​​of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 19, SEQ ID NO: 25, SEQ ID NO: 29, SEQ ID NO: 30 and SEQ ID NO: 38, respectively, RPM stands for reads per million, the cutoff score (y) is 0.5, and

[0487] wherein the value (z)>0.5 and further increases with time, indicating worsening of lung cancer in the patient, or

[0488] Therein, a value (z) > 0.5 and does not further increase over time, indicating that the lung cancer in the patient is stable.

[0489] Alternatively, for features: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 18 and SEQ ID NO: 28, the value (z) is calculated as follows:

[0490] z=f(0.24*x1+0.74*x2+0.19*x3+0.68*x6+0.36*x7+0.26*x11+0.26*x12+-0.42*x14+0.66*x18+-0.94*x28+4.76), f(x)=1 / (1+exp(-x)))),

[0491] wherein x1, x2, x3, x6, x7, x11, x12, x14, x18 and x28 are the normalized log2-RPM expression values ​​of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 18 and SEQ ID NO: 28, respectively, RPM stands for reads per million, the cutoff score (y) is 0.5, and

[0492] wherein the value (z)>0.5 and further increases with time, indicating worsening of lung cancer in the patient, or

[0493] Therein, a value (z) > 0.5 and does not further increase over time, indicating that the lung cancer in the patient is stable.

[0494] Most preferably, with respect to (54) feature: SEQ ID NO: 1 to SEQ ID NO: 54, the value (z) is calculated as follows:

[0495] z=f(0.45*x1+0.83*x2+0.74*x3+0.50*x4+-0.48*x5+0.74*x6+0.48*x7+0.55* x8+0.64*x9+-0.72*x10+0.39*x11+0.25*x12+0.35*x13+-0.34*x14+-0.43*x15 +-0.40*x16+-0.34*x17+0.14*x18+-0.32*x19+-0.52*x20+-0.28*x21+-0.32* x22+-0.28*x23+0.20*x24+-0.33*x25+-0.24*x26+0.26*x27+0.44*x28+-0.11* x29+-0.12*x30+-0.10*x31+0.25*x32+-0.26*x33+0.16*x34+-0.15*x35+-0.2 4*x36+0.10*x37+-0.11*x38+-0.08*x39+0.08*x40+0.05*x41+-0.10*x42+0.06 *x43+0.06*x44+0.12*x45+-0.06*x46+0.10*x47+-0.02*x48+0.01*x49+-0.04* x50+0.02*x51+0.01*x52+0.04*x53+0.05*x54+0.21), f(x)=1 / (1+exp(-x)))),

[0496] wherein x1 to x54 are each the normalized log2-RPM expression values ​​of SEQ ID NO: 1 to SEQ ID NO: 54, RPM stands for reads per million, the cutoff score (y) is 0.5, and

[0497] wherein the value (z)>0.5 and further increases with time, indicating worsening of lung cancer in the patient, or

[0498] Therein, a value (z) > 0.5 and does not further increase over time, indicating that the lung cancer in the patient is stable.

[0499] Alternatively, with respect to feature (38): SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 34, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 70 and SEQ ID NO: 71, the value (z) is calculated as follows:

[0500] z = f(0.05*x1 + 0.83*x2 + 0.27*x3 + 0.89*x6 + 0.35*x7 + 0.29*x8 + -0.56*x10 + 0.14*x11 + 0.13*x12 + -0.16*x14 + -0.21*x16 + -0.29*x17 + 0.37*x18 + -0.21*x21 + -0.26*x22 + -0.15*x24 + -0.26*x26 + -0.74*x28 + -0.17*x29 + -0.17*x31 + 0.17*x34 + 0.16*x55 + 0.18*x56 + 0.19*x57 + 0.08*x58 + 0.27*x59 + 0.39*x60 + 0.50*x61 + 0.24*x62 + -0.10*x63 + -0.19*x64 + -0.12*x65 + -0.54*x66 + -0.07*x67 + -0.20*x68 + -0.25*x69 + 0.81*x70 + -0.19*x71 + 0.33), where f(x) = 1 / (1 + exp(-x))),

[0501] Among them, x1, x2, x3, x6, x7, x8, x10, x11, x12, x14, x16, x17, x18, x21, x22, x24, x26, x28, x29, x31, x34, x55 to x71 are SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 34, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70 and SEQ ID NO:71, where RPM stands for reads per million, and the cutoff score (y) is 0.5, and

[0502] Wherein, a value (z) > 0.5 and further increases with time, indicating that the lung cancer in the patient is worsening, or

[0503] Wherein, a value (z) > 0.5 and does not further increase over time, indicating that the lung cancer in the patient is stable.

[0504] Regarding implementation method (iii),

[0505] More preferably, with respect to (2) feature: SEQ ID NO: 2 and SEQ ID NO: 3, the value (z) is calculated as follows:

[0506] z=f(0.800*x2+1.342*x3+-8.733),f(x)=1 / (1+exp(-x)))),

[0507] Wherein, x2 and x3 are the log2-RPM expression values ​​of SEQ ID NO: 2 and SEQ ID NO: 3, respectively, RPM stands for reads per million, and the cutoff score (y) is 0.5, and

[0508] Wherein, a value (z) > 0.5 and further increases with time, indicating that the lung cancer in the patient is worsening, or

[0509] Wherein, a value (z) > 0.5 and does not further increase over time, indicating that the lung cancer in the patient is stable.

[0510] Even more preferably, with respect to (18) features: SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 11, SEQ ID NO: 14, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 21, SEQ ID NO: 28, SEQ ID NO: 56, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 77, SEQ ID NO: 78 and SEQ ID NO: 79, the value (z) is calculated as follows:

[0511] z=f(0.792*x2+0.54*x3+0.521*x7+0.26*x11+-0.284*x14+-0.306*x17+0.399*x18+-0.429*x21+-0.693*x28+0.295* x56+0.452*x72+0.38*x73+-0.3*x74+-0.297*x75+-0.219*x76+0.157*x77+0.0658*x78+-0.0421*x79+5.203), f(x)=1 / (1+exp(-x)))),

[0512] wherein x2, x3, x7, x11, x14, x17, x18, x21, x28, x56, x72, x73, x74, x75, x76, x77, x78, x79 are the log2-RPM expression values ​​of SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 11, SEQ ID NO: 14, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 21, SEQ ID NO: 28, SEQ ID NO: 56, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 79, respectively, RPM stands for reads per million, the cutoff score (y) is 0.5, and

[0513] Wherein, a value (z) > 0.5 and further increases with time, indicating that the lung cancer in the patient is worsening, or

[0514] Wherein, a value (z) > 0.5, and does not further increase over time, indicates that the lung cancer in the patient is stable.

[0515] Even more preferably, with respect to (6) feature (Mitra sample): SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 17, SEQ ID NO: 18 and SEQ ID NO: 75, the value (z) is calculated as follows:

[0516] Even more preferably, with respect to (6) feature (Mitra sample): SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 17, SEQ ID NO: 18 and SEQ ID NO: 75, the value (z) is calculated as follows:

[0517] z=f(19.621*x2+0.638*x3+1.171*x7+-0.492*x17+-2.400*x18+1.049*x75+3.185), f(x)=1 / (1+exp(-x)))),

[0518] wherein x2, x3, x7, x17, x18, x75 are the log2-RPM expression values ​​of SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 75, respectively, RPM stands for reads per million, the cutoff score (y) is 0.5, and

[0519] Wherein, a value (z) > 0.5 and further increases with time, indicating that the lung cancer in the patient is worsening, or

[0520] Wherein, a value (z) > 0.5, and does not further increase over time, indicates that the lung cancer in the patient is stable.

[0521] The patient may receive therapeutic treatment (e.g., administration of a drug) throughout the monitoring process, or may receive therapeutic treatment (e.g., administration of a drug) before, at, or after a first time point, and may be retested at a later time point. In particular, the first time point may be before the start of the therapeutic treatment, and the later time point may be during and / or after the therapeutic treatment. If the therapeutic treatment includes administration of a drug, and the patient responds to the treatment, the drug administration may be continued, the dosage of the drug may be reduced, or the drug administration may be stopped. If the therapeutic treatment includes administration of a drug, and the patient does not respond to the treatment, the dosage of the drug may be increased, the drug may be changed, or the mode of therapy may be changed, for example, from administration of a drug to surgery, laser therapy, or thermotherapy.

[0522] Due to the therapeutic treatment, the level of the increased RNA molecule can be reduced and / or the level of the reduced RNA molecule can be increased. Alternatively, due to the therapeutic treatment, the value of the increased RNA molecule can be reduced and / or the value of the reduced RNA molecule can be increased. In this way, the (overall) condition of the patient suffering from lung cancer can be improved.

[0523] In the method of the first aspect, preferably the lung cancer is phase I or phase II lung cancer (i.e., early lung cancer). In this respect, the diagnostic test can significantly reduce the mortality rate because lung cancer can be detected at a very early stage. Further preferably, the lung cancer is small cell lung cancer (SCLC) or non-small cell lung cancer (NSCLC), particularly lung adenocarcinoma (LUAD) or lung squamous cell carcinoma (LUSC), such as small cell lung cancer (SCLC) or non-small cell lung cancer (NSCLC) in phase I or phase II, particularly lung adenocarcinoma (LUAD) or lung squamous cell carcinoma (LUSC).

[0524] In the method of the second aspect, the lung cancer is preferably small cell lung cancer (SCLC) or non-small cell lung cancer (NSCLC), more preferably lung adenocarcinoma (LUAD) or lung squamous cell carcinoma (LUSC).

[0525] In the method of the first or second aspect, the patient is preferably a mammal, more preferably a human or a rodent, even more preferably a human.

[0526] In the method of the first or second aspect, preferably, the blood sample is whole blood or a blood fraction. More preferably, the blood fraction is selected from the group consisting of a blood cell fraction, plasma and serum. Even more preferably, the blood cell fraction is a fraction of / comprising red blood cells, white blood cells and / or platelets.

[0527] In the method of the first or second aspect, the level of RNA molecules is preferably determined by sequencing, in particular next generation sequencing (e.g. ABI SOLID, Illumina Genome Analyzer, Roche 454GS FL, BGISEQ); nucleic acid hybridization (e.g. microarray or microbeads); nucleic acid amplification (e.g. PCR, RT-PCR, qRT-PCR or high throughput RT-PCR); polymerase extension; mass spectrometry; flow cytometry (e.g. LUMINEX), or any combination thereof.

[0528] In the method of the first or second aspect, the level of the RNA molecule is the expression level of said RNA molecule.

[0529] In a third aspect, the present invention relates to the following (in vitro) uses:

[0530] (i) use of at least one RNA molecule for diagnosing lung cancer in a patient, or for monitoring a patient suspected of having lung cancer or a patient suffering from lung cancer,

[0531] wherein the at least one RNA molecule comprises / has a nucleotide sequence according to SEQ ID NO: 1, or is a fragment thereof, or has a sequence having at least 80% sequence identity thereto;

[0532] (ii) use of at least two RNA molecules for diagnosing lung cancer in a patient, or for monitoring a patient suspected of having lung cancer or a patient suffering from lung cancer, wherein the at least two RNA molecules comprise a first RNA molecule and a second RNA molecule,

[0533] wherein the first RNA molecule comprises / has a nucleotide sequence according to SEQ ID NO: 1, or a fragment thereof, or a sequence having at least 80% sequence identity thereto, and the second RNA molecule comprises / has a nucleotide sequence according to SEQ ID NO: 2, or a fragment thereof, or a sequence having at least 80% sequence identity thereto; or

[0534] (iii) use of at least two RNA molecules for diagnosing lung cancer in a patient, or for monitoring a patient suspected of having lung cancer or a patient suffering from lung cancer, wherein the at least two RNA molecules comprise a first RNA molecule and a second RNA molecule,

[0535] Wherein, the first RNA molecule comprises a nucleotide sequence according to SEQ ID NO:2, or a fragment thereof, or a sequence having at least 80% sequence identity therewith, and the second RNA molecule comprises a nucleotide sequence according to SEQ ID NO:3, or a fragment thereof, or a sequence having at least 80% sequence identity therewith.

[0536] Preferably,

[0537] The first RNA molecule comprises the nucleotide sequence according to SEQ ID NO: 1, and the second RNA molecule comprises the nucleotide sequence according to SEQ ID NO: 2; or

[0538] The first RNA molecule comprises a nucleotide sequence according to SEQ ID NO:2, and the second RNA molecule comprises a nucleotide sequence according to SEQ ID NO:3.

[0539] In particular, the at least two RNA molecules are included in a group. In other words, the at least two RNA molecules represent a feature. The feature may include, for example, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97 7, 8, 9, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78 or 79 RNA molecules, specifically, 2, 5, 6, 10, 18, 38 or 54 RNA molecules (RNA signatures).

[0540] In embodiment (i),

[0541] At least one additional RNA molecule selected from the group consisting of the following RNA molecules for diagnosing or monitoring lung cancer in a patient: an RNA molecule comprising / having a nucleotide sequence according to SEQ ID NO: 2 to SEQ ID NO: 71, an RNA molecule comprising / having a fragment thereof, and an RNA molecule comprising / having a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto; or

[0542] At least one additional RNA molecule selected from the group consisting of the following RNA molecules is used for diagnosing or monitoring lung cancer in a patient: an RNA molecule comprising / having a nucleotide sequence according to SEQ ID NO: 2 to SEQ ID NO: 79, an RNA molecule comprising / having a fragment thereof, and an RNA molecule comprising / having a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto.

[0543] Thus, an RNA molecule comprising the nucleotide sequence according to SEQ ID NO: 1, a fragment thereof or a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto will be included, and

[0544] At least one additional RNA molecule selected from the group consisting of the following RNA molecules for diagnosing or monitoring lung cancer in a patient: an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 2 to SEQ ID NO: 71, an RNA molecule comprising a fragment thereof, and an RNA molecule comprising a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto, or

[0545] At least one additional RNA molecule selected from the group consisting of the following RNA molecules is used to diagnose or monitor lung cancer in a patient: an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 2 to SEQ ID NO: 79, an RNA molecule comprising fragments thereof, and an RNA molecule comprising a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g., at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto.

