Use of iridin in preparing prion drugs

Abstract

The application relates to the field of biotechnology, and particularly discloses application of iridin in preparation of a prion drug. The application finds that iridin can reduce oxidative stress caused by a prion disease model and relieve mitochondrial dysfunction caused by the prion disease model. Further, the application provides application of iridin in preparation of a drug for treating nerve cell apoptosis caused by stimulation of the prion disease. The application provides a new method for intervention of neuron problems caused by the prion disease.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and more specifically, to the application of irisin in the preparation of prion drugs. Background Technology

[0002] Prion diseases represent a group of deadly neurodegenerative diseases characterized by cellular prion proteins (PrP). C ) misfolded into the pathogenic form (PrP) Sc PrP 106-126 Peptides, corresponding to a segment of prion proteins, have become important tools for studying these diseases. This particular peptide is a synthetic peptide homologous to residues 106-126 of the human prion protein and has been found to encapsulate PrP. Sc Many of its characteristics include cytotoxicity, neurotoxicity, glial nutritional activity, proteinase-K resistance, and β-sheet structure. PrP 106-126 This study helps elucidate the role of amyloid protein structure in the neurodegenerative process of prion diseases, highlighting the importance of oligomers and prion-like diffusion in protein misfolding diseases. In summary, PrP 106-126 Peptides are an important tool in prion research, providing insights into the molecular basis of prion-induced neurotoxicity and offering pathways for developing therapeutic strategies against these devastating diseases.

[0003] Mitochondria perform many vital functions; however, they are highly susceptible to oxidative stress, which can lead to mitochondrial dysfunction and ultimately apoptosis. Mitochondria are the primary source of cellular reactive oxygen species (ROS). The UCP family, located in the inner mitochondrial membrane, can partially dissipate the proton concentration gradient within the mitochondrial membrane, playing a crucial role in controlling intracellular ROS homeostasis and preventing oxidative stress. UCP2 (Uncoupling Protein 2) (NCBI ID: 22228) is a major type in the nervous system. Recent studies have shown that UCP2 is associated with neurodegenerative diseases such as Parkinson's disease, Alzheimer's disease, and depression, and its neuroprotective function may be mediated by limiting ROS production and protecting mitochondrial function. Therefore, targeting UCP2 may have significant therapeutic implications for treating prion-induced oxidative stress and mitochondrial dysfunction. Oxidative stress plays a crucial role in the pathogenesis of prion diseases, but its underlying mechanisms remain to be elucidated.

[0004] In recent years, irisin, a newly discovered endogenous muscle hormone, is released into circulation by cleaving protein 5 (FNDC5), which contains the fibronectin type III domain. It protects neuronal health through anti-inflammatory and antioxidant effects.

[0005] Existing research has shown that decreased irisin levels in the cerebrospinal fluid of Alzheimer's patients may be an important biomarker for prediction and diagnosis, and may play a significant role in the treatment of neuronal degeneration in Parkinson's disease patients. Although Alzheimer's disease, Parkinson's disease, and prion diseases are all neurodegenerative diseases, their pathogenic mechanisms differ. The main pathogenic mechanism of Alzheimer's disease is the deposition of amyloid plaques and Tau protein tangles, while the core mechanism of Parkinson's disease is the degeneration of dopaminergic neurons in the substantia nigra and the formation of Lewy bodies. Prion diseases are caused by abnormal folding of prion proteins, leading to neuronal damage. Furthermore, their symptoms also differ; Alzheimer's disease is mainly characterized by memory loss and cognitive impairment, Parkinson's disease is primarily characterized by motor disorders, and prion diseases are characterized by rapidly progressive dementia and neurodegeneration.

[0006] While some literature reports that iris extract can treat Alzheimer's and Parkinson's diseases through BDNF or αVβ5 integrin, the pathogenesis and symptoms of Alzheimer's, Parkinson's, and prion diseases differ, making it impossible to expect similar treatments to be effective for prion diseases. Furthermore, current technology documents that acetylcholinesterase inhibitors (such as donepezil) are effective in relieving Alzheimer's symptoms but ineffective against Parkinson's and prion diseases; levodopa is a first-line treatment for Parkinson's disease but cannot be used to treat Alzheimer's or prion diseases. This existing information further supports the notion that treatment methods for these three diseases cannot be universally applied. Further research on how to treat prion diseases is still necessary. Summary of the Invention

[0007] One of the objectives of this invention is to provide a novel method for intervening in neuronal problems caused by prion diseases.

