Method for constructing gene-free edited all-male fish based on kdm6bb gene knock-down technology

Abstract

The invention discloses a method for constructing gene-free edited all-male fish based on a kdm6bb gene knock-down technology, which comprises the following steps: carrying out knock-down treatment on a fish kdm6bb gene by utilizing a CRISPR / Cas9 gene editing technology, and carrying out genotype identification to obtain a kdm6bb heterozygote (kdm6bb + / -); a kdm6bb heterozygous mutant capable of effectively reducing kdm6bb protein expression is obtained through selfing of heterozygous fish; pseudo female fishes with XY sex genetic types are screened through sex molecular markers, the pseudo female fishes are mated with wild XY male fishes, YY sex genetic super-male fishes without kdm6bb mutation are screened, and the YY sex genetic super-male fishes are hybridized with wild XX female fishes, so that all-male fish groups without kdm6bb mutation are obtained, unisexual culture of fishes is realized, sex control breeding efficiency is improved, and breeding cost is reduced. The present invention is widely applicable to aquatic economic fishes on the basis of XX / XY sex determination.

Description

Technical Field

[0001] The present invention belongs to the technical field of fish breeding, and in particular relates to a method for constructing all-male fish without gene editing based on KDM6BB gene knockdown technology. Background Art

[0002] The diversity of sex determination mechanisms has formed an important paradox in the developmental biology of lower vertebrates. Sex-controlled breeding can be achieved through artificial intervention in the sex development process, so that the offspring can produce a group with the desired sex characteristics. Sex control of animals is of great significance in improving production and quality, and enhancing resistance to stress and disease. Unlike the sex determination mechanism of mammals that relies on the chromosomal sex determination system (CSD), fish sex determination has a high degree of plasticity, and many exogenous factors, such as temperature and hormones, can affect fish sex determination. Among many aquaculture species, many animals show obvious sexual dimorphism in growth, that is, the growth performance of one sex is significantly better than that of the other sex. For example, male tilapia grows significantly faster than females. The breeding of single-sex groups will bring obvious economic benefits.

[0003] Inducing sex reversal by sex hormone interference is the most common method for producing monosex populations. For example, patent document CN110583539B discloses a method for efficiently producing high-reproduction rate YY-transformed female fish of Nile tilapia, and CN117016488A discloses an inducer, induction method and application for sex reversal of XY genetic male fish of largemouth bass to XY pseudo-female fish. Both methods induce sex reversal in fish through hormone regulation, thereby obtaining monosex breeding populations. However, many adverse effects are also produced in the process of applying the above methods, such as hormone pollution, fish body residues, hormone-related substances inducing unstable sex development of parent fish, and inability to produce on a large scale and continuously. Therefore, it is particularly urgent to develop sex-controlled breeding methods such as sex reversal and monosex population construction based on endogenous gene editing methods. CN113789352B discloses a method and application for achieving sex-controlled breeding of XX / XY sex-genetically determined fish, including: (1) obtaining cyp17a1 homozygous fish through gene editing; (2) screening XX genetic type cyp17a1 - / - Homozygous fish, which appear physiologically male, are recorded as pseudo-male fish; (3) The genotype cyp17a1 + / + XX wild-type female fish and cyp17a1 - / - XX pseudo-male fish were artificially induced to spawn and inseminated, and all the genotypes obtained were cyp17a1 + / -The method can achieve sex-controlled breeding of fish and the cultivation of single-sex groups. However, the single-sex groups obtained by this method are all gene-edited offspring, and cannot be promoted in breeding and applied in breeding. In view of this, it is necessary to design a knockdown of key sex-inducing genes to achieve sex reversal of fish and the construction of single-sex groups to solve the above problems. Summary of the invention

[0004] The purpose of the present invention is to provide a method for constructing a non-gene-edited all-male fish based on the KDM6BB gene knockdown technology, using gene editing technology to obtain heterozygous fish edited by the histone demethylase KDM6BB, reducing the KDM6BB protein level, reducing the nuclear entry of KDM6BB, and hindering the expression of male development genes, thereby obtaining the genotype KDM6BB + / - XY pseudo-female fish; then the pseudo-female fish were mated with wild-type male fish to screen out the genotype kdm6bb + / + YY's supermale fish; then the supermale fish is hybridized with wild-type XX female fish to obtain all-male offspring without gene editing, realizing fish sex-controlled breeding and single-sex group farming.

