Effect of Intestinia butyriproducens bacteria in anti-tumor immunotherapy

Abstract

The invention discloses an effect of an Intestinia butyriproducens bacterium in anti-tumor immunotherapy, and finds that colonization of the Intestinia butyriproducens bacterium in intestinal tracts can inhibit growth of CT26 mouse subcutaneous transplanted tumors with poor response to the tumor immunotherapy, meanwhile, growth of human colorectal cancer cells is remarkably inhibited, and apoptosis of tumor cells is promoted for the first time. The application of the Intestinia butyriproducens bacterium in the anti-tumor immunotherapy has the advantages that the effect of the intestinia butyriproducens bacterium in the anti-tumor immunotherapy is achieved, and the application of the intestinia butyriproducens bacterium in the anti-tumor immunotherapy in the anti-tumor immunotherapy in the anti-tumor immunotherapy in the anti-tumor immunotherapy is achieved. Meanwhile, after colonization of the strain and combined administration of PD-1 monoclonal antibodies, the proportion of CD8 + T cells in mouse tumor infiltration lymphocytes is increased, the proportion of depleted PD-1 + CD8 + T cells is reduced, and the proportion of CD8 + T cells releasing functional cell factors interferon gamma and granzyme B is also increased, which shows that after colonization of the strain, the curative effect of tumor immunotherapy can be enhanced, and the tumor immunotherapy effect can be enhanced. The immunoregulation capability and the great clinical application value are realized.

Description

Technical Field

[0001] The invention belongs to the field of biomedicine, and in particular relates to the role of Intestinimonas butyriciproducens bacteria in anti-tumor immunotherapy. Background Art

[0002] Colorectal cancer (CRC) is one of the most common digestive tract malignancies. Current studies have shown that immune checkpoint blockade therapy has a good therapeutic effect on CRC, but only a small number of patients with high microsatellite instability (MSI-H) or mismatch repair deficiency (dMMR) can respond to immune checkpoint blockade therapy, and most microsatellite stable (MSS) patients do not respond well to immune checkpoint blockade therapy. The intestinal flora can play an important role in regulating the "hot" and "cold" tumor microenvironment. Therefore, regulating the intestinal flora structure of MSS colorectal cancer patients is an effective intervention method to enhance the patient's immune response and improve immune checkpoint blockade therapy, and has good application prospects.

[0003] Intestinimonas butyriciproducens is a Gram-positive bacterium isolated from the intestinal contents of mice and is an anaerobic bacterium. The present invention uses a strain that has been disclosed in major strain collections, SRB-521-5-1 (DSM 26588, BNCC 364486). The bacterium has also been identified in the intestinal flora colonized in the human intestine (BUI TPN, SHETTY SA, LAGKOUVARDOS I, et al. Comparative genomics and physiology of the butyrate-producing bacterium Intestinimonas butyriciproducens [J / OL]. Environmental Microbiology Reports, 2016, 8 (6): 1024-1037. DOI: 10.1111 / 1758-2229.12483.). Current studies have shown that Intestinimonas butyriciproducens mainly produces butyric acid ( K,HANSKE L,BUI N,et al.Intestinimonas butyriciproducens gen.nov.,sp.nov.,a butyrate-producing bacterium from the mouse intestine[J / OL].International Journal of Systematic and Evolutionary Microbiology,2013,63(Pt_12):4606-4612.DOI:10.1099 / ijs.0.051441-0.), and participates in the regulation of human glucose metabolism, and can improve obesity and insulin sensitivity (ANTONIOTTI V,CAPUTO M,TINI S,et al.Intestinimonasbutyriciproducens improves glucose metabolism in subjects with obesity andprediabetes:preliminary data from a randomized controlled trial[C / OL] / / Endocrine Abstracts: Volume 90. Bioscientifica, 2023 [2024-11-26]. https: / / www.endocrine-abstracts.org / ea / 0090 / ea0090p608.). Chinese patent CN110638838A discloses the use of Akkermansia or Prevotella in the preparation of a drug for enhancing anti-tumor immune function, indicating that Akkermansia and Prevotella can reduce CD4 + T / CD8 + The expression level of PD-1 on the surface of T cells was significantly inhibited, thereby significantly inhibiting the subcutaneous transplantation of lung cancer cells, indicating that these two bacteria have an anti-tumor effect. However, the patent did not further test whether these two bacteria and the currently commonly used tumor immunotherapy, PD-1 monoclonal antibody, have the possibility of being used together in clinical medication and sensitizing PD-1 monoclonal antibody. Chinese patent CN117987297B discloses a strain of intestinal bacteria and its application in anti-tumor immunotherapy, indicating that this intestinal bacteria can increase CD8 +The level of the killer cytokine interferon gamma released by T cells enhances the therapeutic effect of PD-1 monoclonal antibodies and has an anti-tumor effect on a variety of cancers. However, the mouse model used in this patent is only the MSI type currently reported, that is, a tumor model with a high degree of response to tumor immunotherapy, and the MSS type, that is, a tumor model with poor response, has not been adopted. There are currently no research reports introducing the specific effects of Intestinimonas butyriciproducens bacteria in anti-tumor treatment. At present, there are few reports on available strains that can play an auxiliary role in the treatment of MSS-type colorectal cancer that does not respond well to immune checkpoint blockade therapy in clinical practice. Summary of the invention

