Preparation method and application of microalgae feed

Abstract

The invention relates to the technical field of microalgae feed, and discloses a preparation method and application of microalgae feed, and the preparation method comprises the following steps: S1, extracting hawthorn flavone; s2, extraction of maca unsaturated fatty acid; s3, extracting beta-glucan from the oat bran; s4, extracting pinellia ternate agglutinin; s5, screening of excellent chlorella; according to the preparation method and application of the microalgae feed, the chlorella which is not reported by public literatures is screened out, substances such as pinellia ternate agglutinin extracted from pinellia ternate, beta-glucan extracted from oat bran, flavone extracted from hawthorn, unsaturated fatty acid extracted from maca and the like are combined to serve as a culture medium for culturing the chlorella, an original BG-11 culture medium is replaced, and the microalgae feed is prepared. The chlorella breeding rate is increased; the cultured composite microalgae liquid is used as a liquid feed for livestock and poultry, and compared with a common chlorella feed, the composite microalgae feed can more quickly eliminate toxins such as heavy metals in animal bodies; the weight of animals can be increased, the protein content of meat can be increased, and the fat content can be reduced.

Description

Technical Field

[0001] The invention relates to the technical field of microalgae feed, and in particular to a preparation method and application of microalgae feed. Background Art

[0002] In recent years, my country's livestock and poultry feed has developed greatly, and there are many kinds of feed additives. Most of them provide amino acids, minerals and vitamins to supplement the nutrition of animals and animal products. However, most of the added ingredients are chemical synthetic preparations or inorganic salts containing trace elements. On the one hand, the utilization rate of animals in the digestion and absorption process is low. Microalgae is rich in polyunsaturated fatty acids, proteins, carotenoids, vitamins and various minerals, which can increase the omega-3 unsaturated fatty acids, vitamins and minerals in animal products, making it a good feed additive. At present, eggs and chickens rich in polyunsaturated fatty acids such as docosahexaenoic acid (DHA) and eicosapentaenoic acid (EPA) have appeared on the market, as well as eggs rich in selenium and iodine.

[0003] In the prior art, composite microalgae feed is only used as feed. During the feeding process, the minerals contained in it will increase the heavy metal toxins in the animal's body, which is not conducive to the weight gain of the animal and reduces the meat protein content in the animal's body. In view of this, we propose a preparation method and application of microalgae feed. Summary of the invention

[0004] The purpose of the present invention is to provide a preparation method and application of microalgae feed to solve the problems raised in the above background technology.

[0005] To achieve the above object, the present invention provides the following technical solution: a method for preparing microalgae feed, the method comprising the following steps:

[0006] S1, hawthorn brass extraction;

[0007] S2, unsaturated fatty acid extraction from maca;

[0008] S3, oat bran β-glucan extraction;

[0009] S4, Pinellia ternata lectin extraction;

[0010] S5. Screening of high-quality Chlorella;

[0011] S6. Cultivation of Chlorella.

[0012] Optionally, S1 further comprises: crushing the dried hawthorn fruit through a 0.5 mm sieve and drying at 105° C. for 3 hours. Take 2.5 g of hawthorn fruit powder, add 100 ml of 70% ethanol, ultrasonically vibrate 3 times, the ultrasonic frequency is 40 KHZ, each time for 15 minutes, each time interval is 15 minutes, combine the extracts, recover the ethanol, obtain the hawthorn brass extract, and dilute to 100 ml for standby use.

[0013] Optionally, the S2 further includes: accurately weighing 10.00 grams of dried maca powder, placing it in a conical flask, taking 50 ml of methanol and 2.5 ml of hydrochloric acid to mix, and then adding 150 ml of isooctane to the mixed solution, making a biphasic solution of hydrochloric acid-methanol and isooctane, adding 100 ml of hydrochloric acid-methanol and isooctane to a conical flask. After soaking for a period of time, ultrasonic extraction for 50 minutes, ultrasonic frequency 40KHZ, extraction 3 times. Suction filtration to remove slag and wash the residue 3 times, the filtrate is combined. After the extraction is completed, petroleum ether is removed by rotary evaporation to obtain 2.68g maca unsaturated fatty acids, which are settled to 100 ml for standby use, and the concentration of the hydrochloric acid is 1 mol / L.

[0014] Optionally, the S3 further comprises: weighing 10 grams of oat bran, passing through a 0.5 mm sieve, adding distilled water in proportion, mixing, heating in a water bath at a certain temperature and time, ultrasonic treatment under certain conditions, ultrasonic frequency 40KHZ, 6000r / min centrifugation for 20 minutes to take the supernatant, using high temperature heat-resistant α-amylase to hydrolyze starch, adjusting the solution water-soluble heating temperature to 95°C, pH to 6.5, heating for 30 minutes to hydrolyze and remove starch in the extract, and then selecting a high temperature enzyme inactivation method to remove amylase. Under rapid stirring conditions, the pH of the solution is slowly adjusted to 4.5 by 20% hydrochloric acid, centrifuged at 6000r / min for 20 minutes to remove protein from oat bran by isoelectric precipitation, then centrifuged at 6000r / min for 20 minutes to take the supernatant, add 95% ethanol alcohol precipitation, stand at 4°C for 12 hours, collect the precipitate, freeze-dry to obtain 0.5 grams of β-glucan, and set to 100 ml for standby use.