[0008] This invention provides the use of irisin in the preparation of drugs for treating prion disease-induced neuronal apoptosis, neuronal oxidative stress, or neuronal mitochondrial dysfunction.

[0009] In prion diseases, an early marker of neuronal damage is impaired mitochondrial function. Mitochondria supply energy through the respiratory chain and participate in many key intracellular functions; however, they are highly susceptible to oxidative stress, leading to dysfunction and triggering apoptosis. Irisin, an endogenous myokine, plays a crucial role in reducing mitochondrial ROS levels through mitochondrial uncoupling. UCP2, a transmembrane protein of the mitochondrial anion carrier family, located on the inner mitochondrial membrane, reduces mitochondrial ROS synthesis by promoting increased electron flux and enhancing respiratory chain activity. However, the specific role and mechanism of irisin in prion diseases remain unclear. The results of this invention demonstrate that in a prion cell model, irisin alleviates oxidative stress and mitochondrial dysfunction by activating UCP2, thereby reducing neuronal apoptosis. Furthermore, it demonstrates that UCP2 is a potential therapeutic target for prion diseases, and irisin has the potential to serve as a drug for alleviating prion diseases.

[0010] This invention also provides the use of irisin in the preparation of medicaments for treating any of the following conditions caused by prion disease:

[0011] (1) Increased levels of reactive oxygen species in mitochondria of nerve cells;

[0012] (2) Increased malondialdehyde levels in nerve cells;

[0013] (3) The ratio of reduced glutathione to oxidized glutathione in nerve cells is reduced.

[0014] (4) The activity of catalase in nerve cells is reduced;

[0015] (5) The total superoxide dismutase activity in nerve cells is reduced.

[0016] This invention also provides the use of irisin in the preparation of a medicament for treating prion disease-induced decreases in mitochondrial membrane potential, energy metabolism, mitochondrial respiratory chain complex I-IV activity, or mitochondrial DNA copy number in nerve cells.

[0017] The present invention also provides the use of irisin in the preparation of drugs that enhance the co-determination of UCP2 with mitochondria in nerve cells and / or increase the expression of UCP2.

[0018] This invention also provides the application of irisin in reducing neuronal apoptosis, neuronal oxidative stress, and neuronal mitochondrial dysfunction caused by prion disease stimulation for non-disease diagnosis or treatment purposes.

[0019] The present invention also provides the application of irisin in enhancing the co-determination of UCP2 and mitochondria in nerve cells and / or increasing UCP2 expression for purposes other than disease diagnosis or treatment.

[0020] The above-described applications of the present invention may be for non-disease diagnosis or treatment purposes, such as for pharmaceutical manufacturing, research on pathogenic mechanisms, etc.

[0021] The beneficial effects of this invention are at least as follows:

[0022] This invention reveals that oxidative stress induced by a prion disease model leads to mitochondrial dysfunction. Irisin can alleviate oxidative stress and related mitochondrial dysfunction in the prion disease model by activating UCP2. This provides a novel approach to address neuronal problems caused by prion diseases, offering a new therapeutic option for prion disease treatment. Attached Figure Description

[0023] Figure 1 This is one of the results regarding the effect of irisin on apoptosis induced by a prion disease model. AB represents N2a cells treated with irisin and PrP. 106-126 After treatment, apoptosis was assessed by Annexin V-FITC / PI flow cytometry. CD represents the results of N2a cell apoptosis assayed by TUNEL staining. Scale bar: 50 μm.

[0024] Figure 2 This is the second result of the effect of irisin on apoptosis induced by a prion disease model. AG represents the protein expression results of cleaved caspase-3, cleaved caspase-9, BAX, and Bcl-2 in N2a cells detected by Western blotting, as well as the protein expression results of cyt c in N2a cell cytoplasmic and mitochondrial extracts.

[0025] Figure 3 This presents the results of a study on the alleviating effect of irisin on neuronal mitochondrial dysfunction in a prion disease model. In the figures, AB represents mitochondrial morphology measured by confocal microscopy and mitochondrial length analyzed using ImageJ software (scale bar: 10 μm). CD represents the results of flow cytometry analysis of JC-1. E represents the mtDNA / nDNA ratio. F represents ATP levels. GJ represents the activity of mitochondrial respiratory chain complexes (I-IV) detected using a microplate chemiluminescence analyzer.