[0004] Purpose of the invention: In order to solve the above technical problems, the present invention aims to provide a method for treating a tumor by using Intestinimonasbutyriciproducens in anti-tumor immunotherapy, and the use of Intestinimonasbutyriciproducens in the preparation of anti-tumor drugs, specifically, by using Intestinimonasbutyriciproducens in the preparation of CD8 + T cell anti-tumor immunity and / or enhancement of CD8 + The bacteria are used in drugs for the anti-tumor immune function of T cells, and the bacteria regulate CD8 + The infiltration level and functional activity of T cells enhance the immune response, while promoting the apoptosis of tumor cells and inhibiting the growth of tumor cells, thereby achieving the anti-tumor effect of tumor inhibition and sensitization of immune checkpoint inhibitors such as PD-1 monoclonal antibodies.

[0005] Technical solution: In order to achieve the above-mentioned purpose, the present invention provides an application of the bacterium Intestinimonasbutyriciproducens in the preparation of anti-tumor drugs.

[0006] Among them, Intestinimonas butyriciproducens bacteria are used in the preparation of enhanced CD8 + Application of T cell anti-tumor immune function in drugs.

[0007] Furthermore, the Intestinimonas butyriciproducens bacterium is any one of the following: Intestinimonas butyriciproducens bacterium body, Intestinimonas butyriciproducens bacterium lysate, Intestinimonas butyriciproducens bacterium metabolite or Intestinimonasbutyriciproducens bacterium culture supernatant.

[0008] Furthermore, the tumor is a colorectal solid tumor.

[0009] Furthermore, the Intestinimonas butyriciproducens bacteria inhibits the growth of CT26 subcutaneous transplanted tumors, inhibits the growth of human colorectal cancer cells, and promotes the apoptosis of tumor cells.

[0010] Furthermore, the enhancement of CD8 + T cell anti-tumor immune functions include: tumor-infiltrating CD8 + The proportion of T cells increased, and the exhausted PD-1 + CD8 + The proportion of T cells decreases, and CD8 cells that release functional cytokines such as interferon gamma and granzyme B + The proportion of T cells increased.

[0011] Furthermore, the enhancement of CD8 + T cell anti-tumor immune function includes CD8 + Increased T cell infiltration and / or accumulation, as well as CD8 + Enhancement of T cell anti-tumor immune function.

[0012] The invention discloses a method for enhancing systemic CD8 + T cell anti-tumor immunity and / or CD8 + A pharmaceutical composition for preventing and / or treating tumors by enhancing the anti-tumor immune function of T cells, said pharmaceutical composition comprising a pharmaceutically effective dose of Intestinimonas butyriciproducens bacteria and a pharmaceutically acceptable carrier thereof.

[0013] Among them, the Intestinimonas butyriciproducens bacteria is used in combination with an anti-tumor drug in the preparation of an anti-tumor drug.

[0014] Furthermore, the Intestinimonas butyriciproducens bacteria is used in combination with immune checkpoint blockers mainly including PD-1 monoclonal antibodies in the preparation of drugs for treating colorectal cancer.