[0015] Optionally, the S4 further comprises: weighing about 10 grams of fresh and dry tubers respectively, crushing the samples and adding the extracting solution to the samples at a solid-liquid ratio of 1:3, ultrasonically treating for 20 minutes, extracting with 1.5% NaCl solution at 4°C for 6 hours, extracting once, centrifuging to obtain the supernatant and performing ammonium sulfate precipitation to obtain a crude extract of Pinellia ternata. Dialysis desalination, centrifuging to remove the precipitate after completion to obtain the supernatant, and preparing for sample chromatography. The chromatography column is balanced with 0.05mol / LTris-HCl (pH8.0) buffer, the supernatant is loaded, and 500mmol / LNaCl solution is used for ionic strength linear gradient elution, the elution temperature is 25°C, the flow rate is 0.5mL / min, and 3mL / tube is collected with an automatic fraction collector, and the protein peak is eluted, and the agglutination activity of each protein peak is detected, and the collected target lectin is dialyzed for desalination and stored at -20°C for standby use.

[0016] Optionally, S5 further comprises: selecting the best Chlorella mother cell, the nucleic acid sequence of which is:

[0017]

[0018] Optionally, S6 further includes: stepwise expansion and cultivation of Chlorella in different containers containing hawthorn brass, maca unsaturated fatty acids, pinellia lectin, and oat bran β-glucan culture medium, until the mother cell content in each milliliter of culture medium is not less than a preset value, so as to form a composite microalgae feed; the environmental conditions for stepwise expansion and cultivation are: continuous illumination, constant temperature, introduction of purified air and carbon dioxide, water pH value of 7.0-7.5, TDS value of 20-25, light intensity of 4000-4500 lux, cultivation temperature of 28-30°C, purified air pressure of 0.65-0.85Mpa, and carbon dioxide concentration in the air is controlled at 15%-20%. The composite microalgae feed is in the form of a liquid preparation; preferably, in the liquid preparation, the number of living Chlorella is not less than 1×10 7 / mL, Pinellia lectin 0.01-0.05 g / mL, β-glucan 0.01-0.05 g / mL, hawthorn flavonoids 0.01-0.05 g / mL, maca unsaturated fatty acids 0.01-0.05 g / mL.

[0019] The present invention also proposes an application of a method for preparing microalgae feed, wherein the microalgae feed is applied in livestock and poultry farming, wherein the livestock and poultry include cattle, sheep, pigs, chickens, ducks, and geese, and the composite microalgae feed is added to disinfected animal drinking water for consumption, wherein the temperature of the animal drinking water is not higher than 40°C.

[0020] Optionally, when the livestock and poultry are fattening pigs, they are fed once a month for 10 consecutive days starting from the first day of weaning of the piglets, 10-20 ml per pig per day, and the feeding amount of the day is mixed into the trough or pig feed for feeding at one time. In winter, 5-10 ml per head per day, and the feeding amount of the day is mixed into the trough or pig feed for feeding at one time to prevent diarrhea. When the livestock and poultry are sows, the feeding method is the same as that of fattening pigs during the growth stage. During the gestation period, 10-20 ml per pig per day, continuous feeding, until the piglets are weaned or slaughtered, the feeding amount of the day is mixed into the trough or pig feed for feeding at one time. When the livestock and poultry are cattle, the feeding method and dosage of fattening cattle are the same as those of fattening pigs. The growth stage of dairy cows is the same as that of fattening pigs. During the milk production period, 10-20 ml per cow per day, continuous feeding, and the feeding amount of the day is mixed into the trough or cattle feed for feeding at one time. When the livestock and poultry are sheep, the feeding method and dosage of fattening sheep are the same as those of fattening pigs. The growth stage of dairy goats is the same as that of fattening pigs. During the milk production period, 10-20 ml per goat per day is fed continuously. The daily feeding amount is mixed into the trough or cattle feed at one time.

[0021] When the poultry is chicken, each batch of broiler chickens eats it for 10 days, starting from the first day the chicks are bought, and continue to eat for 10 days, at a rate of 20-40 ml per 100 chickens per day, and the daily feeding amount is mixed into the drinking water of the chickens for feeding at one time. During the growth stage of laying hens, the feeding method is the same as that of broilers. After laying eggs, feed them once a week, at a rate of 10-20 ml per 100 chickens each time, until they stop laying eggs, and then mix the daily feeding amount into the drinking water of the chickens for feeding at one time. When the poultry is ducks, the feeding method and dosage of ducks are the same as those of chickens. When the poultry is geese, each batch of geese eats it for 10 days, starting from the first day the goose chicks are bought, and continue to eat for 10 days, at a rate of 40-80 ml per 100 geese per day, and the daily feeding amount is mixed into the drinking water of the geese for feeding at one time.

[0022] Compared with the prior art, the present invention provides a method for preparing microalgae feed and its application, which has the following beneficial effects:

[0023] The preparation method and application of the microalgae feed screen out Chlorella that has not been reported in public literature, use Pinellia lectin extracted from Pinellia, β-glucan extracted from oat bran, flavonoids extracted from hawthorn, unsaturated fatty acids extracted from maca and other substances as a culture medium to cultivate Chlorella, replacing the original BG-11 culture medium, so that the reproduction rate of Chlorella is improved; the cultured composite algae liquid is used as liquid feed for livestock and poultry. Compared with ordinary Chlorella feed, this composite microalgae feed can eliminate toxins such as heavy metals in animals more quickly; it is more helpful to increase the weight of animals, improve the protein content of meat, and reduce the fat content. DETAILED DESCRIPTION

[0024] The following will be combined with the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of the present invention.