[0546] Specifically, the RNA molecule is an RNA molecule comprising:

[0547] (i) a nucleotide sequence according to SEQ ID NO: 1 to SEQ ID NO: 71 or SEQ ID NO: 1 to SEQ ID NO: 79,

[0548] (ii) a nucleotide sequence that is a fragment of the nucleotide sequence according to (i), preferably a nucleotide sequence that is a fragment that is between 1 and 12, more preferably between 1 and 8, and most preferably between 1 and 5 or between 1 and 3 (e.g. 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12) nucleotides shorter than the nucleotide sequence according to (i), or

[0549] (iii) a nucleotide sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g., at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity with the nucleotide sequence according to (i) or the nucleotide sequence fragment according to (ii).

[0550] In embodiment (ii),

[0551] At least one additional RNA molecule selected from the group consisting of the following RNA molecules is used for diagnosing or monitoring lung cancer in a patient: an RNA molecule comprising / having a nucleotide sequence according to SEQ ID NO: 3 to SEQ ID NO: 71, an RNA molecule comprising / having a fragment thereof, and an RNA molecule comprising / having a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto; or

[0552] At least one additional RNA molecule selected from the group consisting of the following RNA molecules is used for diagnosing or monitoring lung cancer in a patient: an RNA molecule comprising / having a nucleotide sequence according to SEQ ID NO: 3 to SEQ ID NO: 79, an RNA molecule comprising / having a fragment thereof, and an RNA molecule comprising / having a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto.

[0553] Thus, it will include an RNA molecule comprising the nucleotide sequence according to SEQ ID NO: 1, a fragment thereof or a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto, as well as an RNA molecule comprising the nucleotide sequence according to SEQ ID NO: 1, a fragment thereof or a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto, and NO:2, a fragment thereof, or an RNA molecule having a sequence identity of at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) thereto,

[0554] and the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO:3 to SEQ ID NO:71, an RNA molecule comprising fragments thereof, and an RNA molecule comprising a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto for diagnosing or monitoring lung cancer in a patient, or

[0555] and the level of at least one additional RNA molecule selected from the group consisting of the following RNA molecules for diagnosing or monitoring lung cancer in a patient: an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 3 to SEQ ID NO: 79, an RNA molecule comprising a fragment thereof, and an RNA molecule comprising a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g., at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto.

[0556] Specifically, the RNA molecule is an RNA molecule comprising:

[0557] (i) a nucleotide sequence according to SEQ ID NO: 1 to SEQ ID NO: 71 or SEQ ID NO: 1 to SEQ ID NO: 79,

[0558] (ii) a nucleotide sequence that is a fragment of the nucleotide sequence according to (i), preferably a nucleotide sequence that is a fragment that is between 1 and 12, more preferably between 1 and 8, and most preferably between 1 and 5 or between 1 and 3 (e.g. 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12) nucleotides shorter than the nucleotide sequence according to (i), or

[0559] (iii) a nucleotide sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g., at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity with the nucleotide sequence according to (i) or the nucleotide sequence fragment according to (ii).

[0560] Preferably,

[0561] (i) using at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 19, SEQ ID NO: 35, SEQ ID NO: 39, SEQ ID NO: 48, an RNA molecule comprising fragments thereof and an RNA molecule comprising a sequence having at least 80% sequence identity thereto (for diagnosing or monitoring lung cancer in a patient);

[0562] (ii) using at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 23, SEQ ID NO: 39, SEQ ID NO: 48, an RNA molecule comprising a fragment thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto (for diagnosing or monitoring lung cancer in a patient);

[0563] (iii) using at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:9, an RNA molecule comprising a fragment thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto (for diagnosing or monitoring lung cancer in a patient);

[0564] (iv) using at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:11, SEQ ID NO:18, an RNA molecule comprising fragments thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto (for diagnosing or monitoring lung cancer in a patient);

[0565] (v) using at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 19, SEQ ID NO: 35, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 43, SEQ ID NO: 48, SEQ ID NO: 49, an RNA molecule comprising fragments thereof and an RNA molecule comprising a sequence having at least 80% sequence identity thereto (for diagnosing or monitoring lung cancer in a patient);

[0566] (vi) using at least one additional RNA molecule selected from the group consisting of the following RNA molecules (for diagnosing or monitoring lung cancer in a patient): an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 17, SEQ ID NO: 23, SEQ ID NO: 35, SEQ ID NO: 39, SEQ ID NO: 45, SEQ ID NO: 48, SEQ ID NO: 52, SEQ ID NO: 53, an RNA molecule comprising fragments thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto;

[0567] (vii) using at least one additional RNA molecule selected from the group consisting of: an RNA molecule comprising a nucleotide sequence according to SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:19, SEQ ID NO:25, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:38, an RNA molecule comprising fragments thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto (for diagnosing or monitoring lung cancer in a patient);

[0568] (viii) using at least one additional RNA molecule selected from the group consisting of: an RNA molecule comprising a nucleotide sequence according to SEQ ID NO:3, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:18, SEQ ID NO:28, an RNA molecule comprising fragments thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto (for diagnosing or monitoring lung cancer in a patient);

[0569] (ix) using at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 3 to SEQ ID NO: 54, an RNA molecule comprising a fragment thereof and an RNA molecule comprising a sequence having at least 80% sequence identity thereto (for diagnosing or monitoring lung cancer in a patient); or

[0570] (x) using at least one additional RNA molecule selected from the group consisting of the following RNA molecules (for diagnosing or monitoring lung cancer in a patient): comprising the RNA molecules according to SEQ ID NO:3, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:26, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:31, SEQ ID NO:34, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68 NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:71, RNA molecules including fragments thereof, and RNA molecules including sequences having at least 80% sequence identity therewith.

[0571] More preferably, an RNA molecule comprising a nucleotide sequence according to:

[0572] (i) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 19, SEQ ID NO: 35, SEQ ID NO: 39 and SEQ ID NO: 48;

[0573] (ii) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 23, SEQ ID NO: 39 and SEQ ID NO: 48;

[0574] (iii) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 7 and SEQ ID NO: 9;

[0575] (iv) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 11 and SEQ ID NO: 18;

[0576] (v) SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:19, SEQ ID NO:35, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:43, SEQ ID NO:48 and SEQ ID NO:49;

[0577] (vi) SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:17, SEQ ID NO:23, SEQ ID NO:35, SEQ ID NO:39, SEQ ID NO:45, SEQ ID NO:48, SEQ ID NO:52 and SEQ ID NO:53;

[0578] (vii) SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:19, SEQ ID NO:25, SEQ ID NO:29, SEQ ID NO:30 and SEQ ID NO:38;

[0579] (viii) SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:18, and SEQ ID NO:28;

[0580] (ix) SEQ ID NO:1 to SEQ ID NO:54; or

[0581] (x) SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:26, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:31, SEQ ID NO:34, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, and SEQ ID NO:71.

[0582] In embodiment (iii),

[0583] At least one additional RNA molecule selected from the group consisting of an RNA molecule comprising / having a nucleotide sequence according to SEQ ID NO: 1, SEQ ID NO: 4 to SEQ ID NO: 79, an RNA molecule comprising / having a fragment thereof, and an RNA molecule comprising / having a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto is used for diagnosing or monitoring lung cancer in a patient.

[0584] Thus, it will include an RNA molecule comprising the nucleotide sequence according to SEQ ID NO: 2, a fragment thereof or a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto, as well as an RNA molecule comprising the nucleotide sequence according to SEQ ID NO: 2, a fragment thereof or a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto, and NO:3, a fragment thereof, or an RNA molecule having a sequence identity of at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) thereto, and the level of at least one additional RNA molecule selected from the group consisting of the following RNA molecules for diagnosing or monitoring lung cancer in a patient: comprising the nucleotide sequence according to SEQ ID NO:1, SEQ ID NO:4 to SEQ ID NO:79, RNA molecules comprising fragments thereof, and RNA molecules comprising sequences having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g., at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto.

[0585] Specifically, the RNA molecule is an RNA molecule comprising:

[0586] (i) according to SEQ ID NO: 1 to SEQ ID NO: 79,

[0587] (ii) a nucleotide sequence that is a fragment of the nucleotide sequence according to (i), preferably a nucleotide sequence that is a fragment that is between 1 and 12, more preferably between 1 and 8, and most preferably between 1 and 5 or between 1 and 3 (e.g. 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12) nucleotides shorter than the nucleotide sequence according to (i), or

[0588] (iii) a nucleotide sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g., at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity with the nucleotide sequence according to (i) or the nucleotide sequence fragment according to (ii).

[0589] Preferably,

[0590] (i) using at least one additional RNA molecule selected from the group consisting of the following RNA molecules for diagnosing or monitoring lung cancer in a patient: an RNA molecule comprising a nucleotide sequence according to SEQ ID NO:7, SEQ ID NO:11, SEQ ID NO:14, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:21, SEQ ID NO:28, SEQ ID NO:56, SEQ ID NO:72 to SEQ ID NO:79, an RNA molecule comprising fragments thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto; or

[0591] (ii) using at least one additional RNA molecule selected from the group consisting of the following RNA molecules for diagnosing or monitoring lung cancer in a patient: an RNA molecule comprising a nucleotide sequence according to SEQ ID NO:7, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:75, an RNA molecule comprising fragments thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto.

[0592] More preferably, an RNA molecule comprising a nucleotide sequence according to:

[0593] (i) SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:7, SEQ ID NO:11, SEQ ID NO:14, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:21, SEQ ID NO:28, SEQ ID NO:56, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, and SEQ ID NO:79; or

[0594] (ii) SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:7, SEQ ID NO:17, SEQ ID NO:18 and SEQ ID NO:75.

[0595] The diagnosis or monitoring is specifically carried out in a blood sample from the patient. For this purpose, the level of RNA molecules in a blood sample from the patient is specifically determined / analyzed. Preferably, the blood sample is whole blood or a blood fraction. More preferably, the blood fraction is selected from the group consisting of a blood cell fraction, plasma and serum. Even more preferably, the blood cell fraction is a fraction of / comprising red blood cells, white blood cells and / or platelets.

[0596] Preferably, the lung cancer is stage I or stage II lung cancer (i.e., early stage lung cancer). Further preferably, the lung cancer is small cell lung cancer (SCLC) or non-small cell lung cancer (NSCLC), in particular lung adenocarcinoma (LUAD) or lung squamous cell carcinoma (LUSC), such as stage I or stage II small cell lung cancer (SCLC) or non-small cell lung cancer (NSCLC), in particular lung adenocarcinoma (LUAD) or lung squamous cell carcinoma (LUSC).

[0597] With regard to further preferred embodiments, reference is made to the first or second aspect of the invention.

[0598] In a fourth aspect, the present invention relates to a kit for diagnosing lung cancer in a patient, or for monitoring a patient suspected of having lung cancer or a patient suffering from lung cancer (use (in vitro)), the kit comprising

[0599] (i) means for determining the level of at least one RNA molecule in a blood sample from a patient,

[0600] wherein the at least one RNA molecule comprises / has a nucleotide sequence according to SEQ ID NO: 1, or is a fragment thereof, or has a sequence having at least 80% sequence identity thereto,

[0601] (ii) means for determining the levels of at least two RNA molecules in a blood sample from a patient, wherein the at least two RNA molecules comprise a first RNA molecule and a second RNA molecule,

[0602] wherein the first RNA molecule comprises / has a nucleotide sequence according to SEQ ID NO: 1, or a fragment thereof, or a sequence having at least 80% sequence identity thereto, and the second RNA molecule comprises / has a nucleotide sequence according to SEQ ID NO: 2, or a fragment thereof, or a sequence having at least 80% sequence identity thereto, or

[0603] (iii) a means for determining the levels of at least two RNA molecules in a blood sample from a patient, wherein the at least two RNA molecules comprise a first RNA molecule and a second RNA molecule,

[0604] Wherein, the first RNA molecule comprises a nucleotide sequence according to SEQ ID NO:2, or a fragment thereof, or a sequence having at least 80% sequence identity therewith, and the second RNA molecule comprises a nucleotide sequence according to SEQ ID NO:3, or a fragment thereof, or a sequence having at least 80% sequence identity therewith.

[0605] Preferably,

[0606] The first RNA molecule comprises the nucleotide sequence according to SEQ ID NO: 1, and the second RNA molecule comprises the nucleotide sequence according to SEQ ID NO: 2; or

[0607] The first RNA molecule comprises a nucleotide sequence according to SEQ ID NO:2, and the second RNA molecule comprises a nucleotide sequence according to SEQ ID NO:3.

[0608] In particular, the at least two RNA molecules are included in a group. In other words, the at least two RNA molecules represent a feature. The feature may include, for example, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46 7, 8, 9, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78 or 79 RNA molecules, specifically, 2, 5, 6, 10, 18, 38 or 54 RNA molecules (RNA signatures).

[0609] In embodiment (i),

[0610] The kit comprises means for determining the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising / having a nucleotide sequence according to SEQ ID NO: 2 to SEQ ID NO: 71, an RNA molecule comprising / having a fragment thereof, and an RNA molecule comprising / having a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto, or

[0611] The kit comprises means for determining the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising / having a nucleotide sequence according to SEQ ID NO:2 to SEQ ID NO:79, an RNA molecule comprising / having a fragment thereof, and an RNA molecule comprising / having a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto.

[0612] Thus, the kit comprises means for determining the level of RNA molecules comprising the nucleotide sequence according to SEQ ID NO: 1, a fragment thereof or a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto,

[0613] and means for determining the level of at least one further RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 2 to SEQ ID NO: 71, an RNA molecule comprising fragments thereof and an RNA molecule comprising a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto, or

[0614] and means for determining the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising / having a nucleotide sequence according to SEQ ID NO:2 to SEQ ID NO:79, an RNA molecule comprising / having a fragment thereof and an RNA molecule comprising / having a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto.