[0015] The present invention first discovered that colonization of Intestinimonas butyriciproducens in the intestine can inhibit the growth of subcutaneous transplanted tumors in CT26 mice that do not respond well to tumor immunotherapy, and significantly inhibit the growth of human colorectal cancer cells and promote apoptosis of tumor cells. At the same time, after colonization with the bacteria and combined administration of PD-1 monoclonal antibody, CD8 + The proportion of T cells increased and the exhausted PD-1 + CD8 + The proportion of T cells decreases, and CD8 cells that release functional cytokines such as interferon gamma and granzyme B + The proportion of T cells also increased, indicating that colonization with this bacterium can increase CD8 + Infiltration and reduction of CD8 T + Depletion of T cells and enhancement of CD8 + The above results show that colonization of the bacteria can regulate immunity and enhance the anti-tumor effect of PD-1 monoclonal antibody, while enhancing the therapeutic effect of tumor immunotherapy on MSS tumors. The experimental results of the present invention confirm that colonization of the bacteria in the intestine can enhance the efficacy of tumor immunotherapy, and has immune regulation ability and great clinical application value.

[0016] In the animal experiment of the present invention, the intestinal colonization of the bacteria was completed without using antibiotics for bowel cleansing, and the anti-tumor, PD-1 antibody enhancement and immunomodulatory effects of the bacteria were verified, indicating that the bacteria can be directly used in clinical applications.

[0017] In the present invention, the intestinal colonization of Intestinimonas butyriciproducens bacteria begins after the subcutaneous transplanted tumor has grown, and it is still verified to have a significant tumor-suppressing effect, indicating that in clinical use, there is no need to supplement the bacteria in advance, and only the supplementary intervention of the bacteria in the early stage of cancer still has a good anti-tumor effect.

[0018] The present invention first discovered in a mouse subcutaneous transplant tumor model that the bacteria had anti-tumor, PD-1 antibody enhancement and immunomodulatory effects, and at the same time verified that the culture supernatant of the bacteria had the same anti-tumor effect, indicating that in addition to the bacteria being able to exert anti-tumor effects by colonizing in the intestine, the use of the culture supernatant of the bacteria can also achieve similar effects.

[0019] The present invention uses a subcutaneous transplant tumor model formed by CT26 cells to simulate MSS-type colorectal cancer. The results show that colonization of Intestinimonas butyriciproducens can improve the immune response of MSS-type colorectal cancer, enhance the efficacy of immune checkpoint blockers such as PD-1 monoclonal antibodies, and provide a new solution for the clinical treatment of MSS-type colorectal cancer that does not respond well to immunotherapy.

[0020] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages:

[0021] The present invention is the first to discover that Intestinimonas butyriciproducens can colonize the intestine and regulate CD8 + The infiltration level and functional activity of T cells enhance the immune response, while promoting the apoptosis of tumor cells such as colorectal cancer cells and inhibiting the growth of tumor cells, thereby achieving the anti-tumor effect of tumor inhibition and sensitization of immune checkpoint inhibitors such as PD-1 monoclonal antibodies.

[0022] The invention can be used in clinical anti-tumor treatment to achieve the effect of anti-colorectal cancer. It is recommended to be used in combination with immune checkpoint blockers mainly composed of PD-1 monoclonal antibodies to produce better anti-tumor effects. This discovery has good application prospects in enhancing the effect of clinical tumor immunotherapy in the treatment of microsatellite stable (MSS) colorectal cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 This is a graph showing the results of the detection of Intestinimonas butyriciproducens in the intestines of SPF mice;

[0024] Figure 2 This is a graph showing the results of the detection of Intestinimonas butyriciproducens in the intestines of CT26 tumor-bearing mice;

[0025] Figure 3 This is a graph showing the inhibitory effect of the combination of Intestinimonas butyriciproducens bacteria and PD-1 monoclonal antibody on the size of CT26 subcutaneous transplanted tumors, showing the dissected mouse tumor tissue;

[0026] Figure 4 This is the volume change curve of CT26 subcutaneous transplanted tumor every 2 days after subcutaneous inoculation in mice after the combination of Intestinimonas butyriciproducens bacteria and PD-1 monoclonal antibody;

[0027] Figure 5CD8 in tumor-infiltrating lymphocytes of CT26 subcutaneous transplanted tumors after combined treatment with Intestinimonas butyriciproducens and PD-1 monoclonal antibody + Flow cytometry analysis results of T cell ratio;