[0025] Embodiment 1:

[0026] This example proposes a method for preparing microalgae feed and its application, the method comprising the following steps: gradually expanding the culture of Chlorella in different containers containing hawthorn brass, maca unsaturated fatty acids, pinellia lectin, and oat bran β-glucan culture medium until the mother cell content per milliliter of culture medium is not less than 1×10 7 / mL, forming a composite microalgae feed; the environmental conditions for step-by-step expansion of the culture are: continuous illumination, constant temperature, introduction of purified air and carbon dioxide, water pH value of 7.5, TDS value of 25, light intensity of 4500lux, culture temperature of 28°C, purified air pressure of 0.65Mpa, and carbon dioxide concentration in the air controlled at 15%. The composite microalgae feed is in the form of a liquid preparation; in the liquid preparation, 1×10 live Chlorella 7 / mL, Pinellia lectin 0.05 g / mL, β-glucan 0.05 g / mL, Hawthorn flavonoids 0.05 g / mL, Maca unsaturated fatty acids 0.05 g / mL. The composite microalgae feed is added to the disinfected animal drinking water for consumption, and the temperature of the animal drinking water is not higher than 40°C. When the livestock is a fattening pig, start from the first day of weaning of the piglets, feed once a month for 10 consecutive days each time, 20 ml per pig per day, and mix the daily feeding amount into the trough or pig feed at one time. In winter, 10 ml per head per day, mix the daily feeding amount into the trough or pig feed at one time to prevent diarrhea. When the livestock is a sow, the feeding method is the same as that of a fattening pig during the growth stage. During pregnancy, 20 ml per pig per day, continue feeding until the piglets are weaned or slaughtered, and mix the daily feeding amount into the trough or pig feed at one time. When the livestock is a cattle, the feeding method and dosage of fattening cattle are the same as those of fattening pigs. The growth stage of dairy cows is the same as that of fattening pigs. During the milk production period, 20 ml per cow per day is used for continuous feeding, and the daily feeding amount is mixed into the trough or cattle feed for feeding at one time. When the livestock is sheep, the feeding method and dosage of fattening sheep are the same as those of fattening pigs. The growth stage of dairy sheep is the same as that of fattening pigs. During the milk production period, 20 ml per sheep per day is used for continuous feeding, and the daily feeding amount is mixed into the trough or cattle feed for feeding at one time. When the poultry is chicken, each batch of broiler chickens eats for 10 days, starting from the first day the chicks are bought, and they are eaten for 10 consecutive days, 40 ml per hundred chickens per day, and the daily feeding amount is mixed into the drinking water of the chickens for feeding at one time. During the growth stage of laying hens, the feeding method is the same as that of broilers. After laying eggs, feed once a week, 20 ml per hundred chickens each time, until egg laying stops, and the daily feeding amount is mixed into the drinking water of the chickens for feeding at one time. When the poultry is ducks, the feeding method and dosage of ducks are the same as those of chickens. When the poultry are geese, each batch of geese eats the solution for 10 days, starting from the first day the goose chicks are bought, and for 10 consecutive days, 80 ml per 100 geese per day, and the daily feeding amount is mixed into the drinking water of the geese at one time for feeding.

[0027] Embodiment 2:

[0028] This embodiment proposes a method for preparing microalgae feed and its application, the method comprising the following steps:

[0029] Chlorella was cultured in different containers containing hawthorn brass, maca unsaturated fatty acids, pinellia lectin, and oat bran β-glucan culture medium, until the mother cell content per ml of culture medium was not less than 1×10 7 / mL, forming a composite microalgae feed; the environmental conditions for step-by-step expansion of the culture are: continuous illumination, constant temperature, introduction of purified air and carbon dioxide, water pH value of 7.5, TDS value of 25, light intensity of 4500lux, culture temperature of 28°C, purified air pressure of 0.65Mpa, and carbon dioxide concentration in the air controlled at 15%. The composite microalgae feed is in the form of a liquid preparation; in the liquid preparation, 1×10 live Chlorella 7 / mL, Pinellia lectin 0.03 g / mL, β-glucan 0.03 g / mL, hawthorn flavonoids 0.03 g / mL, maca unsaturated fatty acids 0.03 g / mL. The composite microalgae feed is added to the disinfected animal drinking water for consumption, and the temperature of the animal drinking water is not higher than 40°C. When the livestock is a fattening pig, it starts from the first day of weaning of the piglets, once a month, for 10 consecutive days each time, 20 ml per pig per day, and the daily feeding amount is mixed into the trough or pig feed for feeding at one time. In winter, 10 ml per head per day, the daily feeding amount is mixed into the trough or pig feed for feeding at one time to prevent diarrhea. When the livestock is a sow, the feeding method is the same as that of a fattening pig during the growth stage. During pregnancy, 20 ml per pig per day, continuous feeding, until the piglets are weaned or slaughtered, the daily feeding amount is mixed into the trough or pig feed for feeding at one time. When the livestock is a cattle, the feeding method and dosage of fattening cattle are the same as those of fattening pigs. The growth stage of dairy cows is the same as that of fattening pigs. During the milk production period, 20 ml per cow per day is used for continuous feeding, and the daily feeding amount is mixed into the trough or cattle feed for feeding at one time. When the livestock is sheep, the feeding method and dosage of fattening sheep are the same as those of fattening pigs. The growth stage of dairy sheep is the same as that of fattening pigs. During the milk production period, 20 ml per sheep per day is used for continuous feeding, and the daily feeding amount is mixed into the trough or cattle feed for feeding at one time. When the poultry is chicken, each batch of broiler chickens eats for 10 days, starting from the first day the chicks are bought, and they are eaten for 10 consecutive days, 40 ml per hundred chickens per day, and the daily feeding amount is mixed into the drinking water of the chickens for feeding at one time. During the growth stage of laying hens, the feeding method is the same as that of broilers. After laying eggs, feed once a week, 20 ml per hundred chickens each time, until egg laying stops, and the daily feeding amount is mixed into the drinking water of the chickens for feeding at one time. When the poultry is ducks, the feeding method and dosage of ducks are the same as those of chickens. When the poultry are geese, each batch of geese eats the solution for 10 days, starting from the first day the goose chicks are bought, and for 10 consecutive days, 80 ml per 100 geese per day, and the daily feeding amount is mixed into the drinking water of the geese at one time for feeding.