[0615] Specifically, the RNA molecule is an RNA molecule comprising:

[0616] (i) a nucleotide sequence according to SEQ ID NO: 1 to SEQ ID NO: 71 or SEQ ID NO: 1 to SEQ ID NO: 79;

[0617] (ii) a nucleotide sequence that is a fragment of the nucleotide sequence according to (i), preferably a nucleotide sequence that is a fragment that is between 1 and 12, more preferably between 1 and 8, and most preferably between 1 and 5 or between 1 and 3 (e.g. 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12) nucleotides shorter than the nucleotide sequence according to (i); or

[0618] (iii) a nucleotide sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g., at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity with the nucleotide sequence according to (i) or the nucleotide sequence fragment according to (ii).

[0619] In embodiment (ii),

[0620] The kit comprises means for determining the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising / having a nucleotide sequence according to SEQ ID NO:3 to SEQ ID NO:71, an RNA molecule comprising / having a fragment thereof, and an RNA molecule comprising / having a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto; or

[0621] The kit comprises means for determining the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising / having a nucleotide sequence according to SEQ ID NO: 3 to SEQ ID NO: 79, an RNA molecule comprising / having a fragment thereof, and an RNA molecule comprising / having a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto.

[0622] Thus, the kit comprises means for determining the level of RNA molecules comprising the nucleotide sequence according to SEQ ID NO: 1, a fragment thereof or a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto, and means for determining the level of RNA molecules comprising the nucleotide sequence according to SEQ ID NO: 1, a fragment thereof or a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto. NO: 2, a fragment thereof or a RNA molecule having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto;

[0623] and means for determining the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 3 to SEQ ID NO: 71, an RNA molecule comprising fragments thereof, and an RNA molecule comprising a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto, or

[0624] and means for determining the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO:3 to SEQ ID NO:79, an RNA molecule comprising fragments thereof, and an RNA molecule comprising a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto.

[0625] Specifically, the RNA molecule is an RNA molecule comprising:

[0626] (i) a nucleotide sequence according to SEQ ID NO: 1 to SEQ ID NO: 71 or SEQ ID NO: 1 to SEQ ID NO: 79;

[0627] (ii) a nucleotide sequence that is a fragment of the nucleotide sequence according to (i), preferably a nucleotide sequence that is a fragment that is between 1 and 12, more preferably between 1 and 8, and most preferably between 1 and 5 or between 1 and 3 (e.g. 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12) nucleotides shorter than the nucleotide sequence according to (i); or

[0628] (iii) a nucleotide sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g., at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity with the nucleotide sequence according to (i) or the nucleotide sequence fragment according to (ii).

[0629] Preferably, the kit includes means for determining the levels of

[0630] (i) at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 19, SEQ ID NO: 35, SEQ ID NO: 39, SEQ ID NO: 48, an RNA molecule comprising fragments thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto;

[0631] (ii) at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 23, SEQ ID NO: 39, SEQ ID NO: 48, an RNA molecule comprising a fragment thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto;

[0632] (iii) at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 9, an RNA molecule comprising a fragment thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto;

[0633] (iv) at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 11, SEQ ID NO: 18, an RNA molecule comprising fragments thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto;

[0634] (v) at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 19, SEQ ID NO: 35, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 43, SEQ ID NO: 48, SEQ ID NO: 49, an RNA molecule comprising fragments thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto;

[0635] (vi) at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 17, SEQ ID NO: 23, SEQ ID NO: 35, SEQ ID NO: 39, SEQ ID NO: 45, SEQ ID NO: 48, SEQ ID NO: 52, SEQ ID NO: 53, an RNA molecule comprising fragments thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto;

[0636] (vii) at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:19, SEQ ID NO:25, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:38, an RNA molecule comprising fragments thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto;

[0637] (viii) at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO:3, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:18, SEQ ID NO:28, an RNA molecule comprising fragments thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto;

[0638] (ix) at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 3 to SEQ ID NO: 54, an RNA molecule comprising a fragment thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto; or

[0639] (x) at least one additional RNA molecule selected from the group consisting of the following RNA molecules: comprising the RNA molecules according to SEQ ID NO:3, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:26, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:31, SEQ ID NO:34, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, RNA molecules having the nucleotide sequence of SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:71, RNA molecules including fragments thereof, and RNA molecules including sequences having at least 80% sequence identity therewith.

[0640] More preferably, the kit comprises means for determining the level of an RNA molecule comprising a nucleotide sequence according to:

[0641] (i) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 19, SEQ ID NO: 35, SEQ ID NO: 39 and SEQ ID NO: 48;

[0642] (ii) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 23, SEQ ID NO: 39 and SEQ ID NO: 48;

[0643] (iii) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 7 and SEQ ID NO: 9;

[0644] (iv) SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:11 and SEQ ID NO:18;

[0645] (v) SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:19, SEQ ID NO:35, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:43, SEQ ID NO:48 and SEQ ID NO:49;

[0646] (vi) SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:17, SEQ ID NO:23, SEQ ID NO:35, SEQ ID NO:39, SEQ ID NO:45, SEQ ID NO:48, SEQ ID NO:52 and SEQ ID NO:53;

[0647] (vii) SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:19, SEQ ID NO:25, SEQ ID NO:29, SEQ ID NO:30 and SEQ ID NO:38;

[0648] (viii) SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:18 and SEQ ID NO:28;

[0649] (ix) SEQ ID NO:1 to SEQ ID NO:54; or

[0650] (x) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 21, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:26, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:31, SEQ ID NO:34, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70 and SEQ ID NO:71.

[0651] In embodiment (iii), the kit comprises means for determining the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising / having a nucleotide sequence according to SEQ ID NO: 1, SEQ ID NO: 4 to SEQ ID NO: 79, an RNA molecule comprising / having a fragment thereof, and an RNA molecule comprising / having a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto.

[0652] Thus, the kit comprises: means for determining the level of RNA molecules comprising the nucleotide sequence according to SEQ ID NO: 2, a fragment thereof or a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto, and means for determining the level of RNA molecules comprising the nucleotide sequence according to SEQ ID NO: 2, a fragment thereof or a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto. NO:3, a fragment thereof, or an RNA molecule having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto; and means for determining the level of at least one additional RNA molecule selected from the group consisting of the following RNA molecules: comprising the sequence according to SEQ ID NO:1, SEQ ID NO:4 to SEQ ID NO:5 NO:79, RNA molecules comprising fragments thereof, and RNA molecules comprising sequences having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g., at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto.

[0653] Specifically, the RNA molecule is an RNA molecule comprising:

[0654] (i) the nucleotide sequence according to SEQ ID NO: 1 to SEQ ID NO: 79;

[0655] (ii) a nucleotide sequence that is a fragment of the nucleotide sequence according to (i), preferably a nucleotide sequence that is a fragment that is between 1 and 12, more preferably between 1 and 8, and most preferably between 1 and 5 or between 1 and 3 (e.g. 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12) nucleotides shorter than the nucleotide sequence according to (i); or

[0656] (iii) a nucleotide sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g., at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity with the nucleotide sequence according to (i) or the nucleotide sequence fragment according to (ii).

[0657] Preferably, the kit comprises means for determining the levels of:

[0658] (i) at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO:7, SEQ ID NO:11, SEQ ID NO:14, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:21, SEQ ID NO:28, SEQ ID NO:56, SEQ ID NO:72 to SEQ ID NO:79, an RNA molecule comprising fragments thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto; or

[0659] (ii) at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 7, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 75, an RNA molecule comprising a fragment thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto.

[0660] More preferably, the kit comprises means for determining the level of an RNA molecule comprising a nucleotide sequence according to:

[0661] (i) SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:7, SEQ ID NO:11, SEQ ID NO:14, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:21, SEQ ID NO:28, SEQ ID NO:56, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, and SEQ ID NO:79; or

[0662] (ii) SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:7, SEQ ID NO:17, SEQ ID NO:18 and SEQ ID NO:75.

[0663] Preferably, the blood sample is whole blood or a blood fraction. More preferably, the blood fraction is selected from the group consisting of a blood cell fraction, plasma and serum. Even more preferably, the blood cell fraction is a fraction of / comprising red blood cells, white blood cells and / or platelets.

[0664] Preferably, the lung cancer is stage I or stage II lung cancer (i.e., early stage lung cancer). Further preferably, the lung cancer is small cell lung cancer (SCLC) or non-small cell lung cancer (NSCLC), in particular lung adenocarcinoma (LUAD) or lung squamous cell carcinoma (LUSC), such as stage I or stage II small cell lung cancer (SCLC) or non-small cell lung cancer (NSCLC), in particular lung adenocarcinoma (LUAD) or lung squamous cell carcinoma (LUSC).

[0665] With regard to further preferred embodiments, reference is made to the first or second aspect of the invention.

[0666] More specifically, the kit comprises

[0667] Tools for performing next generation sequencing (NGS),

[0668] One or more polynucleotides (probes) for detecting the RNA molecule,

[0669] One or more primers (e.g., primer pairs) for binding to the RNA molecule, and / or

[0670] One or more antibodies capable of binding to the hybrid of the polynucleotide (probe) and the RNA molecule.

[0671] The one or more polynucleotides (probes) can be a part of a microarray / biochip, or can be attached to a bead based on a multiplex system of beads. The one or more polynucleotides (primers, primer pairs) can be a part of a RT-PCR system, a PCR system, or a next generation sequencing system.

[0672] The tools may further include a microarray, a RT-PCR system, a PCR system, a flow cytometer, a Luminex system, and / or a next generation sequencing system.

[0673] In a preferred embodiment, the kit is useful for performing the method of the first or second aspect of the invention.

[0674] In another preferred embodiment, the kit further comprises instructions on how to carry out the method of the first or second aspect of the present invention.

[0675] The kit may further include

[0676] container, and / or

[0677] Data carrier.

[0678] The data carrier may be a non-electronic data carrier, such as a graphic data carrier (e.g., an information brochure, an information sheet, a bar code, or an access code), or an electronic data carrier, such as a floppy disk, a compact disk (CD), a digital versatile disk (DVD), a microchip, or another semiconductor-based electronic data carrier. The access code may allow access to a database (e.g., an Internet database, a centralized database, or a decentralized database). The access code may also allow access to application software, which enables a computer to perform tasks for a computer user, or to a mobile application, which is software designed to run on smartphones and other mobile devices.

[0679] The data carrier may further include at least one reference, e.g., a reference level and / or a cutoff score for the level of the RNA molecule determined herein. Where the data carrier includes an access code allowing access to a database, the at least one reference (reference level and / or a cutoff score for the level of the RNA molecule determined herein) may be stored in the database.

[0680] The data carrier may also comprise information or instructions on how to carry out the method of the first or second aspect of the invention.

[0681] The kit may further include materials desirable from a commercial and user perspective, including buffers, reagents and / or diluents for determining the above levels.

[0682] In a further aspect, the present invention relates to a method for determining / differentiating / differentiating whether a patient is healthy or has a lung cancer subtype, in particular has small cell lung cancer (SCLC), has lung adenocarcinoma (LUAD) or has lung squamous cell carcinoma (LUSC), the method comprising the steps of:

[0683] determining the levels of at least two RNA molecules in a blood sample from a patient, wherein the at least two RNA molecules include a first RNA molecule and a second RNA molecule,

[0684] wherein the first RNA molecule comprises the nucleotide sequence according to SEQ ID NO: 2, or a fragment thereof, or a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto, and the second RNA molecule comprises the nucleotide sequence according to SEQ ID NO: 2, or a fragment thereof, or a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto; IDNO: 3, or a fragment thereof, or a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g., at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto.

[0685] In a preferred embodiment, the levels of the following RNA molecules are determined in a blood sample from a patient:

[0686] the level of RNA molecules comprising the nucleotide sequence according to SEQ ID NO: 2, a fragment thereof or a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto,

[0687] The level of RNA molecules comprising the nucleotide sequence according to SEQ ID NO: 3, a fragment thereof or a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto, and

[0688] The level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 1, SEQ ID NO: 4 to SEQ ID NO: 79, including fragments thereof, and an RNA molecule comprising a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto.

[0689] Preferably, the levels of RNA molecules determined as above are (subsequently) used / considered in mathematical calculations to obtain a numerical value (z).

[0690] More preferably, the numerical value is obtained by summing the weighted levels of at least two RNA molecules.

[0691] Even more preferably, the value (z) is (afterwards) compared to an empirically determined cut-off score for healthy or lung cancer subtypes, in particular lung adenocarcinoma (LUAD), lung squamous cell carcinoma (LUSC) and / or small cell lung cancer (SCLC). Such a comparison allows determining whether a patient is healthy or has a lung cancer subtype, in particular LUAD, LUSC or SCLC.

[0692] In a more preferred embodiment,

[0693] (i) determining the level of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:7, SEQ ID NO:11, SEQ ID NO:14, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:21, SEQ ID NO:28, SEQ ID NO:56, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, and SEQ ID NO:79 in a blood sample from a patient,

[0694] (ii) using / taking into account the level of the RNA molecule determined in step (i) in a mathematical calculation to obtain a value (z), and

[0695] (iii) comparing the value (z) to an empirically determined cut-off score for healthy, adenocarcinoma (LUAD), squamous cell carcinoma (LUSC) and / or small cell lung cancer (SCLC), where

[0696] Values ​​(z) below the cut-off score for LUAD indicate that the patient is healthy (does not have lung cancer),

[0697] Values ​​(z) above the healthy cutoff score and below the LUSC cutoff score indicate that the patient has LUAD,

[0698] A value (z) below the cut-off score for SCLC and above the cut-off score for LUAD indicates that the patient has LUSC, or

[0699] A value (z) above the cut-off score for LUSC indicates that the patient has SCLC.

[0700] Preferably, the numerical value is obtained by summing the weighted levels of said at least two RNA molecules.