[0028] Figure 6 CD8 cells that release interferon gamma (IFN-γ) in tumor-infiltrating lymphocytes of subcutaneous transplanted tumors after combined use of Intestinimonas butyriciproducens and PD-1 monoclonal antibody + Flow cytometry analysis results of T cell ratio;

[0029] Figure 7 CD8 T cells that release granzyme B (GZMB) in subcutaneous transplanted tumors after combined use of Intestinimonas butyriciproducens and PD-1 monoclonal antibody + Flow cytometry analysis results of T cell ratio;

[0030] Figure 8 PD-1 in tumor-infiltrating lymphocytes of CT26 subcutaneous transplanted tumors after combined use of Intestinimonas butyriciproducens and PD-1 monoclonal antibody + CD8 + Flow cytometry analysis results of T cell ratio;

[0031] Fig. 9 It is a statistical curve diagram of the cell viability of colorectal cancer cells in the culture supernatant of Intestinimonas butyriciproducens bacteria at different added volume ratios;

[0032] Fig.10 It is a statistical curve diagram of the cell viability of colorectal cancer cells when the culture supernatant of Intestinimonas butyriciproducens bacteria is added at a ratio of 20%;

[0033] Fig.11 This is a fluorescence result graph showing the positive level of propidium iodide (PI) staining of colorectal cancer cells when the culture supernatant of Intestinimonas butyriciproducens was added at a ratio of 20%. DETAILED DESCRIPTION

[0034] The technical solution of the present invention is further described below in conjunction with the accompanying drawings.

[0035] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources. Experimental methods without specific conditions specified in the examples are usually carried out under conventional conditions or under conditions recommended by the manufacturer.

[0036] PD-1 monoclonal antibody: Bioxcell, BE0146.

[0037] Intestinimonas butyriciproducens was purchased from Beina Biotechnology (BNCC 364486) and is the same strain as other bacterial collections, such as DSM 26588 and CCUG 63529T.

[0038] Example 1

[0039] Intestinimonas butyriciproducens

[0040] Scrape the bacterial moss 4 times with an inoculation loop and inoculate it into Wilkins-Chalgren Anaerobe medium. Strictly control the anaerobic environment at 37°C and measure the OD every 4 days. 600 When the OD value is 0.8, it reaches the growth plateau. Take the plateau Intestinimonasbutyriciproducens bacteria and streak them on Columbia blood agar plates. Colonies with a diameter of 0.5-1mm, irregular shape, irregular edges, opaque, grayish white on the front, and flat morphology can grow. Collect and culture in a strict anaerobic environment until the plateau (OD 600 =0.8) was centrifuged at 8000 rpm for 10 min to obtain bacterial sludge, which was resuspended in physiological saline for use in viable bacteria counting.

[0041] Example 2

[0042] Verification of colonization of Intestinimonas butyriciproducens in the intestines of SPF mice

[0043] Six-week-old BALB / c mice purchased from Cavens, Changzhou, were divided into a control group and a colonization group (Ib group). After one week of adaptive feeding, the control group was gavaged with normal saline daily, and the colonization group was gavaged with 1% dapoxetine daily from the growth plateau (OD 600 =0.8) The bacterial sludge was diluted to 1×10 8100uL of Intestinimonas butyriciproducens bacterial solution with CFU / mL was added for 1 week, and the mice were allowed to eat freely during the period. One week later, the feces of the two groups of mice were collected, and the fecal DNA of the two groups of mice was extracted using a fecal DNA extraction kit (Tian Gen, DP328). PCR was performed using Intestinimonas butyriciproducens specific primers (F: CCTGACGGAGTTTTCGGACA, R: CAGTCCGGCTACTGATCGTC), and 16s rRNA universal primers (F: GAAAGCCCAATCTTCACATCAATC, R: GCATCTGGCGTGGGATGATGTTCCT) were used as internal references to calculate the relative abundance of Intestinimonas butyriciproducens in the feces to test the colonization effect. The test results are shown in the figure. Figure 1 As shown, Intestinimonas butyriciproducens bacteria can successfully colonize the intestines of SPF mice.