[0005] In order to achieve the above-mentioned purpose of the present invention, the present invention adopts the following technical scheme:

[0006] The present invention provides a method for constructing a non-gene-edited all-male fish based on the KDM6BB knockdown technology, comprising the following steps:

[0007] S1: Knock down the kdm6bb gene in fish or reduce the expression level of kdm6bb protein in fish to obtain the genotype kdm6bb + / - kdm6bb heterozygous fish;

[0008] S2: The genotype is kdm6bb + / - The kdm6bb heterozygous fish were self-fertilized, and the kdm6bb heterozygous fish with genetic sex of XY were obtained through genotyping. Their physiological sex was female and marked as genotype kdm6bb. + / - XY pseudo-female fish;

[0009] S3: The genotype is kdm6bb + / - XY pseudo-female fish with genotype kdm6bb + / + XY wild-type male fish were mated and the genotype was kdm6bb + / + YY's super male fish;

[0010] S4: The genotype is kdm6bb + / + YY's super male fish has the genotype kdm6bb + / + The wild-type female fish of XX were mated, and the F3 generation obtained had the genotype of kdm6bb+ / + An all-male XY group.

[0011] Preferably, in step S1, gene editing technology is used to knock down the fish kdm6bb gene, including: using the CRISPR / Cas9 system to specifically cut the fish kdm6bb gene to achieve the knockdown of the fish kdm6bb gene, obtain kdm6bb heterozygous fish, block the fish histone demethylation reaction, and inhibit the expression of male development genes.

[0012] Preferably, in step S1, double-stranded small molecule RNA interference technology is used to reduce the expression level of fish kdm6bb protein to obtain genetic XY sex-reversed fish.

[0013] Preferably, in step S3, the genotype is kdm6bb + / + The method for screening super male fish of YY comprises: the genotype is kdm6bb + / - XY pseudo-female fish with genotype kdm6bb + / + XY wild-type male fish are mated, and super male fish with kdm6bb without gene editing and genetic sex of YY are obtained through genotyping.

[0014] Preferably, in step S4, the genotype is kdm6bb + / + The screening method of the XY all-male population includes: the genotype is kdm6bb + / + YY's super male fish has the genotype kdm6bb + / + XX wild-type female fish were mated, and an all-male group with no kdm6bb gene mutation and genetic sex of XY was obtained through genotyping.

[0015] Preferably, the pseudo-female fish is a female fish with a genetic sex of XY, a physiological sex of female and normal ovarian structure and mature egg development, and the genetic sex of the offspring XX, XY and YY is identified by means of sex molecular markers.

[0016] Preferably, the supermale fish is a male fish with genetic sex YY, physiological sex male and normal testicular structure and mature spermatogenesis, and the genetic sex of its offspring XX, XY and YY is identified by means of sex molecular markers.

[0017] Preferably, the fish is an economically cultured aquatic fish of male heterogametic type (XX / XY sex genetic determination type).

[0018] More preferably, the fish is Nile tilapia.

[0019] Compared with the prior art, the present invention has the following beneficial effects:

[0020] 1. The present invention provides a method for constructing a non-gene-edited all-male fish based on the kdm6bb knockdown technology, wherein the gene editing technology is used to knock out the key gene kdm6bb for fish sex development to obtain heterozygous fish, effectively reduce the expression level of kdm6bb protein, reduce the entry of kdm6bb into the cell nucleus, inhibit the expression of male development genes, and thus achieve fish sex reversal; the genetic type XY heterozygous pseudo-female fish is mated with the wild-type XY male fish, and since the kdm6bb gene is not located on the Y chromosome, during the hybridization gamete formation process between the XY pseudo-female fish and the wild-type XY male fish, the kdm6bb gene and the Y chromosome can be freely combined to form a kdm6bb non-gene-edited YY super-male fish, and the fish is mated with a wild-type female fish (kdm6bb + / + XX) hybridization, a 100% male population can be obtained (kdm6bb + / + XY), thereby achieving the effect of gender control and single-sex group breeding.