[0030] Example 3

[0031] A preparation method and application of microalgae feed, the method comprising the following steps:

[0032] Chlorella was cultured in different containers containing hawthorn brass, maca unsaturated fatty acids, pinellia lectin, and oat bran β-glucan culture medium, until the mother cell content per ml of culture medium was not less than 1×10 7 / mL, forming a composite microalgae feed; the environmental conditions for step-by-step expansion of the culture are: continuous illumination, constant temperature, introduction of purified air and carbon dioxide, water pH value of 7.5, TDS value of 25, light intensity of 4500lux, culture temperature of 28°C, purified air pressure of 0.65Mpa, and carbon dioxide concentration in the air controlled at 15%. The composite microalgae feed is in the form of a liquid preparation; in the liquid preparation, 1×10 live Chlorella 7 / mL, Pinellia lectin 0.01 g / mL, β-glucan 0.01 g / mL, Hawthorn flavonoids 0.01 g / mL, Maca unsaturated fatty acids 0.01 g / mL. The composite microalgae feed is added to the disinfected animal drinking water for consumption, and the temperature of the animal drinking water is not higher than 40°C. When the livestock is a fattening pig, start from the first day of weaning of the piglets, feed once a month for 10 consecutive days each time, 20 ml per pig per day, and mix the daily feeding amount into the trough or pig feed at one time. In winter, 10 ml per head per day, mix the daily feeding amount into the trough or pig feed at one time to prevent diarrhea. When the livestock is a sow, the feeding method is the same as that of a fattening pig during the growth stage. During pregnancy, 20 ml per pig per day, continue feeding until the piglets are weaned or slaughtered, and mix the daily feeding amount into the trough or pig feed at one time. When the livestock is a cattle, the feeding method and dosage of fattening cattle are the same as those of fattening pigs. The growth stage of dairy cows is the same as that of fattening pigs. During the milk production period, 20 ml per cow per day is used for continuous feeding, and the daily feeding amount is mixed into the trough or cattle feed for feeding at one time. When the livestock is sheep, the feeding method and dosage of fattening sheep are the same as those of fattening pigs. The growth stage of dairy sheep is the same as that of fattening pigs. During the milk production period, 20 ml per sheep per day is used for continuous feeding, and the daily feeding amount is mixed into the trough or cattle feed for feeding at one time. When the poultry is chicken, each batch of broiler chickens eats for 10 days, starting from the first day the chicks are bought, and they are eaten for 10 consecutive days, 40 ml per hundred chickens per day, and the daily feeding amount is mixed into the drinking water of the chickens for feeding at one time. During the growth stage of laying hens, the feeding method is the same as that of broilers. After laying eggs, feed once a week, 20 ml per hundred chickens each time, until egg laying stops, and the daily feeding amount is mixed into the drinking water of the chickens for feeding at one time. When the poultry is ducks, the feeding method and dosage of ducks are the same as those of chickens. When the poultry are geese, each batch of geese eats the solution for 10 days, starting from the first day the goose chicks are bought, and for 10 consecutive days, 80 ml per 100 geese per day, and the daily feeding amount is mixed into the drinking water of the geese at one time for feeding.

[0033] Embodiment 4:

[0034] A preparation method and application of microalgae feed, the method comprising the following steps: culturing Chlorella vulgaris in different containers containing hawthorn brass, maca unsaturated fatty acids, pinellia lectin, and oat bran β-glucan culture medium step by step until the mother cell content in each milliliter of culture medium is not less than 1×10 7 / mL, forming a composite microalgae feed; the environmental conditions for step-by-step expansion of the culture are: continuous illumination, constant temperature, introduction of purified air and carbon dioxide, water pH value of 7.5, TDS value of 25, light intensity of 4500lux, culture temperature of 28°C, purified air pressure of 0.65Mpa, and carbon dioxide concentration in the air controlled at 15%. The composite microalgae feed is in the form of a liquid preparation; in the liquid preparation, 1×10 live Chlorella 7 / mL, Pinellia lectin 0.05 g / mL, β-glucan 0.05 g / mL, Hawthorn flavonoids 0.05 g / mL, Maca unsaturated fatty acids 0.05 g / mL. The composite microalgae feed is added to the disinfected animal drinking water for consumption, and the temperature of the animal drinking water is not higher than 40°C. When the livestock is a fattening pig, start from the first day of weaning of the piglets, feed once a month for 10 consecutive days each time, 10 ml per pig per day, and mix the daily feeding amount into the trough or pig feed at one time. In winter, 5 ml per head per day, mix the daily feeding amount into the trough or pig feed at one time to prevent diarrhea. When the livestock is a sow, the feeding method is the same as that of a fattening pig during the growth stage. During pregnancy, 10 ml per pig per day, continue feeding until the piglets are weaned or slaughtered, and mix the daily feeding amount into the trough or pig feed at one time. When the livestock is a cattle, the feeding method and dosage of fattening cattle are the same as those of fattening pigs. The growth stage of dairy cows is the same as that of fattening pigs. During the milk production period, 10 ml per cow per day is used for continuous feeding, and the daily feeding amount is mixed into the trough or cattle feed for feeding at one time. When the livestock is sheep, the feeding method and dosage of fattening sheep are the same as those of fattening pigs. The growth stage of dairy sheep is the same as that of fattening pigs. During the milk production period, 10 ml per sheep per day is used for continuous feeding, and the daily feeding amount is mixed into the trough or cattle feed for feeding at one time. When the poultry is chicken, each batch of broiler chickens eats for 10 days, starting from the first day the chicks are bought, and they are eaten for 10 consecutive days, 20 ml per hundred chickens per day, and the daily feeding amount is mixed into the drinking water of the chickens for feeding at one time. During the growth stage of laying hens, the feeding method is the same as that of broilers. After laying eggs, feed once a week, 10 ml per hundred chickens each time, until egg laying stops, and the daily feeding amount is mixed into the drinking water of the chickens for feeding at one time. When the poultry is ducks, the feeding method and dosage of ducks are the same as those of chickens. When the poultry are geese, each batch of geese eats the drug for 10 days, starting from the first day the goslings are bought, and for 10 consecutive days, 40 ml per 100 geese per day, and the daily feeding amount is mixed into the drinking water of the geese at one time for feeding.