[0701] As mentioned above, in another aspect, the present invention relates to a method for determining / differentiating / differentiating whether a patient is healthy or has a lung cancer subtype, in particular has small cell lung cancer (SCLC), has lung adenocarcinoma (LUAD) or has lung squamous cell carcinoma (LUSC), the method comprising the following steps:

[0702] determining the levels of at least two RNA molecules in a blood sample from a patient, wherein the at least two RNA molecules include a first RNA molecule and a second RNA molecule,

[0703] wherein the first RNA molecule comprises the nucleotide sequence according to SEQ ID NO: 2, or is a fragment thereof, or has a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto, and the second RNA molecule comprises the nucleotide sequence according to SEQ ID NO: 2, or is a fragment thereof, or has a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto; IDNO: 3, or a fragment thereof, or a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g., at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto.

[0704] In a preferred embodiment, the levels of the following RNA molecules are determined in a blood sample from a patient:

[0705] the level of RNA molecules comprising the nucleotide sequence according to SEQ ID NO: 2, a fragment thereof or a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto,

[0706] The level of RNA molecules comprising the nucleotide sequence according to SEQ ID NO: 3, a fragment thereof or a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto, and

[0707] The level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 1, SEQ ID NO: 4 to SEQ ID NO: 79, including fragments thereof, and an RNA molecule comprising a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto.

[0708] In an alternative more preferred embodiment,

[0709] (i) determining the level of an RNA molecule comprising the nucleotide sequence according to SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:7, SEQ ID NO:11, SEQ ID NO:14, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:21, SEQ ID NO:28, SEQ ID NO:56, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, and SEQ ID NO:79 in a blood sample from a patient, and

[0710] (ii) using / taking into account the level of said RNA molecule in a mathematical calculation to obtain values ​​z1 to z4 according to the following formula:

[0711] z1=f(-0.639*x2+-0.479*x3+-0.243*x7+-0.264*x11+0.094*x14+0.252*x17+-0.271*x18+0.391*x21+0.530*x28+-0.215*x56+-0 .189*x72+-0.313*x73+0.000*x74+0.196*x75+0.181*x76+-0.075*x77+-0.071*x78+0.000*x79+-1.823), f(x)=1 / (1+exp(-x)))),

[0712] wherein x2, x3, x7, x11, x14, x17, x18, x21, x28, x56, x72, x73, x74, x75, x76, x77, x78, x79 are the log2-RPM expression values ​​of SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 11, SEQ ID NO: 14, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 21, SEQ ID NO: 28, SEQ ID NO: 56, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 77, SEQ ID NO: 78, and SEQ ID NO: 79, respectively, and RPM stands for reads per million;

[0713] z2=f(0.142*x2+0.272*x3+-0.207*x7+0.000*x11+-0.143*x14+-0.134*x17+0.008*x18+-0.075*x21+0.124*x28+-0.023*x56+0.2 87*x72+0.085*x73+-0.448*x74+0.000*x75+-0.000*x76+0.076*x77+-0.126*x78+-0.017*x79+-0.712), f(x)=1 / (1+exp(-x)))),

[0714] wherein x2, x3, x7, x11, x14, x17, x18, x21, x28, x56, x72, x73, x74, x75, x76, x77, x78, x79 are the log2-RPM expression values ​​of SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 11, SEQ ID NO: 14, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 21, SEQ ID NO: 28, SEQ ID NO: 56, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 77, SEQ ID NO: 78, and SEQ ID NO: 79, respectively, and RPM stands for reads per million;

[0715] z3=f(-0.306*x2+-0.088*x3+1.368*x7+0.095*x11+-0.294*x14+0.140*x17+0.182*x18+0.002*x21+-0.099*x28+0.085*x56+0. 229*x72+-0.216*x73+0.064*x74+-0.527*x75+0.066*x76+0.038*x77+0.002*x78+-0.053*x79+1.186), f(x)=1 / (1+exp(-x)))),

[0716] wherein x2, x3, x7, x11, x14, x17, x18, x21, x28, x56, x72, x73, x74, x75, x76, x77, x78, x79 is the log2-RPM expression of SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:7, SEQ ID NO:11, SEQ ID NO:14, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:21, SEQ ID NO:28, SEQ ID NO:56, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, and SEQ ID NO:79, respectively, and RPM stands for reads per million;

[0717] z4=f(0.803*x2-0.287*x3+-0.587*x7+0.029*x11+0.344*x14+-0.257*x17+0.000*x18+-0.287*x21+-0.553*x28+0.154 *x56+-0.327*x72+0.442*x73+0.059*x74+0.009*x75+-0.257*x76+-0.045*x77+0.457*x78+0.131*x79+1.350), f(x)=1 / (1+exp(-x)))),

[0718] wherein x2, x3, x7, x11, x14, x17, x18, x21, x28, x56, x72, x73, x74, x75, x76, x77, x78, x79 are the log2-RPM expression values ​​of SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 11, SEQ ID NO: 14, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 21, SEQ ID NO: 28, SEQ ID NO: 56, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 77, SEQ ID NO: 78, and SEQ ID NO: 79, respectively, and RPM stands for reads per million,

[0719] in

[0720] z1>z2 and z1>z3 and z1>z4 indicate that the patient is healthy (does not suffer from any type of lung cancer, particularly lung adenocarcinoma (LUAD), lung squamous cell carcinoma (LUSC) or lung squamous cell carcinoma or (SCLC),

[0721] z2>z1 and z2>z3 and z2>z4 indicate that the patient has lung adenocarcinoma (LUAD),

[0722] z3>z1 and z3>z2 and z3>z4 indicates that the patient has lung squamous cell carcinoma (LUSC), or z4>z1 and z4>z2 and z4>z3 indicates that the patient has small cell lung cancer (SCLC).

[0723] If any two values ​​of z1, z2, z3, z4 are exactly equal, the test is undefined.

[0724] As for other embodiments, reference is made to the first aspect of the invention.

[0725] Various modifications and variations of the present invention without departing from the scope of the present invention will be apparent to those skilled in the art. Although the present invention has been described in conjunction with specific preferred embodiments, it should be understood that the claimed invention should not be overly limited to these specific embodiments. In fact, the present invention is intended to cover various modifications of the described modes for carrying out the present invention that are apparent to those skilled in the relevant art. BRIEF DESCRIPTION OF THE DRAWINGS

[0726] The following drawings are merely illustrative of the present invention and should not be interpreted in any way to limit the scope of the present invention as indicated by the appended claims.

[0727] Figure 1 : shows the ROC curve quantiles of the RNA molecule having the nucleotide sequence of SEQ ID NO: 1 in 100 model training repetitions. AUC (median): 0.777.

[0728] Figure 2 : shows the ROC curve quantiles of 100 repetitions of RNA molecules having the nucleotide sequences of SEQ ID NO: 1 and SEQ ID NO: 2. AUC (median): 0.807.

[0729] Figure 3 : shows the ROC curves of 100 model training repetitions for RNA molecules having the nucleotide sequences of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 19, SEQ ID NO: 35, and SEQ ID NO: 39, and SEQ ID NO: 48. AUC (median): 0.841.

[0730] Figure 4 : shows the ROC curves of 100 model training repetitions for RNA molecules having the nucleotide sequences of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 23, SEQ ID NO: 39 and SEQ ID NO: 48. AUC (median): 0.848.

[0731] Figure 5 : shows the ROC curves of 100 model training repetitions for RNA molecules having the nucleotide sequences of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 7 and SEQ ID NO: 9. AUC (median): 0.821.

[0732] Figure 6 : shows the ROC curves of 100 model training repetitions for RNA molecules having the nucleotide sequences of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 11, and SEQ ID NO: 18. AUC (median): 0.844.

[0733] Figure 7 : Shows the ROC curve of 100 model training repetitions for RNA molecules having nucleotide sequences of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 19, SEQ ID NO: 35, and SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 43, SEQ ID NO: 48, and SEQ ID NO: 49. AUC (median): 0.841.

[0734] Figure 8 : Shows the ROC curve quantiles of 100 model training repetitions for RNA molecule pairs having nucleotide sequences of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 17, SEQ ID NO: 23, and SEQ ID NO: 35, SEQ ID NO: 39, SEQ ID NO: 45, SEQ ID NO: 48, SEQ ID NO: 52, and SEQ ID NO: 53. AUC (median): 0.857.

[0735] Fig. 9: Shows the ROC curve quantiles of 100 model training repetitions for RNA molecules having nucleotide sequences of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 19, SEQ ID NO: 25, SEQ ID NO: 29, SEQ ID NO: 30, and SEQ ID NO: 38. AUC (median): 0.839.

[0736] Fig.10 : Shows the ROC curve quantiles of 100 model training repetitions for RNA molecules having nucleotide sequences of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 18, and SEQ ID NO: 28. AUC (median): 0.871.

[0737] Fig.11 : shows the ROC curve quantiles of 100 repetitions of RNA molecules having the nucleotide sequences of SEQ ID NO: 1 to SEQ ID NO: 54. AUC (median): 0.880.

[0738] Fig.12: Shown are SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 21, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:26, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:31, SEQ ID NO:34, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID ROC curve quantiles of 100 replicates of RNA molecules with nucleotide sequences of SEQ ID NO: 69, SEQ ID NO: 70 and SEQ ID NO: 71. AUC (median): 0.866.

[0739] Fig.13 : Shows the comparison of the features of 54 RNA molecules of healthy (control) subjects and patients known to have lung cancer. The average model weights, log2 fold changes (DESeq2) and corrected p-values ​​(DESeq2) from 100 training repetitions are indicated. "0" represents an asymptotically small value that is close to zero.

[0740] Fig.14 : Shows the comparison of the features of 38 RNA molecules of healthy (control) subjects and patients known to have lung cancer. The average model weights, log2 fold changes (DESeq2) and corrected p-values ​​(DESeq2) from 100 training repetitions are indicated. "0" represents a value that asymptotically approaches zero.

[0741] Fig.15: Shown are the comparative results of the features of 18 RNA molecules of healthy (control) subjects and patients known to have lung cancer. Two groups of non-overlapping patients were used, the discovery cohort (498 controls and 445 cancers) and the validation cohort (155 controls and 286 cancers). The logistic regression model was trained on the discovery cohort, and the ROC curve and AUC were measured on the validation cohort.

[0742] Fig.16 : Comparison of the signatures of 6 RNA molecules (Mitra samples) from healthy (control) subjects and patients known to have lung cancer is shown. The groups of 21 controls and 19 cancers were randomly split into 100 sets of 30 training samples and 10 test samples, and separate logistic regression models were trained on all splits. The model with the median AUC on the test set was used here. Please note that the blood samples in this specific case were obtained from peripheral blood by finger puncture, not venous blood collected in PAXgene.

[0743] Fig.17 : ROC curve showing the performance of a model using two RNAs, an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 2 and an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 3, which are part of the miLung18 signature (trained on a large patient discovery cohort), for predicting cases vs. controls in an independent held-out validation cohort. AUC is 0.774.

[0744] Fig.18 : ROC curve showing the performance of the miLung18 model (trained on a large patient discovery cohort) for predicting cases vs. controls in an independent validation cohort. AUC is 0.832.

[0745] Fig.19 : POC curve showing the performance of the miLung6 model in 100-fold cross-validation splits of 20 controls and 20 cancer patients, blood was obtained using the Mitra finger-prick device. The median AUC was 0.735.

[0746] Fig. 20: ROC curves showing the performance of different miLung18 models trained to predict control and three major subtypes of lung cancer (NSCLC adenocarcinoma (LUAD), NSCLC squamous cell carcinoma (LUSC), SCLC) to predict. Each curve corresponds to a different one-vs-rest comparison. The AUC for Control-vs-rest is 0.83, the AUC for NSCLC_Adeno-vs-rest is 0.74, the AUC for NSCLC_Squamous-vs-rest is 0.87, and the AUC for SCLC-vs-rest is 0.92. The model was trained on the discovery cohort, and the metrics for the independent validation cohort are shown.

[0747] Fig.21 : Scores of the miLung18 model calculated on a validation cohort that was not used for training. Separate bar graphs for controls and different tumor stages and different lung cancer subtypes are shown. Scores below 0.5 indicate that the patient is predicted to not have lung cancer, while scores above 0.5 indicate a lung cancer prediction.

[0748] Fig. 22 : Model weights of the lung cancer subtype prediction model based on miLung18 RNS signature. The performance of the model is shown in Fig. 20 shown.

[0749] Example

[0750] The following examples are given for illustrative purposes only and are not intended to limit the invention described above in any way.

[0751] Example 1

[0752] Material

[0753] Patients with or without lung cancer (all possible lung cancer types) from three Hummingbird sponsored studies (Boston (NCT03452514), Lungenklinik Grosshansdorf (DRKS00018784), Ruhrlandklinik Essen (DRKS00020137)) were included. Briefly, blood was collected in PAXgene Blood RNA tubes according to the manufacturer's instructions and stored at -20°C after inversion 10x, and then at -80°C for long-term storage.

[0754] method

[0755] RNA from PAXgene samples was extracted using the QIAsymphony PAXgene Blood RNA Kit on a QIAsymphony SP liquid handling station. The eluted RNA was aliquoted and stored at -80°C. 100 ng of total RNA was used for small RNA library preparation. The size and uniformity of PCR library products after 18 amplification cycles were evaluated, and the concentration of PCR products was determined. NGS libraries were measured on an Illumina NextSeq 200 instrument. Small noncoding RNAs were measured from next-generation sequencing data, measuring the relative abundance (expression) of a large number of RNAs. Small subsets of RNAs that can be used to detect lung cancer were identified.

[0756] First, the FastQ files provided by Illumina NextSeq 2000 from replicate measurements of the same multiplex pool (sample batches sequenced simultaneously using dual calibration) were aggregated into a single FastQ file for each pool. These were then UMI-corrected (to remove PCR artifacts) and converted into a raw read count matrix, adding the UMI-corrected read counts of small RNAX. Finally, the RNA expression was provided as follows:

[0757]

[0758] It is log2 transformed, 1 shifted, library size M j Normalized reads per million (RPM) cX ij / M j , for each RNA i and patient sample j, c = 1e6.