[0021] 2. The present invention applies gene editing technology to knockdown of fish sex induction genes to obtain sex-reversed fish, and hybridizes sex-reversed fish with wild-type male fish to obtain super male fish without gene editing, which are then hybridized with wild-type female fish to obtain all-male monosex groups, thereby significantly improving the aquaculture yield and quality of fish. This method uses gene knockout technology to obtain monosex aquaculture groups without gene mutations, which is suitable for aquaculture promotion and breeding applications.

[0022] 3. The present invention realizes sex control by endogenously interfering with the expression of sex-inducing genes, and has the advantages of being able to continuously obtain pseudo-female and super-male fish parents on a large scale, being simple to operate, and being able to realize large-scale continuous production. It does not involve the induction of exogenous hormones, and effectively avoids the technical problems of hormone pollution, residues, and hormone-related substances inducing unstable sex development of parents and inability to produce on a large scale brought about by traditional fish sex control breeding methods. At the same time, the method provided by the present invention has strong applicability, and has wide adaptability and expansibility in aquaculture economic fish, which greatly expands the scope of application of the method provided by the present invention in the field of sex control breeding of aquaculture economic fish. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 Schematic diagram of the method for constructing all-male fish without gene editing based on kdm6bb knockdown technology in the embodiment.

[0024] Figure 2 Schematic diagram of two target sites in exons 5 and 7 of the kdm6bb gene in the example (red indicates the gRNA sequence).

[0025] Figure 3 This is the electrophoresis diagram of the PCR product detected by the kdm6bb gene knockout individual in the embodiment. The three on the left are kdm6bb + / +Wild type, the middle three are KDM6BB + / - Heterozygous, the three on the right are kdm6bb - / - Homozygous.

[0026] Figure 4 This is the electrophoresis diagram for fish sex genotype identification in the example.

[0027] Figure 5 In the embodiment, 1 month old kdm6bb + / - Anatomy diagram and genotype identification diagram of XY pseudo-female fish.

[0028] Figure 6 In the embodiment, 1 month old kdm6bb + / + YY super male fish anatomical diagram and genotype identification diagram.

[0029] Figure 7 The anatomical diagram of a 3-month-old male fish and kdm6bb in the embodiment + / + XY genotyping chart. DETAILED DESCRIPTION

[0030] In order to make the purpose, technical solution and advantages of the embodiment of the present invention clearer, the technical solution of the embodiment of the present invention will be clearly and completely described in conjunction with the drawings of the embodiment of the present invention. Obviously, the described embodiment is a part of the embodiment of the present invention, not all of the embodiments. Based on the described embodiment of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work belong to the scope of protection of the present invention.

[0031] The following embodiment provides a method for constructing all-male fish without gene editing based on kdm6bb knockdown technology, constructing a kdm6bb heterozygous model by gene editing technology, and obtaining a pseudo-female fish of XY genotype; then mating the pseudo-female fish with a wild-type XY genetic sex male fish, screening for YY genetic sex super male fish without gene editing, and hybridizing them with XX wild-type female fish to obtain XY genetic sex all-male offspring, thereby realizing all-male controlled breeding of XX / XY sex genetically determined fish;

[0032] The specific method of knocking down the kdm6bb gene to obtain heterozygotes is: using CIRSPR / Cas9 gene editing technology to cut the histone demethylase kdm6bb gene to obtain heterozygous offspring, reducing the expression of kdm6bb protein, thereby inducing XY genetic fish to develop into pseudo-female fish.

[0033] In some embodiments, a method for constructing a non-gene-edited all-male fish based on the KDM6BB knockdown technology comprises the following steps:

[0034] S1, knocking down the kdm6bb gene in fish using gene editing technology to obtain kdm6bb heterozygous fish, whose genotype is kdm6bb + / - ;

[0035] S2, the kdm6bb heterozygous fish were self-fertilized and the genetic sex XY was obtained through genotyping. The kdm6bb heterozygous fish, whose physiological sex was female, were marked as kdm6bb + / - XY pseudo-female fish;

[0036] S3, the genotype is KDM6BB + / - XY pseudo-female fish with genotype kdm6bb + / + XY wild-type male fish were mated and the genotype was selected as kdm6bb + / + YY's super male fish;

[0037] S4, the genotype was kdm6bb + / + YY super male fish and kdm6bb + / + XX wild-type females were mated, and the F3 generation obtained were all of the genotype kdm6bb + / + XY all-male population, achieving sex-controlled breeding of fish and cultivation of single-sex populations;

[0038] Among them, the fish are kdm6bb-sensitive male heterogametic (XX / XY sex genetic determination type) aquatic economic farmed fish.