[0044] Example 3

[0045] Anti-CT26 Tumor Effect of Intestinimonas butyriciproducens on SPF Mice

[0046] Forty 6-week-old BALB / c mice purchased from Changzhou Cavens were randomly divided into 4 groups. After 1 week of adaptive feeding, they were divided into control group, Intestinimonas butyriciproducens colonization group, PD-1 monoclonal antibody administration group, and PD-1 monoclonal antibody combined with Intestinimonas butyriciproducens group. They were adaptively fed for 1 week and fed freely during the period. After the adaptive feeding, the mice were inoculated with 1.5×10 5 After the tumor tissue was palpable subcutaneously, the mice in the control group (Control) were intragastrically injected with normal saline every day and PBS solution every 3 days; the mice in the Intestinimonas butyriciproducens colonization group (Ib) were intragastrically injected with 100 μg / mL of CT26 cells every day from the growth plateau phase (OD 600 =0.8) The bacterial sludge was diluted to 1×10 8The mice in the PD-1 monoclonal antibody group (αPD-1) were intraperitoneally injected with 100uL of Intestinimonas butyriciproducens solution with a concentration of CFU / mL every 3 days. The mice in the PD-1 monoclonal antibody group (αPD-1) were intraperitoneally injected with 100uL of PD-1 monoclonal antibody at a concentration of 200μg / mouse every 3 days, and were gavaged with normal saline every day. The mice in the PD-1 monoclonal antibody combined with Intestinimonas butyriciproducens group (αPD-1+Ib) were gavaged with 1×10 8 CFU / mL of Intestinimonas butyriciproducens bacterial solution 100uL, and 200μg / mouse PD-1 monoclonal antibody 100uL were intraperitoneally injected every 3 days. One week later, the feces of the two groups of mice were collected, and the fecal DNA of the two groups of mice was extracted using a fecal DNA extraction kit (Tian Gen, DP328). PCR was performed using Intestinimonasbutyriciproducens specific primers (F: CCTGACGGAGTTTTCGGACA, R: CAGTCCGGCTACTGATCGTC), and 16s rRNA universal primers (F: GAAAGCCCAATCTTCACATCAATC, R: GCATCTGGCGTGGGATGATGTTCCT) were used as internal references to calculate the relative abundance of Intestinimonas butyriciproducens in feces to test the colonization effect. The test results are shown in Figure 2 As shown in the figure, in the feces of mice in the Ib group and the αPD-1+Ib group that were gavaged with Intestinimonasbutyriciproducens, the relative abundance of Intestinimonasbutyriciproducens was significantly higher than that in the Control group and the αPD-1 group that were not gavaged with Intestinimonasbutyriciproducens, indicating that Intestinimonasbutyriciproducens successfully colonized in the intestines of mice in the Ib group and the αPD-1+Ib group. During the experiment, the tumor volume was measured every 2 days, and the tumor volume was approximately calculated using "π / 2×length×width×width". After 21 days, the mice were killed by cervical dislocation, and photos were taken to compare the size of the tumor tissue. The results are shown in the figure. Figure 3 As shown in the figure, after the intestinal colonization of Intestinimonas butyriciproducens, the tumor size of the Ib and αPD-1+Ib groups was significantly smaller than that of the other two groups of mice. Figure 4As shown in the figure, after the intestinal colonization of Intestinimonas butyriciproducens bacteria, the growth of tumors can be significantly inhibited. After the combination of PD-1 monoclonal antibody, the effect of reducing tumor size and inhibiting tumor growth is more significant than the use of either alone. This shows that the intestinal colonization of Intestinimonas butyriciproducens bacteria can significantly reduce the size of CT26 tumors and inhibit tumor growth. After the combination of PD-1 monoclonal antibody, the effect of reducing tumor size and inhibiting tumor growth is more significant than the use of either alone.

[0047] Example 4

[0048] Intestinimonas butyriciproducens increases CD8 infiltrating lymphocytes in CT26 subcutaneous xenografts + T cell ratio and CD8 + T cells release interferon gamma (IFN-γ) and granzyme B (GZMB), reducing the exhaustion of PD-1 + CD8 + T cell ratio

[0049] The animal experiment model is the same as that in Example 3.