[0759] ROC curves were used to quantify the ability of the logistic regression model (with optimized L1 regularization) to distinguish cancer patients from non-cancer patients (controls) based on RNA expression.

[0760] Figures 1 to 12 A summary of 100 ROC curves is shown, each obtained from a separate training and test set of patient samples. A separate logistic regression model was trained on each training set, and ROC statistics were obtained on the test set. The summary AUC metric is given in each figure to indicate the expected AUC value and its variability for 100 replicates.

[0761] All features were normalized by subtracting the mean and dividing by the standard deviation of the training samples.

[0762] The RNA molecule having the nucleotide sequence according to SEQ ID NO: 1 has a median AUC value of 0.77 and is therefore of high diagnostic relevance for lung cancer detection in patients. The ROC curve of this RNA molecule is Figure 1Shown.

[0763] Additionally, the following RNA molecular features with high diagnostic relevance were calculated:

[0764] (i) SEQ ID NO: 1 and SEQ ID NO: 2;

[0765] (ii) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 19, SEQ ID NO: 35 and SEQ ID NO: 39 and SEQ ID NO: 48;

[0766] (iii) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 23, SEQ ID NO: 39 and SEQ ID NO: 48;

[0767] (iv) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 7 and SEQ ID NO: 9;

[0768] (v) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 7, and SEQ ID NO: 11, and SEQ ID NO: 18;

[0769] (vi) SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:19, SEQ ID NO:35 and SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:43, SEQ ID NO:48 and SEQ ID NO:49;

[0770] (vii) SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:17, SEQ ID NO:23 and SEQ ID NO:35, SEQ ID NO:39, SEQ ID NO:45, SEQ ID NO:48, SEQ ID NO:52 and SEQ ID NO:53;

[0771] (viii) SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:19, SEQ ID NO:25, SEQ ID NO:29, SEQ ID NO:30 and SEQ ID NO:38;

[0772] (ix) SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:18 and SEQ ID NO:28;

[0773] (x) SEQ ID NO: 1 to SEQ ID NO: 54; and

[0774] (xi) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 21, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:26, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:31, SEQ ID NO:34, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQID NO:69, SEQ ID NO:70 and SEQ ID NO:71.

[0775] The ROC curves of the above RNA molecular features are Figures 2 to 12 The combination of RNA molecules (RNA features) can achieve an AUC value > 0.8.

[0776] Comparison of the signatures of 54 RNA molecules between healthy (control) subjects and patients known to have lung cancer, including corrected p-values ​​(DESeq2), log2 fold changes (DESeq2) for individual RNA molecules, and average model weights from 100 training replicates, are shown in Fig.13 middle.

[0777] Comparison of the signatures of 38 RNA molecules between healthy (control) subjects and patients known to have lung cancer, including corrected p-values ​​(DESeq2), log2 fold changes (DESeq2) for individual RNA molecules, and average model weights from 100 training replicates, are shown in Fig.14 middle.

[0778] It is expected that all subsets of the maximum feature (including the minimum feature) have performance between the minimum and maximum features, ie, all of these subsets can also be used for the detection of lung cancer.

[0779] In order to allow classification of patients as those with lung cancer or those without lung cancer (ie healthy), the following formulas were calculated for the different features (with corrected median weights):

[0780] (i) SEQ ID NO: 1 and SEQ ID NO: 2:

[0781] z=f(0.95*x1+0.71*x2+-5.71), f(x)=1 / (1+exp(-x)))),

[0782] Wherein, x1 and x2 are the normalized log2-RPM expression values ​​of SEQ ID NO: 1 and SEQ ID NO: 2, and

[0783] RPM stands for reads per million;

[0784] (ii) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 19, SEQ ID NO: 35, SEQ ID NO: 39 and SEQ ID NO: 48:

[0785] z=f(0.94*x1+0.86*x2+-0.07*x19+-0.33*x35+-0.15*x39+-0.33*x48+-3.86), f(x)=1 / (1+exp(-x)))),

[0786] wherein x1, x2, x19, x35, x39 and x48 are the normalized log2-RPM expression values ​​of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 19, SEQ ID NO: 35, SEQ ID NO: 39 and SEQ ID NO: 48, respectively, and

[0787] RPM stands for reads per million;

[0788] (iii) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 23, SEQ ID NO: 39 and

[0789] SEQ ID NO: 48:

[0790] z=f(0.44*x1+0.83*x2+0.45*x23+-0.07*x39+-0.25*x48+-4.34), f(x)=1 / (1+exp(-x)))),

[0791] wherein x1, x2, x23, x39 and x48 are the normalized log2-RPM expression values ​​of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 23, SEQ ID NO: 39 and SEQ ID NO: 48, respectively, and

[0792] RPM stands for reads per million;

[0793] (iv) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 7 and SEQ ID NO: 9:

[0794] z=f(0.84*x1+0.60*x2+0.85*x6+0.23*x7+0.30*x9+-6.44), f(x)=1 / (1+exp(-x)))),

[0795] wherein x1, x2, x6, x7 and x9 are the normalized log2-RPM expression levels of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 7 and SEQ ID NO: 9, respectively, and

[0796] RPM stands for reads per million.

[0797] (v) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 7 and SEQ ID NO: 11 and SEQ ID NO: 18:

[0798] z=f(0.19*x1+0.62*x2+0.87*x6+0.32*x7+0.40*x11+0.65*x18+-6.12), f(x)=1 / (1+exp(-x)))),

[0799] wherein x1, x2, x6, x7, x11 and x18 are the normalized log2-RPM expression values ​​of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 11 and SEQ ID NO: 18, respectively, and

[0800] RPM stands for reads per million;

[0801] (vi) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 19, SEQ ID NO: 35, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 43, SEQ ID NO: 48 and SEQ ID NO: 49:

[0802] z=f(0.93*x1+0.83*x2+-0.09*x19+-0.33*x35+-0.11*x38+-0.13*x39+-0. 12*x40+0.17*x43+-0.29*x48+0.10*x49+-4.41), f(x)=1 / (1+exp(-x)))),

[0803] wherein x1, x2, x19, x35, x38, x39, x40, x43, x48 and x49 are the normalized log2-RPM expression values ​​of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 19, SEQ ID NO: 35, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 43, SEQ ID NO: 48 and SEQ ID NO: 49, respectively, and

[0804] RPM stands for reads per million;

[0805] (vii) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 17, SEQ ID NO: 23, SEQ ID NO: 35, SEQ ID NO: 39, SEQ ID NO: 45, SEQ ID NO: 48, SEQ ID NO: 52 and SEQ ID NO: 53:

[0806] z=f(0.52*x1+0.93*x2+-0.22*x17+0.43*x23+-0.22*x35+-0.08*x39+-0.0 6*x45+-0.22*x48+-0.32*x52+0.02*x53+-1.32), f(x)=1 / (1+exp(-x)))),

[0807] wherein x1, x2, x17, x23, x35, x39, x45, x48, x52 and x53 are the normalized log2-RPM expression values ​​of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 17, SEQ ID NO: 23, SEQ ID NO: 35, SEQ ID NO: 39, SEQ ID NO: 45, SEQ ID NO: 48, SEQ ID NO: 52 and SEQ ID NO: 53, respectively, and

[0808] RPM stands for reads per million;

[0809] (viii) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 19, SEQ ID NO: 25, SEQ ID NO: 29, SEQ ID NO: 30 and SEQ ID NO: 38:

[0810] z=f(0.83*x1+0.77*x2+0.69*x6+0.31*x7+0.34*x9+-0.03*x19+-0.58* x25+-0.33*x29+-0.28*x30+-0.19*x38+3.17), f(x)=1 / (1+exp(-x)))),

[0811] wherein x1, x2, x6, x7, x9, x19, x25, x29, x30 and x38 are the normalized log2-RPM expression values ​​of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 19, SEQ ID NO: 25, SEQ ID NO: 29, SEQ ID NO: 30 and SEQ ID NO: 38, respectively, and

[0812] RPM stands for reads per million;

[0813] (ix) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 18 and SEQ ID NO: 28:

[0814] z=f(0.24*x1+0.74*x2+0.19*x3+0.68*x6+0.36*x7+0.26*x11+0.26*x12+-0.42*x14+0.66*x18+-0.94*x28+4.76), f(x)=1 / (1+exp(-x)))),

[0815] wherein x1, x2, x3, x6, x7, x11, x12, x14, x18 and x28 are the normalized log2-RPM expression values ​​of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 18 and SEQ ID NO: 28, respectively, and

[0816] RPM stands for reads per million;

[0817] (x) SEQ ID NO: 1 to SEQ ID NO: 54:

[0818] z=f(0.45*x1+0.83*x2+0.74*x3+0.50*x4+-0.48*x5+0.74*x6+0.48*x7+0.55* x8+0.64*x9+-0.72*x10+0.39*x11+0.25*x12+0.35*x13+-0.34*x14+-0.43*x15 +-0.40*x16+-0.34*x17+0.14*x18+-0.32*x19+-0.52*x20+-0.28*x21+-0.32* x22+-0.28*x23+0.20*x24+-0.33*x25+-0.24*x26+0.26*x27+0.44*x28+-0.11* x29+-0.12*x30+-0.10*x31+0.25*x32+-0.26*x33+0.16*x34+-0.15*x35+-0.2 4*x36+0.10*x37+-0.11*x38+-0.08*x39+0.08*x40+0.05*x41+-0.10*x42+0.06 *x43+0.06*x44+0.12*x45+-0.06*x46+0.10*x47+-0.02*x48+0.01*x49+-0.04* x50+0.02*x51+0.01*x52+0.04*x53+0.05*x54+0.21), f(x)=1 / (1+exp(-x)))),

[0819] wherein x1 to x54 are each the normalized log2-RPM expression values ​​of SEQ ID NO: 1 to SEQ ID NO: 54, and

[0820] RPM stands for reads per million;

[0821] (xi)SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 34, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 70, and SEQ ID NO: 71:

[0822] z = f(0.05*x1 + 0.83*x2 + 0.27*x3 + 0.89*x6 + 0.35*x7 + 0.29*x8 + -0.56*x10 + 0.14*x11 + 0.13*x12 + -0.16*x14 + -0.21*x16 + -0.29*x17 + 0.37*x18 + -0.21*x21 + -0.26*x22 + -0.15*x24 + -0.26*x26 + -0.74*x28 + -0.17*x29 + -0.17*x31 + 0.17*x34 + 0.16*x55 + 0.18*x56 + 0.19*x57 + 0.08*x58 + 0.27*x59 + 0.39*x60 + 0.50*x61 + 0.24*x62 + -0.10*x63 + -0.19*x64 + -0.12*x65 + -0.54*x66 + -0.07*x67 + -0.20*x68 + -0.25*x69 + 0.81*x70 + -0.19*x71 + 0.33), f(x) = 1 / (1 + exp(-x))),

[0823] Among them, x1, x2, x3, x6, x7, x8, x10, x11, x12, x14, x16, x17, x18, x21, x22, x24, x26, x28, x29, x31, x34, x55 to x71 are respectively SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 34, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70 and SEQ ID NO:71, and the normalized log2-RPM expression values ​​of

[0824] RPM stands for reads per million.

[0825] In all the above cases, the cutoff score (y) was calculated to be 0.5, where z>0.5 obtained from the patient indicates that the patient has lung cancer and z<0.5 obtained from the patient indicates that the patient is healthy (does not have lung cancer).

[0826] Example 2

[0827] Material

[0828] Patients with or without lung cancer (all possible lung cancer types) from three Hummingbird sponsored studies (Boston (NCT03452514), Lungenklinik Grosshansdorf (DRKS00018784), Ruhrlandklinik Essen (DRKS00020137)) were included. Briefly, blood was collected in PAXgene Blood RNA tubes according to the manufacturer's instructions and stored at -20°C after inversion 10x, and then at -80°C for long-term storage.

[0829] method

[0830] RNA was extracted from PAXgene samples and sequenced as described above.

[0831] The discovery cohort consisted of 498 control patients (cancer-free) and 445 lung cancer patients from the Boston, Essen, and Grosshansdorf sites. The validation cohort consisted of 155 controls and 286 lung cancer patients from the Boston, Kempten, Konstanz, and Heidelberg sites.

[0832] A logistic regression model consisting of the listed RNA molecules was trained on the discovery cohort to predict lung cancer vs. no lung cancer. The input data were the log2-RPM expression values ​​of these small RNA molecules.

[0833] Effect sizes are given as Cohen's d as an alternative to DEseq2 fold change to indicate the difference and directionality of expression between controls and cancer, where positive values ​​of d indicate an increase in cancer.

[0834] The following RNA molecular features with high diagnostic relevance were calculated (2): SEQ ID NO: 2 and SEQ ID NO: 3:

[0835] Regarding data, see Fig.15 The ROC curve of this feature is Fig.17 As shown in . AUC value > 0.75, i.e. 0.774, can be achieved.

[0836] In order to enable classification of patients as those with lung cancer or those without lung cancer (ie healthy), the following formula for the (2) feature is calculated (with corrected median weights):

[0837] z=f(0.800*x2+1.342*x3+-8.733),f(x)=1 / (1+exp(-x)))),

[0838] Wherein, x2 and x3 are the log2-RPM expression values ​​of SEQ ID NO: 2 and SEQ ID NO: 3, respectively, and RPM stands for reads per million.

[0839] In addition, the following RNA molecular features with high diagnostic relevance were calculated (18):

[0840] SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 11, SEQ ID NO: 14, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 21, SEQ ID NO: 28, SEQ ID NO: 56, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78 and SEQ ID NO:79.

[0841] Regarding data, see Fig.15 The ROC curve of this feature is Fig.18 As shown in . AUC value > 0.8, i.e. 0.832, can be achieved.