[0039] In some embodiments, in step S1, the specific process of obtaining kdm6bb heterozygous fish is:

[0040] S11, design sgRNA target site in the kdm6bb coding region, and synthesize sgRNA primers by in vitro transcription;

[0041] S12, at the I-cell stage of fish fertilized eggs, sgRNA and Cas9 mRNA are prepared into an injection mixture according to a predetermined ratio, and the fertilized eggs are co-injected;

[0042] S13, the injected fertilized eggs were placed in 28°C circulating water for incubation;

[0043] S14, the KDM6BB genotype of the injected offspring was identified using specific primers to obtain KDM6BB heterozygous fish.

[0044] In some embodiments, in step S2, kdm6bb is obtained + / - The specific process of XY pseudo-female fish is as follows:

[0045] S21, kdm6bb + / - Heterozygous fish were raised to sexual maturity, naturally mated and fertilized, and incubated and raised in circulating water at 28°C:

[0046] S22, using specific primer sequences to identify the kdm6bb genotype of the self-pollinated offspring, and using sex molecular marker primers to identify the genetic sex of the self-pollinated offspring, obtaining kdm6bb heterozygous individuals with genetic sex of XY and physiological sex of female, marked as kdm6bb + / - XY pseudo-female fish.

[0047] In some embodiments, in step S3, kdm6bb is obtained + / + The specific process of YY super male fish is:

[0048] S31, kdm6bb + / - XY pseudofemales were raised in circulating water at 28°C until sexual maturity;

[0049] S32, kdm6bb + / - XY pseudo-female fish and wild-type Kdm6bb + / + XY male fish mate and fertilize naturally, and hatch and raise in circulating water at 28℃:

[0050] S33, using specific primer sequences to identify the kdm6bb genotype of the offspring, using sex molecular marker primers to identify the genetic sex of the self-pollinated offspring, and obtaining super male fish with no kdm6bb mutation, genetic sex of YY, and physiological sex of male, marked as kdm6bb + / + YY super male fish.

[0051] In some embodiments, in step S4, kdm6bb is obtained + / + The specific process of the XY all-male population is as follows:

[0052] S41, kdm6bb + / + YY super male fish and wild type XX female fish mate naturally to lay eggs and fertilize them, and then hatch and raise them in circulating water at 28℃:

[0053] S42, use specific primer sequences to identify the kdm6bb genotype of the offspring, and use sex molecular marker primers to identify the genetic sex of the self-pollinated offspring, to obtain an all-male population with no kdm6bb mutation, genetic sex of XY, and physiological sex of male, to achieve sex-controlled breeding of fish and cultivation of single-sex populations.

[0054] In some embodiments, the pseudo-female fish has a genetic sex of XY, a physiological sex of female, and a female fish with normal ovarian structure and mature egg development; the super-male fish has a genetic sex of YY, a physiological sex of male, and a male fish with normal testicular structure and mature spermatogenesis. The screening process of pseudo-female fish and super-male fish is to identify the XX, XY and YY genetic sex of the offspring by means of sex molecular markers.

[0055] In some embodiments, the target of KDM6BB knockout is not limited to exons 7 and 9, and it is sufficient to effectively reduce the expression level of KDM6BB heterozygous protein.

[0056] In some embodiments, the water temperature for incubation and culture of fertilized eggs is 28° C. to avoid high temperature-induced sex reversal of fish.

[0057] In some embodiments, the fish is Nile tilapia.