[0050] Cut 0.7-1g of subcutaneous transplanted tumor tissue from each group of mice in Example 3, cut it into pieces, and use digestion solution (CollagenaseⅡ+DNaseⅠ+DMEM) to digest the tumor tissue in a 37°C shaker at 220rpm for about 2h, and filter through a 70μm filter membrane to obtain a single cell suspension. After washing the single cell suspension with PBS, use 40% Percoll working solution to resuspend the cell pellet after centrifugation, spread it on the surface of 70% Percoll working solution, centrifuge at 950g for 20min, and perform density gradient centrifugation on the single cell suspension to separate different cell populations. The middle layer is lymphocytes. Collect the middle layer lymphocytes and wash them with PBS to obtain tumor infiltrating lymphocytes. Perform flow staining on the tumor infiltrating lymphocytes to detect CD8 + T cells, IFN-γ + CD8 + T cells, GZMB + CD8 + T cells, PD-1 + CD8 + The results showed that after colonization with Intestinimonas butyriciproducens, CD8 + The proportion of T cells increased significantly ( Figure 5 ), CD8 +The level of interferon-γ released by T cells was also significantly increased, and the exhausted PD-1 + CD8 + The proportion of T cells also decreased significantly ( Figure 8 Compared with the use of either monoclonal antibody alone, colonization with Intestinimonas butyriciproducens combined with administration of PD-1 monoclonal antibody further increased the level of interferon-γ release ( Figure 6 Although colonization with Intestinimonas butyriciproducens did not increase CD8 + The level of granzyme B released by T cells was significantly increased after combined use of PD-1 monoclonal antibody ( Figure 7 ). At the same time, after colonization with Intestinimonas butyriciproducens combined with PD-1 monoclonal antibody administration, compared with PD-1 monoclonal antibody alone, the exhausted PD-1 + CD8 + The proportion of T cells further decreased ( Figure 8 In summary, colonization with Intestinimonas butyriciproducens significantly increased CD8 + T cell ratio and CD8 + T releases IFN-γ and GZMB, reducing the exhaustion of PD-1 + CD8 + The proportion of T cells in the tumor microenvironment was significantly increased after combined use of PD-1 monoclonal antibody, indicating that Intestinimonas butyriciproducens can improve the immune response of the tumor microenvironment of MSS-type colorectal cancer.

[0051] Example 5

[0052] The culture supernatant of Intestinimonas butyriciproducens can inhibit the growth of colorectal cancer cells and promote their apoptosis

[0053] The cells were collected in Wilkins-Chalgren Anaerobe liquid medium and reached the growth plateau (OD 600=0.8) was centrifuged at 8000 rpm for 10 minutes, and the supernatant was collected. The bacteria in the supernatant were removed using a sterile 0.22 μm filter to obtain the Intestinimonas butyriciproducens culture supernatant that can be used for cell experiments. By setting a gradient of the addition ratio of the culture supernatant of Intestinimonas butyriciproducens in the culture system, that is, adding the culture supernatant of Intestinimonas butyriciproducens in the three cell culture systems of HCT116, SW480 and HT29 at a volume ratio of 0%, 1%, 5%, 8%, 10%, 12%, 15%, 18%, 20%, and 25% in the total culture system, respectively, and treating in a 37°C, 5% CO2 environment for 24 hours (24h) and 48 hours (48h), the cell viability of the three colorectal cancer cell lines was detected using the CCK8 kit, thereby comparing whether the culture supernatant of Intestinimonas butyriciproducens at different addition ratios has a significant inhibitory ability on the growth of the three colorectal cancer cell lines compared with the blank culture supernatant. The results are shown in the attached figure. Fig. 9 As shown in the figure, the optimal addition volume ratio that can inhibit the cell viability of three colorectal cancer cell lines is 20%. Fig.10 As shown, after adding 20% ​​by volume of the culture supernatant of Intestinimonas butyriciproducens bacteria to the culture system and treating the three cell lines HCT116, SW480 and HT29 in a 37°C, 5% CO2 environment for 24h and 48h, the cell viability of the three colorectal cancer cells was significantly reduced, and the result of the intervention treatment for 48h was more significant. The results indicate that the culture supernatant of Intestinimonas butyriciproducens bacteria can inhibit the growth of colorectal cancer cells.