[0842] In order to enable classification of patients as those with lung cancer or those without lung cancer (ie healthy), the following formula for the (18) feature is calculated (with corrected median weights):

[0843] SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 11, SEQ ID NO: 14, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 21, SEQ ID NO: 28, SEQ ID NO: 56, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78 and SEQ ID NO:79:

[0844] z=f(0.792*x2+0.54*x3+0.521*x7+0.26*x11+-0.284*x14+-0.306*x17+0.399*x18+-0.429*x21+-0.693*x28+0.295*x56+0.45 2*x72+0.38*x73+-0.3*x74+-0.297*x75+-0.219*x76+0.157*x77+0.0658*x78+-0.0421*x79+5.203), f(x)=1 / (1+exp(-x)))),

[0845] wherein x2, x3, x7, x11, x14, x17, x18, x21, x28, x56, x72, x73, x74, x75, x76, x77, x78, x79 are each the log2-RPM expression value of SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:7, SEQ ID NO:11, SEQ ID NO:14, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:21, SEQ ID NO:28, SEQ ID NO:56, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, and

[0846] RPM stands for reads per million.

[0847] Example 3

[0848] Materials & Methods

[0849] Prick a clean, sterilized finger with a knife. Press a drop of blood from the finger. Discard the first drop. Apply 2x microsamplers directly to the blood drop without touching the skin until they absorb 10 μL each. Then cover with a lid and store the Mitra microsampler at room temperature. For RNA extraction, transfer the Mitra cellulose to a 2 mL Eppendorf tube and add 1 mL QIAzol (QIAgen, Venlo, The Netherlands). Incubate the sample at room temperature for 15 min while shaking at 1000 rpm. Next, the sample is centrifuged at 12,000xg for 5 min at room temperature and the cellulose is removed. 200 μL of chloroform is added and the sample is pulse-vortexed for 15 s. After incubation at RT for 2 min, the sample is centrifuged at 12,000xg for 15 min at 4°C. The upper aqueous phase containing RNA is mixed with 1.5 volumes of 100% ethanol and further combined with MinElute spin columns (QIAgen) using the miRNeasy serum and plasma kit (QIAgen) according to the manufacturer's instructions. RNA was eluted using 28 μL of nuclease-free water and stored at -80°C. 5-50 ng of total RNA was used for small RNA library preparation as described in Rajakumar et al., 2022 and sequenced on an Illumina NextSeq2000 system.

[0850] DBS data analysis

[0851] Based on the log2-RPM expression values ​​measured by NGS of small RNAs in 21 controls and 19 cancer patients, 100 logistic regression models were trained, each on a different random 30 samples, while the ROC curve and AUC performance on the remaining 10 samples were calculated. A representative model with the median AUC was selected.

[0852] The following RNA molecular features with high diagnostic relevance were calculated (6):

[0853] SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 17, SEQ ID NO: 18 and SEQ ID NO: 75.

[0854] Regarding data, see Fig.16 The ROC curve of this feature is Fig.19 As shown in . AUC value > 0.7, i.e. 0.735, can be achieved.

[0855] In order to enable classification of patients as those with lung cancer or those without lung cancer (ie healthy), the following formula for the (6) feature is calculated (with corrected median weights):

[0856] SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 17, SEQ ID NO: 18 and SEQ ID NO: 75:

[0857] z*f(19.621*x2+0.638*x3+1.171*x7+-0.492*x17+-2.400*x18+1.049*x75+3.185), f(x)=1 / (1+exp(-x)))),

[0858] Wherein, x2, x3, x7, x17, x18, x75 are the log2-RPM expression values ​​of SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 75, respectively, and RPM stands for reads per million.

[0859] Informal Sequence Listing

[0860] An RNA molecule having the following sequence was identified as a suitable biomarker for diagnosing and monitoring lung cancer in patients:

[0861] 1.UUCACAGUGGCUAAGUUCUGC (SEQ ID NO: 1)

[0862] 2.GCCGCCGGUGAAAUACCACUAC (SEQ ID NO: 2)

[0863] 3.AUUGCACGGUAUUCCAUCUG (SEQ ID NO: 3)

[0864] 4.CUCCCACUGCUUCACUUGACUAGCC (SEQ ID NO: 4)

[0865] 5.UUCUCACUACUGCACUUGACUAGUC (SEQ ID NO: 5)

[0866] 6.UCCUUCAUUCCACCGGAGU (SEQ ID NO: 6)

[0867] 7.UCCUUCAUUCCACCGGAGUCU (SEQ ID NO: 7)

[0868] 8.CAGUGCAAUGUUAAAAGGGC (SEQ ID NO: 8)

[0869] 9.SEQ ID NO:9)

[0870] 10.UGUAAACAUCCCCGACUGGAAGCA(SEQ ID NO:10)

[0871] 11.WATCH RETAIN(SEQ ID NO:11)

[0872] 12.UCUUGCGACCCGGGUUCCUUCCCGGGCGGCCCACCA(SEQ ID NO:12)

[0873] 13.UGAUUAAGUCCCUGCCCUUGUACACACCCCC(SEQ ID NO:1 3)

[0874] 14.CGGGCCGCCGGUGAAAUACCACUA(SEQ ID NO:14)

[0875] 15.UAGCACCAUCUGAAAUCGGU(SEQ TD NO:15)

[0876] 16.UCGAAAACCGGGCAGAAGCACCA(SEQ ID NO:1 6)

[0877] 17.SEQ ID NO:17)

[0878] 18.CAGUGCAAUGUUAAAAGGG(SEQ ID NO:1 8)

[0879] 19.UAGCAGCGGAACQUAKG(SEQ ID NO:19)

[0880] 20.ADD ADDRESS(SEQ ID NO:20)

[0881] 21.GGUCAAUGAUGUGUUGGCA(SEQ ID NO:21)

[0882] 22.UACUUCCAGGAACGGUGCACC(SEQ ID NO:22)

[0883] 23.SEQ ID NO:23)

[0884] 24.UGGCUCAGUUCAGCAGGAACAGUA(SEQ ID NO:24)

[0885] 25.UCCCCCAGGUGUGUAUUCUGAUU(SEQ ID NO:25)

[0886] 26.AUUGGGGAGUGAGAGGGAGAGAACGCGGUCUGAGUGGU(SEQ ID No:26)

[0887] 27.AAGAACUGCUAACUCAUGCCCCCAUGUA(SEQ ID NO: 27)

[0888] 28.UGUAAACAUCCCCGACUGGAAG(SEQ ID NO: 28)

[0889] 29.ACGCCCCUUCCCCCCUUCU(SEQ ID NO: 29)

[0890] 30.UCGAUUCCCGGCCCAUGCACCA(SEQ ID NO:30)

[0891] 31. GAUAUAUACGCCAGUACCGCC(SEQ ID NO:31)

[0892] 32.GUCCAUAACAAAGCGGAGG(SEQ ID NO:32)

[0893] 33.GCCGGGUACUUUCGUAUUU(SEQ ID NO:33)

[0894] 34.AGAAGGUUGCGUGUUCAGGUCACGUCGGGGUCACCA(SEQ ID NO:34)

[0895] 35.UCUCCAAUGGAGGCGUGGGUUU (SEQ ID NO: 35)

[0896] 36.CAUAAAGUAGAAAGCACUACUA(SEQ ID NO: 36)

[0897] 37.GAGACCGCCUGGGAAUACCGGGUG(SEQ ID NO:37)

[0898] 38.UUUCGAUGGUAGUCGCCGUGCC(SEQ ID NO:38)

[0899] 39.CAGCCCUCGACACAAGGGUUUG(SEQ ID NO:39)

[0900] 40.UGCGCGUCCCCCGAAGAGG(SEQ ID NO: 40)

[0901] 41.UGGGUUUACCUUGGGAGAACU(SEQ ID NO:41)

[0902] 42.CAUUCUGAAAACGUGUGGAAAACUAUGACUGAGCA(SEQ ID NO:42)

[0903] 43.CACCCGGCUGUGUGCACAUGUGC(SEQ ID NO:43)

[0904] 44.GUUUCCGUAGUGUAGUGGUUAUCACGUUCGC(SEQ ID NO:44)

[0905] 45.AAGCUGCCAGUUGAAGAACUGU(SEQ ID NO:45)

[0906] 46. ​​GGAGGUAGUAGGUUGUAUAGUU(SEQ ID NO:46)

[0907] 47.AAAAGCUGGGUUGAGAGGGCGAG (SEQ ID NO: 47)

[0908] 48.GCCGCCGGUGAAAUACCACUACU(SEQ ID NO:48)

[0909] 49.UCGAAUCCGAGUCACGGCA(SEQ ID NO:49)

[0910] 50.CUUCUCACUACUGCACUUGACUAGUCUUA(SEQ ID NO:50)

[0911] 51.UGGAGUGUGACAAUGGUGUUU(SEQ ID NO:51)

[0912] 52.GAUUCCCGGCCAAUGCACC(SEQ ID NO:52)

[0913] 53.GGGAGAGAAAGGCAGUUCCUG(SEQ ID NO:53)

[0914] 54.UUUGGCAAUGGUAGAACUC(SEQ ID NO:54)

[0915] 55.CAGCAGCACACACUGUGGUUUGUA(SEQ ID NO:55)

[0916] 56.AAAUAAGCUAUCGGGCCCAUACCCCG(SEQ ID NO:56)

[0917] 57.AUUGGUCGUGGUUGUAGUCCGUGCGAGAAUACCA(SEQ ID NO:57)

[0918] 58.CAAUCCUAAGCCAAAAGAACAA(SEQ ID NO:58)

[0919] 59.UGAGCAUGUAGACAAAGGUAACACUGAAG(SEQ ID NO:59)

[0920] 60.UGGCUCAGUUCAGCAGGAAC(SEQ ID NO:60)

[0921] 61.GUCCAAUAAAAACAAAGCGGAGG(SEQ ID NO:61)

[0922] 62.UCCGCCCCCCGGCCCCGCGUCCUC(SEQ ID NO: 62)

[0923] 63.UCUCACACGGAAAUCGCACCCGU(SEQ ID NO:63)

[0924] 64.UAAUGCCCCUAAAAAUCCUU(SEQ ID NO: 64)

[0925] 65.UAAUCCUUGCUACCUGGUGAGAG(SEQ ID NO:65)

[0926] 66.GUUCUACAGUCCGACAAU(SEQ ID NO:66)

[0927] 67. CGGUGCGCCGCGACCGGCUCCGGGACGGCUG(SEQ ID NO:67)

[0928] 68.UCUCACACAGAAUCGCACCCGU(SEQ ID NO:68)

[0929] 69.UAGCAGCGGGAACAGUUCUGAA(SEQ ID NO:69)

[0930] 70.UGUAAACAUCCCCGACUGGAAGCU(SEQ ID NO:70)

[0931] 71.AGGGGCAGAGGCGAGACUUU(SEQ ID NO:71)

[0932] 72.GUUCACUGAGAGAGCAUUGUUCUGAGCCCA(SEQ ID NO:72)

[0933] 73.UCAUUGGUCGUGGUUGUAGUCCCGUGCGAGAAUACCA(SEQ ID NO:73)

[0934] 74.AUGCACCUGGGCAAGGAUUCUG(SEQ ID NO:74)

[0935] 75.AUCCCACUCCUGACACCUUU(SEQ ID NO:75)

[0936] 76.GGCCGCCGGUGAAAUACCACUACU(SEQ ID NO:76)

[0937] 77.GUCAGUUUGUCAAAUACCC(SEQ ID NO:77)

[0938] 78.UAGCACCAUUUGAAAUCG(SEQ ID NO:78)

[0939] 79.UUCAAAUCCCGGACGAGCCCA(SEQ ID NO:79)

Claims

1. A method for diagnosing lung cancer in a patient, the method comprising the steps of: (i) determining the level of at least one RNA molecule in a blood sample from a patient, wherein the at least one RNA molecule comprises a nucleotide sequence according to SEQ ID NO: 1, is a fragment thereof, or has a sequence having at least 80% sequence identity thereto; (ii) determining the levels of at least two RNA molecules in a blood sample from the patient, wherein the at least two RNA molecules include a first RNA molecule and a second RNA molecule, wherein the first RNA molecule comprises the nucleotide sequence according to SEQ ID NO: 1, a fragment thereof, or a sequence having at least 80% sequence identity thereto, and the second RNA molecule comprises the nucleotide sequence according to SEQ ID NO: 2, a fragment thereof, or a sequence having at least 80% sequence identity thereto; or (iii) determining the levels of at least two RNA molecules in a blood sample from the patient, wherein the at least two RNA molecules include a first RNA molecule and a second RNA molecule, Wherein, the first RNA molecule comprises a nucleotide sequence according to SEQ ID NO:2, a fragment thereof, or a sequence having at least 80% sequence identity thereto, and the second RNA molecule comprises a nucleotide sequence according to SEQ ID NO:3, a fragment thereof, or a sequence having at least 80% sequence identity thereto.

2. The method according to claim 1(i), in, determining the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 2 to SEQ ID NO: 71, an RNA molecule comprising a fragment thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto; or wherein the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO:2 to SEQ ID NO:79, an RNA molecule comprising a fragment thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity therewith is determined.

3. The method according to claim 1(ii), wherein: The first RNA molecule comprises a nucleotide sequence according to SEQ ID NO:1, and the second RNA molecule comprises a nucleotide sequence according to SEQ ID NO:

2.

4. The method according to claim 1(ii) or claim 3, in, determining the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 3 to SEQ ID NO: 71, an RNA molecule comprising a fragment thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto; or wherein the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO:3 to SEQ ID NO:79, an RNA molecule comprising a fragment thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity therewith is determined.