[0058] Example 1

[0059] like Figure 1 As shown, this Example 1 provides a method for constructing a non-gene-edited all-male fish based on the KDM6BB knockdown technology, using Nile tilapia as the implementation object, including the following steps:

[0060] S1, knocking down the kdm6bb gene in fish using gene editing technology to obtain kdm6bb heterozygous fish, whose genotype is kdm6bb + / - , as follows:

[0061] S11, based on the fish kdm6bb gene sequence, the kdm6bb target sites were designed using the online tool http: / / crispor.tefor.net / . The first and second targets were located on exons 7 and 9, respectively. The target sequences are shown in Table 1 , and the target locations are shown in Figure 2 As shown:

[0062] Table 1: KDM6BB gene knockout target sequences

[0063] Primer name Primer sequence (5'-3') Tilapia_kdm6bb_gRNA1 GGGAACCGCGCCAGAGAGAT Tilapia_kdm6bb_gRNA2 GGCAGGAGGCCACCACATTA

[0064] S12, the concentrations of gRNA1 and gRNA2 in the injection mixture for kdm6bb gene editing were both 100 ng / μL; the concentration of Cas9 protein was 800 ng / μL; the microinjection volume of the gRNA and Cas9 protein mixture was 1 uL.

[0065] Table 2: Preparation ratio of gRNA and Cas9 protein injection mixture

[0066] sample Volume (μL) Tilapia_kdm6bb_gRNA1(500ng / μL) 2 Tilapia_kdm6bb_gRNA2(500ng / μL) 2 Cas9 protein (2000ng / μL) 4 water 2 total 10

[0067] S13, the injected fertilized eggs were placed in circulating water at 28°C for incubation and reared until sexual maturity to obtain the F0 generation.

[0068] S14, extract genomic DNA from different individuals by cutting tail fins, perform PCR amplification using fish kdm6bb specific primers in Table 3, and identify genotypes by agarose gel electrophoresis. + / + The wild-type individual PCR product has only one band of 554 bp, kdm6bb + / -The PCR product of the heterozygous individual has two bands of 554 bp and 371 bp, kdm6bb - / - The PCR product of homozygous individuals has only one band of 371 bp, such as Figure 3 As shown; Kdm6bb heterozygous fish were screened.

[0069] Table 3: Primers for detecting mutations in the target gene KDM6BB

[0070] Primer name Primer sequence (5'-3') Tilapia_kdm6bb_F GGAAGCCTCCAAGTGACAGG Tilapia_kdm6bb_R TTCTGAAGGTGATAAAGAGCAACA

[0071] S2. Self-pollinate the kdm6bb heterozygous fish and obtain the genetic sex XY through genotyping. + / - Heterozygous fish, whose biological sex is female, e.g. Figure 4 As shown; marked as kdm6bb + / - XY pseudo-female fish, as follows:

[0072] S21, kdm6bb + / - The heterozygous fish were naturally mated, spawned and fertilized, and incubated and raised in circulating water at 28°C until sexual maturity:

[0073] S22, extract the genomic DNA of the self-pollinated offspring obtained in S21, perform PCR amplification using the kdm6bb-specific primers in Table 3, identify the genotype by agarose gel electrophoresis, and screen out kdm6bb + / - Heterozygous fish.

[0074] S23, first observe sexual maturity kdm6bb + / - The secondary sexual characteristics of heterozygous fish are that the male has only one cloaca on the genital protuberance, while the female has two holes on the genital protuberance and a swollen abdomen. + / - Heterozygous female fish; then the fish sex molecular markers in Table 4 were used to identify kdm6bb + / - Heterozygous female fish were genetically sexed. XX individuals had only one band at the back, while XY individuals had two bands of different sizes, e.g. Figure 5 As shown. KDM6BB was screened out + / - Heterozygous, pseudo-female fish with genetic sex XY, labeled kdm6bb + / - XY pseudo-female fish.

[0075] Table 4: Primers for fish sex genotyping

[0076] Primer name Primer sequence (5'-3') Tilapia_sex_F TTCCTCAGGGATCTGTCCTTGGT Tilapia_sex_R CAGAAATGTAGACGCCCAGGTATC

[0077] S3, the genotype is KDM6BB + / - XY pseudo-female fish with genotype kdm6bb + / + XY wild-type males were mated and the genotype was screened to be kdm6bb+ / + YY super male fish, details are as follows:

[0078] S31, kdm6bb + / - XY pseudofemales were raised in circulating water at 28°C until sexual maturity;

[0079] S32, kdm6bb + / - XY pseudo-female fish and wild-type Kdm6bb + / + XY male fish mate and fertilize naturally, and hatch and raise in circulating water at 28℃:

[0080] S33, using the fish kdm6bb specific primers in Table 3 to identify the kdm6bb genotype of different individuals, using the fish sex molecular marker primers in Table 4 to identify the genetic sex of the self-pollinated offspring, and obtaining super male fish with no kdm6bb mutation, genetic sex of YY, and physiological sex of male. The genotype identification results are as follows Figure 6 As shown, marked as kdm6bb + / + YY super male fish.