[0035] Example 5

[0036] A preparation method and application of microalgae feed, the method comprising the following steps: culturing Chlorella vulgaris in different containers containing hawthorn brass, maca unsaturated fatty acids, pinellia lectin, and oat bran β-glucan culture medium step by step until the mother cell content in each milliliter of culture medium is not less than 1×10 7 / mL, forming a composite microalgae feed; the environmental conditions for step-by-step expansion of the culture are: continuous illumination, constant temperature, introduction of purified air and carbon dioxide, water pH value of 7.5, TDS value of 25, light intensity of 4500lux, culture temperature of 28°C, purified air pressure of 0.65Mpa, and carbon dioxide concentration in the air controlled at 15%. The composite microalgae feed is in the form of a liquid preparation; in the liquid preparation, 1×10 live Chlorella 7 / mL, Pinellia lectin 0.03 g / mL, β-glucan 0.03 g / mL, Hawthorn flavonoids 0.03 g / mL, Maca unsaturated fatty acids 0.03 g / mL. The composite microalgae feed is added to the disinfected animal drinking water for consumption, and the temperature of the animal drinking water is not higher than 40°C. When the livestock is a fattening pig, start from the first day of weaning of the piglets, feed once a month for 10 consecutive days each time, 10 ml per pig per day, and mix the daily feeding amount into the trough or pig feed at one time. In winter, 5 ml per head per day, mix the daily feeding amount into the trough or pig feed at one time to prevent diarrhea. When the livestock is a sow, the feeding method is the same as that of a fattening pig during the growth stage. During pregnancy, 10 ml per pig per day, continue feeding until the piglets are weaned or slaughtered, and mix the daily feeding amount into the trough or pig feed at one time. When the livestock is a cattle, the feeding method and dosage of fattening cattle are the same as those of fattening pigs. The growth stage of dairy cows is the same as that of fattening pigs. During the milk production period, 10 ml per cow per day is used for continuous feeding, and the daily feeding amount is mixed into the trough or cattle feed for feeding at one time. When the livestock is sheep, the feeding method and dosage of fattening sheep are the same as those of fattening pigs. The growth stage of dairy sheep is the same as that of fattening pigs. During the milk production period, 10 ml per sheep per day is used for continuous feeding, and the daily feeding amount is mixed into the trough or cattle feed for feeding at one time. When the poultry is chicken, each batch of broiler chickens eats for 10 days, starting from the first day the chicks are bought, and they are eaten for 10 consecutive days, 20 ml per hundred chickens per day, and the daily feeding amount is mixed into the drinking water of the chickens for feeding at one time. During the growth stage of laying hens, the feeding method is the same as that of broilers. After laying eggs, feed once a week, 10 ml per hundred chickens each time, until egg laying stops, and the daily feeding amount is mixed into the drinking water of the chickens for feeding at one time. When the poultry is ducks, the feeding method and dosage of ducks are the same as those of chickens. When the poultry are geese, each batch of geese eats the drug for 10 days, starting from the first day the goslings are bought, and for 10 consecutive days, 40 ml per 100 geese per day, and the daily feeding amount is mixed into the drinking water of the geese at one time for feeding.

[0037] Embodiment 6:

[0038] A preparation method and application of microalgae feed, the method comprising the following steps: culturing Chlorella vulgaris in different containers containing hawthorn brass, maca unsaturated fatty acids, pinellia lectin, and oat bran β-glucan culture medium step by step until the mother cell content in each milliliter of culture medium is not less than 1×10 7 / mL, forming a composite microalgae feed; the environmental conditions for step-by-step expansion of the culture are: continuous illumination, constant temperature, introduction of purified air and carbon dioxide, water pH value of 7.5, TDS value of 25, light intensity of 4500lux, culture temperature of 28°C, purified air pressure of 0.65Mpa, and carbon dioxide concentration in the air controlled at 15%. The composite microalgae feed is in the form of a liquid preparation; in the liquid preparation, 1×10 live Chlorella 7 / mL, Pinellia lectin 0.01 g / mL, β-glucan 0.01 g / mL, hawthorn flavonoids 0.01 g / mL, maca unsaturated fatty acids 0.01 g / mL. The composite microalgae feed is added to the disinfected animal drinking water for consumption, and the temperature of the animal drinking water is not higher than 40°C. When the livestock is a fattening pig, start from the first day of weaning of the piglets, feed once a month, and feed for 10 consecutive days each time, 10 ml per pig per day, and mix the daily feeding amount into the trough or pig feed at one time. In winter, 5 ml per head per day, mix the daily feeding amount into the trough or pig feed at one time to prevent diarrhea. When the livestock is a sow, the feeding method is the same as that of a fattening pig during the growth stage. During pregnancy, 10 ml per pig per day, continue feeding until the piglets are weaned or slaughtered, and mix the daily feeding amount into the trough or pig feed at one time. When the livestock is a cattle, the feeding method and dosage of fattening cattle are the same as those of fattening pigs. The growth stage of dairy cows is the same as that of fattening pigs. During the milk production period, 10 ml per cow per day is used for continuous feeding, and the daily feeding amount is mixed into the trough or cattle feed for feeding at one time. When the livestock is sheep, the feeding method and dosage of fattening sheep are the same as those of fattening pigs. The growth stage of dairy sheep is the same as that of fattening pigs. During the milk production period, 10 ml per sheep per day is used for continuous feeding, and the daily feeding amount is mixed into the trough or cattle feed for feeding at one time. When the poultry is chicken, each batch of broiler chickens eats for 10 days, starting from the first day the chicks are bought, and they are eaten for 10 consecutive days, 20 ml per hundred chickens per day, and the daily feeding amount is mixed into the drinking water of the chickens for feeding at one time. During the growth stage of laying hens, the feeding method is the same as that of broilers. After laying eggs, feed once a week, 10 ml per hundred chickens each time, until egg laying stops, and the daily feeding amount is mixed into the drinking water of the chickens for feeding at one time. When the poultry is ducks, the feeding method and dosage of ducks are the same as those of chickens. When the poultry are geese, each batch of geese eats the drug for 10 days, starting from the first day the goslings are bought, and for 10 consecutive days, 40 ml per 100 geese per day, and the daily feeding amount is mixed into the drinking water of the geese at one time for feeding.