5. The method according to claim 4, wherein (i) determining the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 19, SEQ ID NO: 35, SEQ ID NO: 39, SEQ ID NO: 48, an RNA molecule comprising a fragment thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto; (ii) determining the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO:23, SEQ ID NO:39, SEQ ID NO:48, an RNA molecule comprising a fragment thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto; (iii) determining the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:9, an RNA molecule comprising a fragment thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto; (iv) determining the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:11, SEQ ID NO:18, an RNA molecule comprising a fragment thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto; (v) determining the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 19, SEQ ID NO: 35, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 43, SEQ ID NO: 48, SEQ ID NO: 49, an RNA molecule comprising a fragment thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto; (vi) determining the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 17, SEQ ID NO: 23, SEQ ID NO: 35, SEQ ID NO: 39, SEQ ID NO: 45, SEQ ID NO: 48, SEQ ID NO: 52, SEQ ID NO: 53, an RNA molecule comprising a fragment thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto; (vii) determining the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:19, SEQ ID NO:25, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:38, an RNA molecule comprising a fragment thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto; (viii) determining the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO:3, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:18, SEQ ID NO:28, an RNA molecule comprising a fragment thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto; (ix) determining the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 3 to SEQ ID NO: 54, an RNA molecule comprising a fragment thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto; or (x) determining the level of at least one additional RNA molecule selected from the group consisting of the following RNA molecules: comprising determining the level of at least one additional RNA molecule selected from the group consisting of SEQ ID NO:3, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:26, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:31, SEQ ID NO:34, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, RNA molecules having the nucleotide sequence of SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:71, RNA molecules including fragments thereof, and RNA molecules including sequences having at least 80% sequence identity therewith.

6. The method according to claim 4 or claim 5, wherein: Determining the level of an RNA molecule comprises a nucleotide sequence according to: (i) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 19, SEQ ID NO: 35, SEQ ID NO: 39 and SEQ ID NO: 48; (ii) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 23, SEQ ID NO: 39 and SEQ ID NO: 48; (iii) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 7 and SEQ ID NO: 9; (iv) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 11 and SEQ ID NO: 18; (v) SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:19, SEQ ID NO:35, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:43, SEQ ID NO:48 and SEQ ID NO:49; (vi) SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:17, SEQ ID NO:23, SEQ ID NO:35, SEQ ID NO:39, SEQ ID NO:45, SEQ ID NO:48, SEQ ID NO:52 and SEQ ID NO:53; (vii) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 19, SEQ ID NO: 25, SEQ ID NO: 29, SEQ ID NO: 30 and SEQ ID NO: 38; (viii) SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:18 and SEQ ID NO:28; (ix) SEQ ID NO: 1 to SEQ ID NO: 54; or (x) SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:26, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:31, SEQ ID NO:34, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70 and SEQ ID NO:

71.

7. The method according to claim 1(iii), wherein: The first RNA molecule comprises a nucleotide sequence according to SEQ ID NO:2, and the second RNA molecule comprises a nucleotide sequence according to SEQ ID NO:

3.

8. The method according to claim 1(iii) or claim 7, wherein: Determine the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 1, SEQ ID NO: 4 to SEQ ID NO: 79, an RNA molecule comprising a fragment thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto.

9. The method according to claim 8, wherein (i) determining the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO:7, SEQ ID NO:11, SEQ ID NO:14, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:21, SEQ ID NO:28, SEQ ID NO:56, SEQ ID NO:72 to SEQ ID NO:79, an RNA molecule comprising fragments thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto; or (ii) determining the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO:7, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:75, an RNA molecule comprising a fragment thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto.

10. The method according to claim 8 or claim 9, wherein: Determining the level of an RNA molecule comprises a nucleotide sequence according to: (i) SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 11, SEQ ID NO: 14, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 21, SEQ ID NO: 28, SEQ ID NO: 56, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, and SEQ ID NO:79; or (ii) SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:7, SEQ ID NO:17, SEQ ID NO:18 and SEQ ID NO:

75.

11. The method according to any one of claims 1 to 10, wherein comparing the level of the at least one RNA molecule to a reference level of the RNA molecule; or The levels of the at least two RNA molecules are compared to a reference level of the RNA molecules.

12. The method according to claim 11, wherein The reference level is the level of the at least one RNA molecule determined empirically by measuring a plurality of reference blood samples from known healthy subjects (those not suffering from lung cancer); or The reference level is the level of the at least two RNA molecules determined empirically by measuring a plurality of reference blood samples from subjects known to be healthy (not suffering from lung cancer).

13. The method according to claim 12, wherein A level of an RNA molecule selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 15, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 49, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65 NO:69, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:77 and / or SEQ ID NO:78; and / or A level of an RNA molecule selected from the group consisting of SEQ ID NO:4, SEQ ID NO:10, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:35, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:42, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:52, SEQ ID NO:61, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, SEQ ID NO:80, SEQ ID NO:81, SEQ ID NO:82, SEQ ID NO:83, SEQ ID NO:84 NO:76 and / or SEQ ID NO:

79.

14. The method according to any one of claims 11 to 13, wherein The reference level is the level of the at least one RNA molecule determined empirically by measuring a plurality of reference blood samples from subjects known to have lung cancer; or The reference level is the level of the at least two RNA molecules determined empirically by measuring a plurality of reference blood samples from subjects known to have lung cancer.

15. The method according to claim 14, wherein A level of an RNA molecule selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 15, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 49, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65 NO:62, SEQ ID NO:69, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:77 and / or SEQ ID NO:78; and / or A level of an RNA molecule selected from the group consisting of SEQ ID NO:4, SEQ ID NO:10, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:35, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:42, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:52, SEQ ID NO:61, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:74, SEQ ID NO:75 NO:75, SEQ ID NO:76 and / or SEQ ID NO:

79.

16. The method according to any one of claims 1 to 15, wherein using the level of the at least one RNA molecule in a mathematical calculation to obtain a numerical value; or The levels of the at least two RNA molecules are used in mathematical calculations to obtain a numerical value.

17. The method according to claim 16, wherein: The numerical value is obtained by summing the weighted levels of the at least two RNA molecules.

18. The method according to claim 16 or claim 17, wherein: The values ​​were compared to an empirically determined cut-off score.

19. The method according to claim 18, wherein: The cut-off score enables classification of patients as having lung cancer or being healthy (not having lung cancer).

20. A method for monitoring a patient suspected of having lung cancer or a patient suffering from lung cancer, the method comprising the following steps: (i) determining the level of at least one RNA molecule in a blood sample from a patient, wherein the at least one RNA molecule comprises a nucleotide sequence according to SEQ ID NO: 1, is a fragment thereof, or has a sequence having at least 80% sequence identity thereto; (ii) determining the levels of at least two RNA molecules in a blood sample from the patient, wherein the at least two RNA molecules include a first RNA molecule and a second RNA molecule, wherein the first RNA molecule comprises the nucleotide sequence according to SEQ ID NO: 1, a fragment thereof, or a sequence having at least 80% sequence identity thereto, and the second RNA molecule comprises the nucleotide sequence according to SEQ ID NO: 2, a fragment thereof, or a sequence having at least 80% sequence identity thereto; or (iii) determining the levels of at least two RNA molecules in a blood sample from the patient, wherein the at least two RNA molecules include a first RNA molecule and a second RNA molecule, Wherein, the first RNA molecule comprises a nucleotide sequence according to SEQ ID NO:2, a fragment thereof, or a sequence having at least 80% sequence identity thereto, and the second RNA molecule comprises a nucleotide sequence according to SEQ ID NO:3, a fragment thereof, or a sequence having at least 80% sequence identity thereto.

21. The method according to claim 20(i) in, determining the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 2 to SEQ ID NO: 71, an RNA molecule comprising a fragment thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto; or wherein the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO:2 to SEQ ID NO:79, an RNA molecule comprising a fragment thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity therewith is determined.

22. The method of claim 20(ii), wherein: The first RNA molecule comprises a nucleotide sequence according to SEQ ID NO:1, and the second RNA molecule comprises a nucleotide sequence according to SEQ ID NO:

2.

23. The method of claim 20(ii) or claim 22, wherein in, determining the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 3 to SEQ ID NO: 71, an RNA molecule comprising a fragment thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto; or wherein the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO:3 to SEQ ID NO:79, an RNA molecule comprising a fragment thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity therewith is determined.

24. The method according to claim 23, wherein (i) determining the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 19, SEQ ID NO: 35, SEQ ID NO: 39, SEQ ID NO: 48, an RNA molecule comprising a fragment thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto; (ii) determining the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO:23, SEQ ID NO:39, SEQ ID NO:48, an RNA molecule comprising a fragment thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto; (iii) determining the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:9, an RNA molecule comprising a fragment thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto; (iv) determining the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:11, SEQ ID NO:18, an RNA molecule comprising a fragment thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto; (v) determining the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 19, SEQ ID NO: 35, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 43, SEQ ID NO: 48, SEQ ID NO: 49, an RNA molecule comprising a fragment thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto; (vi) determining the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 17, SEQ ID NO: 23, SEQ ID NO: 35, SEQ ID NO: 39, SEQ ID NO: 45, SEQ ID NO: 48, SEQ ID NO: 52, SEQ ID NO: 53, an RNA molecule comprising a fragment thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto; (vii) determining the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:19, SEQ ID NO:25, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:38, an RNA molecule comprising a fragment thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto; (viii) determining the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO:3, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:18, SEQ ID NO:28, an RNA molecule comprising a fragment thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto; (ix) determining the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 3 to SEQ ID NO: 54, an RNA molecule comprising a fragment thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto; or (x) determining the level of at least one additional RNA molecule selected from the group consisting of the following RNA molecules: comprising determining the level of at least one additional RNA molecule selected from the group consisting of SEQ ID NO:3, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:26, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:31, SEQ ID NO:34, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, RNA molecules having the nucleotide sequence of SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:71, RNA molecules including fragments thereof, and RNA molecules including sequences having at least 80% sequence identity therewith.

25. A method according to claim 23 or claim 24, wherein: Determining the level of an RNA molecule comprises a nucleotide sequence according to: (i) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 19, SEQ ID NO: 35, SEQ ID NO: 39 and SEQ ID NO: 48; (ii) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 23, SEQ ID NO: 39 and SEQ ID NO: 48; (iii) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 7 and SEQ ID NO: 9; (iv) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 11 and SEQ ID NO: 18; (v) SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:19, SEQ ID NO:35, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:43, SEQ ID NO:48 and SEQ ID NO:49; (vi) SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:17, SEQ ID NO:23, SEQ ID NO:35, SEQ ID NO:39, SEQ ID NO:45, SEQ ID NO:48, SEQ ID NO:52 and SEQ ID NO:53; (vii) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 19, SEQ ID NO: 25, SEQ ID NO: 29, SEQ ID NO: 30 and SEQ ID NO: 38; (viii) SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:18 and SEQ ID NO:28; (ix) SEQ ID NO: 1 to SEQ ID NO: 54; or (x) SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:26, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:31, SEQ ID NO:34, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70 and SEQ ID NO:

71.

26. The method of claim 20(iii), wherein: The first RNA molecule comprises a nucleotide sequence according to SEQ ID NO:2, and the second RNA molecule comprises a nucleotide sequence according to SEQ ID NO:

3.

27. The method of claim 20(iii) or claim 26, wherein: Determine the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 1, SEQ ID NO: 4 to SEQ ID NO: 79, an RNA molecule comprising a fragment thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto.

28. The method of claim 27, wherein (i) determining the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO:7, SEQ ID NO:11, SEQ ID NO:14, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:21, SEQ ID NO:28, SEQ ID NO:56, SEQ ID NO:72 to SEQ ID NO:79, an RNA molecule comprising fragments thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto; or (ii) determining the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO:7, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:75, an RNA molecule comprising a fragment thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto.

29. A method according to claim 27 or claim 28, wherein: Determining the level of an RNA molecule comprises a nucleotide sequence according to: (i) SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 11, SEQ ID NO: 14, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 21, SEQ ID NO: 28, SEQ ID NO: 56, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, and SEQ ID NO:79; or (ii) SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:7, SEQ ID NO:17, SEQ ID NO:18 and SEQ ID NO:

75.

30. The method according to any one of claims 20 to 29, wherein comparing the level of the at least one RNA molecule to a reference level of the RNA molecule; or The levels of the at least two RNA molecules are compared to a reference level of the RNA molecules.

31. The method of claim 30, wherein The reference level is the level of the RNA molecule determined empirically by measuring a plurality of reference blood samples from known healthy subjects or subjects known to have lung cancer; or The reference level is the level of the at least two RNA molecules determined empirically by measuring a plurality of reference blood samples from known healthy subjects or subjects known to have lung cancer.

32. The method according to any one of claims 20 to 31, wherein The monitoring comprises determining the level of the at least one RNA molecule in a blood sample obtained from the patient at a first time point and the level of the at least one RNA molecule in at least one additional blood sample obtained from the (same) patient at a later time point, and comparing the levels determined at the different time points; or The monitoring comprises determining the levels of the at least two RNA molecules in a blood sample obtained from the patient at a first time point and the levels of the at least two RNA molecules in at least one additional blood sample obtained from the (same) patient at a later time point, and comparing the levels determined at the different time points.

33. The method according to any one of claims 1 to 32, wherein: The lung cancer is small cell lung cancer (SCLC) or non-small cell lung cancer (NSCLC), preferably lung adenocarcinoma (LUAD) or lung squamous cell carcinoma (LUSC).

34. The method according to any one of claims 1 to 33, wherein: The blood sample is whole blood or a blood fraction.

35. The method of claim 34, wherein: The blood fraction is selected from the group consisting of a blood cell fraction, plasma and serum.

36. The method of claim 35, wherein: The blood cell fraction is a fraction of red blood cells, white blood cells and / or platelets.

37. The method according to any one of claims 1 to 36, wherein: The levels are determined by sequencing, preferably next generation sequencing, nucleic acid hybridization, nucleic acid amplification, polymerase extension, mass spectrometry, or any combination thereof.