[0081] S4, the genotype was kdm6bb + / + YY super male fish and kdm6bb + / + XX wild-type females were mated, and the F3 generation obtained were all of the genotype kdm6bb + / + XY all-male population, to achieve fish sex-controlled breeding and single-sex population culture, as follows:

[0082] S41, kdm6bb screened in step S33 + / + YY super male fish and wild type XX female fish mate naturally to lay eggs and fertilize them, and then hatch and raise them in circulating water at 28℃:

[0083] S42, using the fish kdm6bb specific primers in Table 3 to identify the kdm6bb genotype of different individuals, using the fish sex molecular marker primers in Table 4 to identify the genetic sex of the self-pollinated offspring, and obtain an all-male population with no kdm6bb gene mutation, genetic sex of XY, and physiological sex of male, such as Figure 7 As shown, sex-controlled breeding of fish and cultivation of single-sex groups are achieved.

[0084] The above description of the embodiments is to facilitate the understanding and use of the invention by those skilled in the art. It is obvious that those skilled in the art can easily make various modifications to these embodiments and apply the general principles described herein to other embodiments without creative work. Therefore, the present invention is not limited to the above embodiments, and improvements and modifications made by those skilled in the art based on the disclosure of the present invention without departing from the scope of the present invention should be within the scope of protection of the present invention.

Claims

1. A method for constructing non-gene-edited all-male fish based on KDM6BB gene knockdown technology, characterized in that: The kdm6bb heterozygous model is constructed by the kdm6bb gene knockdown technology to obtain pseudo-female fish of XY genetic type; the pseudo-female fish is then mated with wild-type XY genetic male fish to screen super male fish of YY genetic sex without gene editing, and the super male fish is hybridized with XX wild-type female fish to obtain all-male offspring of XY genetic sex, thereby realizing all-male controlled breeding of fish; The method for constructing a kdm6bb heterozygous model using the kdm6bb gene knockdown technology comprises: using CIRSPR / Cas9 gene editing technology to cut the histone demethylase kdm6bb gene to obtain heterozygous offspring, reduce the expression of kdm6bb protein, and induce XY genotype fish to develop into pseudo-female fish; The method for constructing all-male fish without gene editing based on KDM6BB gene knockdown technology comprises the following steps: S1, knocking out the kdm6bb gene using gene editing technology to obtain kdm6bb heterozygous fish with the genotype of kdm6bb + / - ; S2, self-pollinating the kdm6bb heterozygous fish, and obtaining a kdm6bb heterozygous fish of genetic sex XY through genotyping, whose physiological sex is female and marked as kdm6bb + / - XY pseudo-female fish; S3, the kdm6bb + / - XY pseudo-female fish and kdm6bb + / + XY wild-type males were mated and selected for kdm6bb + / + YY's super male fish; S4, kdm6bb + / + YY's super male fish and kdm6bb + / + XX wild-type females were mated, and the offspring obtained were all kdm6bb + / + XY genotype males, to achieve sex-controlled breeding and single-sex group culture of fish; The fish is a fish of kdm6bb-sensitive type and male heterogametic genetic determination type.

2. The method for constructing a non-gene-edited all-male fish based on the KDM6BB gene knockdown technology according to claim 1, characterized in that: In step S1, the gene editing technology is to use the CRISPR / Cas9 system to specifically cut the kdm6bb gene of fish, thereby knocking out the kdm6bb gene of fish, blocking the histone demethylation reaction of fish, and inhibiting the expression of male development genes; wherein the specific process of obtaining kdm6bb heterozygous fish is as follows: S11, design sgRNA target site in the kdm6bb coding region, and synthesize sgRNA primers by in vitro transcription; S12, at the I-cell stage of fish fertilized eggs, sgRNA and Cas9 protein are prepared into an injection mixture according to a predetermined ratio, and the fertilized eggs are co-injected; S13, the injected fertilized eggs were placed in 28°C circulating water for incubation; S14, kdm6bb genotype was identified using specific primers to obtain kdm6bb heterozygous fish.