[0039] Comparative Example 1: Animals drink water normally without adding composite microalgae feed

[0040] Comparative Example 2: Adding common Chlorella, 1×10 7 Pieces / mL

[0041] Comparative Example 3: The BG-11 medium of Chlorella vulgaris was cultured in different containers in a step-by-step manner until the mother cell content per milliliter of the medium was not less than 1×10 7 / mL to form a composite microalgae feed; the environmental conditions for gradual expansion of cultivation are: continuous light, constant temperature, introduction of purified air and carbon dioxide, water pH value of 7.5, TDS value of 25, light intensity of 4500lux, cultivation temperature of 28℃, purified air pressure of 0.65Mpa, and carbon dioxide concentration in the air is controlled at 15%.

[0042] Experimental Example 1: Experiment on weight gain of livestock and poultry using composite microalgae feed

[0043] This test selected large fattening pigs, beef cattle, sheep, chickens, ducks and geese as test subjects. For each of the above animals, 800 were selected under the same management conditions, 100 of which were treated according to Comparative Example 1, 100 were treated according to Comparative Example 2, and the rest were treated according to Examples 1-6, 100 for each treatment, and the weight gain ratio relative to Comparative Example 1 was calculated after the animals were marketed. The calculation results are shown in the following table:

[0044] project Fattening Pigs Beef cattle Sheep chicken duck Goose Comparative Example 1 0 0 0 0 0 0 Comparative Example 2 5.3％ 6.1％ 5％ 5.5％ 5.8％ 2.6％ Example 1 15.2％ 12％ 13.8％ 15.2％ 14％ 12.1％ Example 2 13.3％ 11.6％ 13.2％ 12.1％ 13.8％ 11.8％ Example 3 11.2％ 10.4％ 11％ 10.8％ 12％ 10.6％ Example 4 9.5％ 8.2％ 9.8％ 10％ 10％ 9.7％ Example 5 6.8％ 7.2％ 8％ 7％ 8.3％ 8.8％ Example 6 6.3％ 6.9％ 7.2％ 6.4％ 7％ 7％

[0045] The weight gain effect of Examples 1-6 is more obvious than that of adding common Chlorella, which can reflect that the composite microalgae feed with added Pinellia lectin, β-glucan, hawthorn flavonoids, and maca unsaturated fatty acids has an obvious weight gain effect on livestock and poultry breeding. At the same time, Example 1 is more obvious than Examples 2, 3, 4, 5, and 6, indicating that the use of 1×10 live Chlorella of the present invention 7 / mL, Pinellia lectin 0.05g / mL, β-glucan 0.05g / mL, Hawthorn flavonoids 0.05g / mL, Maca unsaturated fatty acids 0.05g / mL. When the livestock is a fattening pig, start feeding the piglets once a month from the first day of weaning, for 10 consecutive days each time, 20 ml per pig per day, in winter, 10 ml per head per day; when the livestock is a sow, the feeding method is the same as that of a fattening pig during the growth stage. During pregnancy, 20 ml per pig per day; when the livestock is a cattle, the feeding method and dosage of fattening cattle are the same as those of fattening pigs. The growth stage of dairy cows is the same as that of fattening pigs, and during the milk production period, 20 ml per cow per day; when the livestock is sheep, the feeding method and dosage of fattening sheep are the same as those of fattening pigs. The growth stage of dairy goats is the same as that of fattening pigs. During the milk production period, 20 ml is used per goat per day. When the poultry is chicken, 40 ml is used per 100 chickens per day. During the growth stage of laying hens, the feeding method is the same as that of broilers. After laying eggs, 20 ml is used per 100 chickens each time. When the poultry is ducks, the feeding method and dosage of ducks are the same as those of chickens. When the poultry is geese, 80 ml is used per 100 geese per day. The weight gain effect of livestock and poultry is the most obvious.

[0046] Experimental Example 2: Quality test of fattened pork with composite microalgae feed

[0047] This experiment selected large fattening pigs as the test subjects. 400 pigs under the same management conditions were selected, 100 of which were treated according to Comparative Example 2, and the rest were treated according to Examples 1-3, 100 pigs in each treatment, and the heavy metal detection results of each treatment after market release are shown in the following table:

[0048]

[0049]

[0050]

[0051]

[0052]

[0053] Compared with pork with common chlorella, the cholesterol content of Examples 1-3 is significantly reduced, the protein content is significantly increased, and the heavy metal toxin content is significantly reduced. The effect of Example 1 is more obvious than that of Examples 2 and 3, indicating that 1×10 living chlorella of the present invention 7 / mL, pinellia lectin 0.05g / mL, β-glucan 0.05g / mL, hawthorn flavonoids 0.05g / mL, maca unsaturated fatty acids 0.05g / mL. When the livestock are fattening pigs, feed the piglets once a month starting from the first day of weaning, for 10 consecutive days each time, 20 ml per pig per day. In winter, 10 ml per pig per day is more obvious in reducing the cholesterol content, increasing the protein content, and reducing heavy metal toxins in pork.