38. The method according to any one of claims 1 to 37, wherein: The patient is a mammal, preferably a human.

39. RNA molecules are used for the following purposes: (i) use of at least one RNA molecule for diagnosing lung cancer in a patient, or for monitoring a patient suspected of having lung cancer or a patient suffering from lung cancer, in, The at least one RNA molecule comprises a nucleotide sequence according to SEQ ID NO: 1, a fragment thereof, or a sequence having at least 80% sequence identity thereto; (ii) use of at least two RNA molecules for diagnosing lung cancer in a patient, or for monitoring a patient suspected of having lung cancer or a patient suffering from lung cancer, wherein the at least two RNA molecules comprise a first RNA molecule and a second RNA molecule, wherein the first RNA molecule comprises the nucleotide sequence according to SEQ ID NO: 1, a fragment thereof, or a sequence having at least 80% sequence identity thereto, and the second RNA molecule comprises the nucleotide sequence according to SEQ ID NO: 2, a fragment thereof, or a sequence having at least 80% sequence identity thereto; or (iii) use of at least two RNA molecules for diagnosing lung cancer in a patient, or for monitoring a patient suspected of having lung cancer or a patient suffering from lung cancer, wherein the at least two RNA molecules comprise a first RNA molecule and a second RNA molecule, Wherein, the first RNA molecule comprises a nucleotide sequence according to SEQ ID NO:2, a fragment thereof, or a sequence having at least 80% sequence identity thereto, and the second RNA molecule comprises a nucleotide sequence according to SEQ ID NO:3, a fragment thereof, or a sequence having at least 80% sequence identity thereto.

40. The use according to claim 39(i), in, at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 2 to SEQ ID NO: 71, an RNA molecule comprising a fragment thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto for diagnosing or monitoring lung cancer in said patient; or Wherein, at least one additional RNA molecule selected from the group consisting of the following RNA molecules is used to diagnose or monitor lung cancer in the patient: an RNA molecule comprising a nucleotide sequence according to SEQ ID NO:2 to SEQ ID NO:79, an RNA molecule comprising a fragment thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity therewith.

41. The use according to claim 39(ii), wherein The first RNA molecule comprises a nucleotide sequence according to SEQ ID NO:1, and the second RNA molecule comprises a nucleotide sequence according to SEQ ID NO:

2.

42. The use according to claim 39(ii) or claim 41, in, at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 3 to SEQ ID NO: 71, an RNA molecule comprising a fragment thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto for diagnosing or monitoring lung cancer in said patient; or Wherein, at least one additional RNA molecule selected from the group consisting of the following RNA molecules is used to diagnose or monitor lung cancer in the patient: an RNA molecule comprising a nucleotide sequence according to SEQ ID NO:3 to SEQ ID NO:79, an RNA molecule comprising a fragment thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity therewith.

43. The use according to claim 42, wherein (i) using at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 19, SEQ ID NO: 35, SEQ ID NO: 39, SEQ ID NO: 48, an RNA molecule comprising a fragment thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto for diagnosing or monitoring lung cancer in said patient; (ii) using at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO:23, SEQ ID NO:39, SEQ ID NO:48, an RNA molecule comprising a fragment thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto for diagnosing or monitoring lung cancer in said patient; (iii) using at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:9, an RNA molecule comprising a fragment thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto for diagnosing or monitoring lung cancer in said patient; (iv) using at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:11, SEQ ID NO:18, an RNA molecule comprising a fragment thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto for diagnosing or monitoring lung cancer in said patient; (v) using at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 19, SEQ ID NO: 35, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 43, SEQ ID NO: 48, SEQ ID NO: 49, an RNA molecule comprising a fragment thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto for diagnosing or monitoring lung cancer in said patient; (vi) using at least one additional RNA molecule selected from the group consisting of the following RNA molecules for diagnosing or monitoring lung cancer in the patient: an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 17, SEQ ID NO: 23, SEQ ID NO: 35, SEQ ID NO: 39, SEQ ID NO: 45, SEQ ID NO: 48, SEQ ID NO: 52, SEQ ID NO: 53, an RNA molecule comprising a fragment thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto; (vii) using at least one additional RNA molecule selected from the group consisting of the following RNA molecules for diagnosing or monitoring lung cancer in the patient: an RNA molecule comprising a nucleotide sequence according to SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:19, SEQ ID NO:25, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:38, an RNA molecule comprising fragments thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto; (viii) using at least one additional RNA molecule selected from the group consisting of the following RNA molecules for diagnosing or monitoring lung cancer in the patient: an RNA molecule comprising a nucleotide sequence according to SEQ ID NO:3, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:18, SEQ ID NO:28, an RNA molecule comprising a fragment thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto; (ix) using at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 3 to SEQ ID NO: 54, an RNA molecule comprising a fragment thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto for diagnosing or monitoring lung cancer in said patient; or (x) using at least one additional RNA molecule selected from the group consisting of the following RNA molecules for diagnosing or monitoring lung cancer in the patient: comprising the RNA molecules according to SEQ ID NO:3, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:26, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:31, SEQ ID NO:34, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68 RNA molecules having the nucleotide sequence of SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:71, RNA molecules including fragments thereof, and RNA molecules including sequences having at least 80% sequence identity therewith.

44. The use according to claim 42 or claim 43, wherein An RNA molecule comprising a nucleotide sequence according to: (i) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 19, SEQ ID NO: 35, SEQ ID NO: 39 and SEQ ID NO: 48; (ii) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 23, SEQ ID NO: 39 and SEQ ID NO: 48; (iii) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 7 and SEQ ID NO: 9; (iv) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 11 and SEQ ID NO: 18; (v) SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:19, SEQ ID NO:35, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:43, SEQ ID NO:48 and SEQ ID NO:49; (vi) SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:17, SEQ ID NO:23, SEQ ID NO:35, SEQ ID NO:39, SEQ ID NO:45, SEQ ID NO:48, SEQ ID NO:52 and SEQ ID NO:53; (vii) SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:19, SEQ ID NO:25, SEQ ID NO:29, SEQ ID NO:30 and SEQ ID NO:38; (viii) SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:18 and SEQ ID NO:28; (ix) SEQ ID NO:1 to SEQ ID NO:54; or (x) SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:26, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:31, SEQ ID NO:34, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70 and SEQ ID NO:

71.

45. The use according to claim 39(iii), wherein The first RNA molecule comprises a nucleotide sequence according to SEQ ID NO:2, and the second RNA molecule comprises a nucleotide sequence according to SEQ ID NO:

3.

46. ​​The use according to claim 39(iii) or claim 45, wherein At least one additional RNA molecule selected from the group consisting of the following RNA molecules is used for diagnosing or monitoring lung cancer in the patient: an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 1, SEQ ID NO: 4 to SEQ ID NO: 79, an RNA molecule comprising a fragment thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity therewith.

47. The use according to claim 46, wherein (i) using at least one additional RNA molecule selected from the group consisting of the following RNA molecules for diagnosing or monitoring lung cancer in the patient: an RNA molecule comprising a nucleotide sequence according to SEQ ID NO:7, SEQ ID NO:11, SEQ ID NO:14, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:21, SEQ ID NO:28, SEQ ID NO:56, SEQ ID NO:72 to SEQ ID NO:79, an RNA molecule comprising fragments thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto; or (ii) using at least one additional RNA molecule selected from the group consisting of the following RNA molecules for diagnosing or monitoring lung cancer in the patient: an RNA molecule comprising a nucleotide sequence according to SEQ ID NO:7, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:75, an RNA molecule comprising a fragment thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto.

48. The use according to claim 46 or claim 47, wherein An RNA molecule comprising a nucleotide sequence according to: (i) SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 11, SEQ ID NO: 14, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 21, SEQ ID NO: 28, SEQ ID NO: 56, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, and SEQ ID NO:79; or (ii) SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:7, SEQ ID NO:17, SEQ ID NO:18 and SEQ ID NO:

75.

49. A kit for diagnosing lung cancer in a patient, or for monitoring a patient suspected of having lung cancer or a patient suffering from lung cancer, the kit comprising: (i) means for determining the level of at least one RNA molecule in a blood sample from a patient, in, The at least one RNA molecule comprises a nucleotide sequence according to SEQ ID NO: 1, a fragment thereof, or a sequence having at least 80% sequence identity thereto; (ii) means for determining the levels of at least two RNA molecules in a blood sample from a patient, wherein the at least two RNA molecules comprise a first RNA molecule and a second RNA molecule, wherein the first RNA molecule comprises the nucleotide sequence according to SEQ ID NO: 1, a fragment thereof, or a sequence having at least 80% sequence identity thereto, and the second RNA molecule comprises the nucleotide sequence according to SEQ ID NO: 2, a fragment thereof, or a sequence having at least 80% sequence identity thereto; or (iii) a means for determining the levels of at least two RNA molecules in a blood sample from a patient, wherein the at least two RNA molecules comprise a first RNA molecule and a second RNA molecule, Wherein, the first RNA molecule comprises a nucleotide sequence according to SEQ ID NO:2, a fragment thereof, or a sequence having at least 80% sequence identity thereto, and the second RNA molecule comprises a nucleotide sequence according to SEQ ID NO:3, a fragment thereof, or a sequence having at least 80% sequence identity thereto.

50. The kit of claim 49(i), wherein The kit comprises means for determining the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 2 to SEQ ID NO: 71, an RNA molecule comprising a fragment thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto; or The kit comprises means for determining the level of at least one additional RNA molecule selected from the group consisting of: an RNA molecule comprising a nucleotide sequence according to SEQ ID NO:2 to SEQ ID NO:79, an RNA molecule comprising a fragment thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity therewith.

51. The kit according to claim 49(ii), wherein The first RNA molecule comprises a nucleotide sequence according to SEQ ID NO:1, and the second RNA molecule comprises a nucleotide sequence according to SEQ ID NO:

2.

52. A kit according to claim 49(ii) or claim 51, wherein The kit comprises means for determining the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 3 to SEQ ID NO: 71, an RNA molecule comprising a fragment thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto; or The kit comprises means for determining the level of at least one additional RNA molecule selected from the group consisting of: RNA molecules comprising nucleotide sequences according to SEQ ID NO:3 to SEQ ID NO:79, RNA molecules comprising fragments thereof, and RNA molecules comprising sequences having at least 80% sequence identity thereto, for use in diagnosing or monitoring lung cancer in the patient.

53. The kit according to claim 52, wherein The kit includes means for determining the levels of the following RNA molecules: (i) at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 19, SEQ ID NO: 35, SEQ ID NO: 39, SEQ ID NO: 48, an RNA molecule comprising a fragment thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto; (ii) at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 23, SEQ ID NO: 39, SEQ ID NO: 48, an RNA molecule comprising a fragment thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto; (iii) at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 9, an RNA molecule comprising a fragment thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto; (iv) at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 11, SEQ ID NO: 18, an RNA molecule comprising a fragment thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto; (v) at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 19, SEQ ID NO: 35, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 43, SEQ ID NO: 48, SEQ ID NO: 49, an RNA molecule comprising fragments thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto; (vi) at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 17, SEQ ID NO: 23, SEQ ID NO: 35, SEQ ID NO: 39, SEQ ID NO: 45, SEQ ID NO: 48, SEQ ID NO: 52, SEQ ID NO: 53, an RNA molecule comprising a fragment thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto; (vii) at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:19, SEQ ID NO:25, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:38, an RNA molecule comprising fragments thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto; (viii) at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO:3, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:18, SEQ ID NO:28, an RNA molecule comprising a fragment thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto; (ix) at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 3 to SEQ ID NO: 54, an RNA molecule comprising a fragment thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto; or (x) at least one additional RNA molecule selected from the group consisting of the following RNA molecules: comprising the RNA molecules according to SEQ ID NO:3, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:26, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:31, SEQ ID NO:34, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, RNA molecules having the nucleotide sequence of SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:71, RNA molecules including fragments thereof, and RNA molecules including sequences having at least 80% sequence identity therewith.

54. The kit according to claim 52 or claim 53, wherein The kit comprises means for determining the level of an RNA molecule comprising a nucleotide sequence according to: (i) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 19, SEQ ID NO: 35, SEQ ID NO: 39 and SEQ ID NO: 48; (ii) SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:23, SEQ ID NO:39 and SEQ ID NO:48; (iii) SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:6, SEQ ID NO:7 and SEQ ID NO:9; (iv) SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:11 and SEQ ID NO:18; (v) SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:19, SEQ ID NO:35, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:43, SEQ ID NO:48 and SEQ ID NO:49; (vi) SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:17, SEQ ID NO:23, SEQ ID NO:35, SEQ ID NO:39, SEQ ID NO:45, SEQ ID NO:48, SEQ ID NO:52 and SEQ ID NO:53; (vii) SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:19, SEQ ID NO:25, SEQ ID NO:29, SEQ ID NO:30 and SEQ ID NO:38; (viii) SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:18 and SEQ ID NO:28; (ix) SEQ ID NO:1 to SEQ ID NO:54; or (x) SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:26, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:31, SEQ ID NO:34, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70 and SEQ ID NO:

71.

55. The kit according to claim 49(iii), wherein The first RNA molecule comprises a nucleotide sequence according to SEQ ID NO:2, and the second RNA molecule comprises a nucleotide sequence according to SEQ ID NO:

3.

56. The kit of claim 49(iii) or claim 55, wherein The kit comprises means for determining the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 1, SEQ ID NO: 4 to SEQ ID NO: 79, an RNA molecule comprising fragments thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity therewith.

57. The kit according to claim 56, wherein The kit includes means for determining the levels of the following RNA molecules: (i) at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO:7, SEQ ID NO:11, SEQ ID NO:14, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:21, SEQ ID NO:28, SEQ ID NO:56, SEQ ID NO:72 to SEQ ID NO:79, an RNA molecule comprising fragments thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto; or (ii) at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO:7, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:75, an RNA molecule comprising a fragment thereof, and an RNA molecule comprising a sequence having at least 80% sequence identity thereto.

58. The kit according to claim 56 or claim 57, wherein The kit comprises means for determining the level of an RNA molecule comprising a nucleotide sequence according to: (i) SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 11, SEQ ID NO: 14, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 21, SEQ ID NO: 28, SEQ ID NO: 56, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, and SEQ ID NO:79; or (ii) SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:7, SEQ ID NO:17, SEQ ID NO:18 and SEQ ID NO:

75.

59. The kit according to any one of claims 49 to 58, wherein The kit is used to perform the method according to any one of claims 1-38.

60. The kit according to any one of claims 49 to 58, wherein The kit further comprises instructions on how to carry out the method according to any one of claims 1-38.

Images