[0054] After adding 20% ​​of the culture supernatant of Intestinimonas butyriciproducens bacteria to the culture system, the HCT116, SW480, and HT29 human colorectal cancer cell lines treated with the culture supernatant of Intestinimonas butyriciproducens bacteria for 24h and 48h were labeled with Hoechst / PI double staining, and the positive rate of intracellular PI was detected under a fluorescence microscope to verify whether the culture supernatant of Intestinimonas butyriciproducens bacteria has the ability to promote the apoptosis of colorectal cancer cells. The results are shown in the attached figure. Fig.11As shown, after 24h and 48h, the PI positivity rates of the three cell lines increased significantly, indicating that the culture supernatant of Intestinimonas butyriciproducens can promote the apoptosis of colorectal cancer cells.

[0055] The experimental results of the present invention show that Intestinimonas butyriciproducens can inhibit the growth of CT26 subcutaneous transplanted tumors, significantly inhibit the growth of human colorectal cancer cells, and promote the apoptosis of tumor cells. At the same time, in the tumor-infiltrating lymphocytes of mice colonized with the bacteria and colonized with the bacteria combined with PD-1 monoclonal antibody, CD8 + The proportion of T cells increased, and PD-1 + CD8 + The proportion of T cells decreased, IFN-γ + CD8 + T.GZMB + CD8 + The increase in the proportion of T cells indicates that colonization with this bacterium can increase the number of CD8 + Infiltration and reduction of CD8 T + Depletion of T cells and enhancement of CD8 + The above results show that colonization with this bacterium can regulate immunity and enhance the anti-tumor effect of PD-1 monoclonal antibody, while enhancing the therapeutic effect of tumor immunotherapy on MSS tumors.

[0056] In summary, the Intestinimonas butyriciproducens bacteria of the present invention can be used in clinical anti-tumor treatment to achieve the effect of anti-colorectal cancer. It is also recommended to be used in combination with immune checkpoint blockers mainly including PD-1 monoclonal antibody, which can produce better anti-tumor effects in the treatment of MSI and MSS type colorectal cancer.

Claims

1. Application of Intestinimonas butyriciproducens in the preparation of anti-tumor drugs.

2. Intestinimonas butyriciproducens bacteria in the preparation of enhanced CD8 + Application of T cell anti-tumor immune function in drugs.

3. The use according to claim 1 or 2, characterized in that: The Intestinimonas butyriciproducens bacterium is any one of the following: Intestinimonas butyriciproducens bacterium body, Intestinimonas butyriciproducens bacterium lysate, Intestinimonas butyriciproducens bacterium metabolite or Intestinimonas butyriciproducens bacterium culture supernatant.

4. The use according to claim 1 or 2, characterized in that: The tumor is a colorectal solid tumor.

5. The application according to claim 4, characterized in that: The Intestinimonas butyriciproducens bacteria inhibit the growth of CT26 subcutaneous transplanted tumors, inhibit the growth of human colorectal cancer cells, and promote the apoptosis of tumor cells.

6. The use according to claim 2, characterized in that: The enhanced CD8 + T cell anti-tumor immune functions include: tumor-infiltrating CD8 + The proportion of T cells increased, and the exhausted PD-1 + CD8 + The proportion of T cells decreases, and CD8 cells that release functional cytokines such as interferon gamma and granzyme B + The proportion of T cells increased.

7. The use according to claim 2, characterized in that: The enhanced CD8 + T cell anti-tumor immune function includes CD8 + Increased T cell infiltration and / or accumulation, as well as CD8 + Enhancement of T cell anti-tumor immune function.

8. A method for enhancing systemic CD8 + T cell anti-tumor immunity and / or CD8 + The pharmaceutical composition for preventing and / or treating tumors by enhancing the anti-tumor immune function of T cells is characterized in that: The pharmaceutical composition comprises a pharmaceutically effective dose of Intestinimonas butyriciproducens bacteria and a pharmaceutically acceptable carrier thereof.

9. Application of Intestinimonas butyriciproducens in combination with anti-tumor drugs in the preparation of anti-tumor drugs.

10. The use according to claim 9, characterized in that: The Intestinimonasbutyriciproducens bacteria is used in combination with an immune checkpoint blocker mainly composed of PD-1 monoclonal antibody in the preparation of a drug for treating colorectal cancer.

Images