3. The method for constructing a non-gene-edited all-male fish based on the KDM6BB gene knockdown technology according to claim 1, characterized in that: In step S2, the kdm6bb heterozygous fish is self-fertilized to obtain a kdm6bb heterozygous fish with a genetic sex of XY, which is female in physiological sex and is marked as kdm6bb. + / - XY pseudo-female fish; among them, kdm6bb was obtained + / - The process of XY pseudo-female fish is: S21, kdm6bb + / - Heterozygous fish were raised to sexual maturity, naturally mated and fertilized, and incubated and raised in circulating water at 28°C: S22, using specific primer sequences to identify the kdm6bb genotype of the self-pollinated offspring, and using sex molecular marker primers to identify the genetic sex of the self-pollinated offspring, obtaining kdm6bb heterozygous individuals with genetic sex of XY and physiological sex of female, marked as kdm6bb + / - XY pseudo-female fish.

4. The method for constructing a non-gene-edited all-male fish based on the KDM6BB gene knockdown technology according to claim 1, characterized in that: In step S3, kdm6bb + / - XY pseudo-female fish were mated with wild-type XY male fish, and kdm6bb was selected through genotyping + / + YY super male fish; among them, kdm6bb was obtained + / + The process of YY super male fish is: S31, kdm6bb + / - XY pseudofemales were raised in circulating water at 28°C until sexual maturity; S32, kdm6bb + / - XY pseudo-female fish and wild-type Kdm6bb + / + XY male fish mate and fertilize naturally, and hatch and raise in circulating water at 28℃: S33, using specific primer sequences to identify the kdm6bb genotype of the offspring, using sex molecular marker primers to identify the genetic sex of the self-pollinated offspring, and obtaining super male fish with no kdm6bb mutation, genetic sex of YY, and physiological sex of male, marked as kdm6bb + / + YY super male fish.

5. The method for constructing a non-gene-edited all-male fish based on the KDM6BB gene knockdown technology according to claim 1, characterized in that: In step S4, kdm6bb + / + YY super male fish were mated with wild-type XX female fish, and genotype identification confirmed that there was no gene mutation in kdm6bb, and the genetic sex was XY. Among them, kdm6bb was obtained. + / + The process of the XY all-male population is: S41, kdm6bb + / + YY super male fish and wild type XX female fish mate naturally to lay eggs and fertilize them, and then hatch and raise them in circulating water at 28℃: S42, use specific primer sequences to identify the kdm6bb genotype of the offspring, and use sex molecular marker primers to identify the genetic sex of the self-pollinated offspring, to obtain an all-male population with no kdm6bb mutation, genetic sex of XY, and physiological sex of male, to achieve sex-controlled breeding of fish and cultivation of single-sex populations.

6. The method for constructing a non-gene-edited all-male fish based on the KDM6BB gene knockdown technology according to claim 2, characterized in that: According to the fish kdm6bb gene sequence, the gRNA target site was designed and the gRNA was synthesized by in vitro transcription.

7. The method for constructing non-gene-edited all-male fish based on the KDM6BB gene knockdown technology according to claim 1, characterized in that: The process of obtaining heterozygous fish with effective mutation kdm6bb is as follows: amplifying and sequencing the target gene fragments of F0 and F1 generation individuals, detecting the gene mutation, and screening heterozygous offspring with effective mutations.

8. The method for constructing a non-gene-edited all-male fish based on the KDM6BB gene knockdown technology according to claim 1, characterized in that: Effective identification of the genetic sex of offspring: Extract offspring genomic DNA, perform target detection fragment amplification and electrophoresis, and identify genetic sex based on the size of PCR products.

9. The method for constructing a non-gene-edited all-male fish based on the KDM6BB gene knockdown technology according to claim 1, characterized in that: The pseudo-female fish is a female fish with normal ovarian structure and mature egg development; the super-male fish is a male fish with normal testicular structure and mature sperm production; the molecular markers are screened for kdm6bb + / - XY pseudo-female fish and kdm6bb + / + YY super male fish.

10. Application of the method for constructing gene-free all-male fish based on kdm6bb gene knockdown technology as described in any one of claims 1 to 9 in sex-controlled breeding of kdm6bb-sensitive male-heterogametic economic fish.

Images