[0054] Test Example 3

[0055] Chlorella reproduction rate experiment.

[0056] This experiment selected Chlorella as the test object. 400 Chlorella mother cells under the same management conditions were selected and placed in 400 test tubes, 100 of which were treated according to Comparative Example 3, and the rest were treated according to Examples 1-3, 100 test tubes were treated in each treatment, and the culture was expanded step by step. After 4 levels of culture, the initial 1 Chlorella became 1 ton of Chlorella, and each ton of Chlorella reached 10 7 The time taken for the order of ml is shown in the following table:

[0057] project <![CDATA[10 5 / ml level time (days)]]> <![CDATA[10 6 / ml level time (days)]]> <![CDATA[10 7 / ml level time (days)]]> Comparative Example 3 77 131 180 Example 1 40 58 72 Example 2 45 72 106 Example 3 61 90 138

[0058] Compared with the culture of Chlorella using BG11 medium, the reproduction rate of Examples 1-3 was significantly improved. The culture rate of Example 1 was more significantly improved than that of Examples 2 and 3, indicating that the culture medium prepared by 0.05 g / mL of Pinellia lectin, 0.05 g / mL of β-glucan, 0.05 g / mL of hawthorn flavonoids, and 0.05 g / mL of maca unsaturated fatty acids was more effective in improving the culture rate of Chlorella.

[0059] The above generally describes the present invention in detail, but it is obvious to a person skilled in the art that some modifications or improvements can be made to the present invention. Therefore, modifications or improvements that do not depart from the spirit of the present invention are within the scope of protection of the present invention.

Claims

1. A method for preparing microalgae feed, characterized in that: The method comprises the following steps: S1, hawthorn brass extraction; S2, unsaturated fatty acid extraction from maca; S3, oat bran β-glucan extraction; S4, Pinellia ternata lectin extraction; S5. Screening of high-quality Chlorella; S6. Cultivation of Chlorella.

2. The method for preparing a microalgae feed according to claim 1, characterized in that: The S1 further comprises: crushing the dried hawthorn fruit through a 0.5 mm sieve, and drying at 105° C. for 3 hours; taking 2.5 g of hawthorn fruit powder, adding 100 ml of 70% ethanol, ultrasonically oscillating 3 times, with an ultrasonic frequency of 40 KHZ, each time for 15 minutes, with an interval of 15 minutes between each time, combining the extracts, recovering the ethanol, obtaining the hawthorn brass extract, and fixing the volume to 100 ml for later use.

3. The method for preparing a microalgae feed according to claim 1, characterized in that: The S2 further comprises: accurately weighing 10.00 g of dry maca powder, placing it in a conical flask, mixing 50 ml of methanol and 2.5 ml of hydrochloric acid, and then adding 150 ml of isooctane to the mixture to prepare a biphasic solution of hydrochloric acid-methanol and isooctane, adding 100 ml of the biphasic solution of hydrochloric acid-methanol and isooctane to the conical flask, soaking for a period of time, ultrasonically extracting for 50 minutes, the ultrasonic frequency is 40 KHZ, and extracting 3 times; filtering to remove the residue and washing the residue 3 times, and combining the filtrate; after the extraction is completed, removing the petroleum ether by rotary evaporation to obtain 2.68 g of maca unsaturated fatty acids, and fixing the volume to 100 ml for use, and the concentration of the hydrochloric acid is 1 mol / L.

4. The method for preparing a microalgae feed according to claim 1, characterized in that: The S3 further comprises: weighing 10 g of oat bran, passing through a 0.5 mm sieve, adding distilled water in proportion, mixing, heating in a water bath at a certain temperature and time, ultrasonically treating under certain conditions, with an ultrasonic frequency of 40 KHZ, centrifuging at 6000 r / min for 20 minutes, taking the supernatant, using high temperature and heat-resistant α-amylase to hydrolyze starch, adjusting the water-soluble heating temperature of the solution to 95°C, adjusting the pH to 6.5, heating for 30 minutes to hydrolyze and remove the starch in the extract, and then selecting a high temperature enzyme inactivation method to remove the amylase; under rapid stirring conditions, slowly adjusting the pH of the solution to 4.5 with 20% hydrochloric acid by mass fraction, centrifuging at 6000 r / min for 20 minutes to remove the protein in the oat bran by isoelectric precipitation, then centrifuging at 6000 r / min for 20 minutes to take the supernatant, adding 95% ethanol to precipitate, standing at 4°C for 12 hours, collecting the precipitate, freeze-drying to obtain 0.5 g of β-glucan, and set the volume to 100 ml for standby use.

5. The method for preparing a microalgae feed according to claim 1, characterized in that: The S4 further comprises: weighing about 10 grams of fresh and dry tubers respectively, crushing the samples and adding the extracting solution to the samples at a solid-liquid ratio of 1:3, ultrasonically treating for 20 minutes, extracting with 1.5% NaCl solution at 4°C for 6 hours, extracting once, centrifuging to obtain the supernatant and precipitating with ammonium sulfate to obtain a crude extract of Pinellia ternata; dialysis for desalination, centrifuging to remove the precipitate after completion to obtain the supernatant, and preparing for chromatography; balancing the chromatography column with 0.05mol / LTris-HCl (pH8.0) buffer, taking the supernatant for loading, and eluting with 500mmol / LNaCl solution for ionic strength linear gradient elution, the elution temperature is 25°C, the flow rate is 0.5mL / min, and 3mL / tube is collected with an automatic fraction collector to obtain protein peaks, and the agglutination activity of each protein peak is detected, and the collected target lectin is dialyzed for desalination and stored at -20°C for future use.

6. The method for preparing a microalgae feed according to claim 1, characterized in that: The S5 further comprises: selecting the best Chlorella mother cell, the nucleic acid sequence of which is: GGTCTAAGGATTATGCCATGCATGTCTAAGTATAAACTGCTTTATACTGTGAAACTGCGAATGGCTCATTAAATCAGTTATAGTTTATTTGATGGTACCTACTACTCGGATACCCGTAGTAAATCTAGAGCTAATACGTGCGTAAATCCCGACTTCTGGAAGGGACGTATTTATTAGATAAAAGGCCGACCGGGCTCTGCCCGACTCGCGGTGAATCATGATAACTTCACGAATCGCATGGCCTTGCGCCGGCGATGTTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGAGGCCTACCATGGTGGTAACGGGTGACGGAGGATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCTGACACAGGGAGGTAGTGACAATAAATAACAATACTGGGCCTTTTCAGGTCTGGTAATTGGAATGAGTACAATCTAAACCCCTTAACGAGGATCAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTTAAGTTGCTGCAGTTAAAAAGCTCGTAGTTGGATTTCGGGTGGGGCCTGCCGGTCCGCCGTTTCGGTGTGCACTGGTAGGGCCCACCTTGTTGCCGGGGACGGGCTCCTGGGCTTCACTGTCCGGGACTCGGAGTCGGCGCTGTTACTTTGAGTAAATTAGAGTGTTCAAAGCAGGCCTACGCTCTGAATACATTAGCATGGAATAACACGATAGGACTCTGGCCTATCCTGTTGGTCTGTAGGACCGGAGTAATGATTAAGAGGGACAGTCGGGGGCATTCGTATTTCATTGTCAGAGGTGAAATTCTTGGATTTATGAAAGACGAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAAGAACGAAAGTTGGGGGGTCGAAGACGATAAATACCGTCCAATCTCAACCTAAACGATGCCACTAGGGATGGCGGAGGTTCTTCATGACCCGCCGGACC。 7. The method for preparing a microalgae feed according to claim 1, characterized in that: The S6 further comprises: stepwise expansion and culturing of Chlorella in different containers containing hawthorn brass, maca unsaturated fatty acids, pinellia lectin, and oat bran β-glucan culture medium, until the mother cell content in each milliliter of culture medium is not less than a preset value, so as to form a composite microalgae feed; the environmental conditions for stepwise expansion and culturing are: continuous illumination, constant temperature, introduction of purified air and carbon dioxide, water pH value of 7.0-7.5, TDS value of 20-25, light intensity of 4000-4500 lux, cultivation temperature of 28-30°C, purified air pressure of 0.65-0.85 MPa, and carbon dioxide concentration in the air controlled at 15%-20%; the composite microalgae feed is in the form of a liquid preparation; preferably, in the liquid preparation, the number of living Chlorella is not less than 1×10 7 / mL, Pinellia lectin 0.01-0.05 g / mL, β-glucan 0.01-0.05 g / mL, hawthorn flavonoids 0.01-0.05 g / mL, maca unsaturated fatty acids 0.01-0.05 g / mL.

8. An application of the method for preparing microalgae feed according to any one of claims 1 to 7, characterized in that: The microalgae feed is applied in livestock and poultry breeding, and the livestock and poultry include cattle, sheep, pigs, chickens, ducks and geese. The composite microalgae feed is added to the disinfected drinking water of the animals for consumption, and the temperature of the drinking water of the animals is not higher than 40°C.

9. The use of the method for preparing microalgae feed according to claim 8, characterized in that: When the livestock and poultry are fattening pigs, start feeding the piglets on the first day after weaning, once a month, for 10 consecutive days each time, 10-20 ml per pig per day, and mix the daily feeding amount into the trough or pig feed at one time for feeding; in winter, 5-10 ml per head per day, once a day, mix the daily feeding amount into the trough or pig feed for feeding, which can prevent diarrhea. When the livestock and poultry are sows, the feeding method is the same as that of fattening pigs during the growth stage, and during the gestation period, 10-20 ml per pig per day, continue feeding until the piglets are weaned or slaughtered, and mix the daily feeding amount into the trough or pig feed at one time. The amount of the feed is mixed into the water trough or pig feed for feeding. When the livestock and poultry is cattle, the feeding method and dosage of fattening cattle are the same as those of fattening pigs. The growth stage of dairy cows is the same as that of fattening pigs. During the lactation period, 10-20 ml per cow per day is fed continuously. The feeding amount of the day is mixed into the water trough or cattle feed for feeding at one time. When the livestock and poultry is sheep, the feeding method and dosage of fattening sheep are the same as those of fattening pigs. The growth stage of dairy sheep is the same as that of fattening pigs. During the lactation period, 10-20 ml per sheep per day is fed continuously. The feeding amount of the day is mixed into the water trough or cattle feed for feeding at one time. When the poultry is chicken, each batch of broiler chickens eats it for 10 days, starting from the first day when the chicks are purchased, and continue to eat for 10 days, at a rate of 20-40 ml per 100 chickens per day, and the daily feeding amount shall be mixed into the drinking water of the chickens for feeding at one time. During the growth stage of laying hens, the feeding method is the same as that of broilers. After laying eggs, they are fed once a week, at a rate of 10-20 ml per 100 chickens each time, until they stop laying eggs, and the daily feeding amount shall be mixed into the drinking water of the chickens for feeding at one time. When the poultry is ducks, the feeding method and dosage of ducks are the same as those of chickens. When the poultry is geese, each batch of geese eats it for 10 days, starting from the first day when the goose chicks are purchased, and continue to eat for 10 days, at a rate of 40-80 ml per 100 geese per day, and the daily feeding amount shall be mixed into the drinking water of the geese for feeding at one time.

Images