[0026] Figure 4 The results of irisin alleviating neuronal oxidative stress in a prion disease cell model are presented. AB represents the results of mtROS level analysis by flow cytometry. CF represents the levels of malondialdehyde, GSH / GSSG, catalase, and total SOD activity in N2a cells.

[0027] Figure 5This is one of the findings from a study on the protective role of irisin in a prion disease model. AC represents the mRNA levels of UCP2, UCP4, and UCP5. DE represents the change in UCP2 protein expression in N2a cells after PrP106-126 treatment.

[0028] Figure 6 This is the second set of results from a study on the protective mechanism of irisin in a prion disease model. A shows the immunofluorescence co-localization detection of mitochondrial markers DsRed-Mito and UCP2 (scale bar: 10 μm). B shows the immunofluorescence co-localization detection of FITC-irisin and UCP2 (scale bar: 10 μm). C shows the determination of N2a cell apoptosis by TUNEL staining (scale bar: 50 μm).

[0029] Figure 7 The results of a study on irisin's role in alleviating oxidative stress and maintaining mitochondrial function are presented below. A shows mitochondrial morphology measured using confocal microscopy. Scale bar: 10 μm. B shows the results of mitochondrial ultrastructure observation using transmission electron microscopy. Scale bar: 500 nm. C and E show the results of JC-1 cell analysis using flow cytometry. D shows the results of mitochondrial length analysis using ImageJ software.

[0030] Figure 8 The results of a study on irisin's role in alleviating oxidative stress and maintaining mitochondrial function are presented. A represents ATP levels. B represents the mtDNA / nDNA ratio. CF represents the activity of mitochondrial respiratory chain complexes (I-IV) detected using a microplate chemiluminescence analyzer.

[0031] In each graph (if any), * represents P<0.05, ** represents P<0.01, and *** represents P<0.001. Detailed Implementation

[0032] The preferred embodiments of the present invention will now be described in detail with reference to specific examples. It should be understood that the following examples are given for illustrative purposes only and are not intended to limit the scope of the invention. Those skilled in the art can make various modifications and substitutions to the present invention without departing from its spirit and essence.

[0033] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the materials and reagents used in the following examples are commercially available or prepared according to conventional methods in the art.

[0034] Example 1

[0035] 1. Materials and Methods

[0036] 1.1 Cell Culture

[0037] The N2a neuroblastoma cell line (ATCC#CCL-131) was purchased from the Cell Resource Center of the Chinese Academy of Medical Sciences / Peking Union Medical College and was verified to be free of mycoplasma contamination. These cells were cultured in Gibco DMEM medium (catalog number C11995500BT) supplemented with 10% fetal bovine serum (Gibco, USA) at 37°C under 5% CO2 conditions and maintained in a humid environment.

[0038] PrP 106-126 The peptide was provided by Amypeptide Biotechnology Co., Ltd., with a purity exceeding 98%, and its sequence is KTNMKHMAGAAAAGAVVGGLG (SEQ ID No. 1). The peptide was dissolved in 0.1M PBS to a storage concentration of 1mM and stirred at 4°C for 24 hours to promote aggregation.

[0039] PrP 106-126 Experimental group: The experiment was conducted under sterile conditions, with PrP added to N2a cells at a final concentration of 150 μM. 106-126 Peptide.

[0040] Iris extract (HY-P70665, MCE, USA) was dissolved in DMEM to prepare a 1 mg / ml stock solution, which was stored at -20°C.

[0041] PrP 106-126 +Irisin experimental group: Irisin was added to N2a cells at a final concentration of 100 ng / ml. Two hours after irisin administration, PrP was added at a final concentration of 150 μM. 106-126 Polypeptide.

[0042] Irisin experimental group: Irisin was added to N2a cells at a final concentration of 100 ng / ml.

[0043] The control group received no treatment.

[0044] 1.2 Plasmids and Transfection

[0045] UCP2 siRNA (positive: 5'-CTAUGAAAUCTUUGGGCUUTT-3' (SEQ ID No. 2); antisense: 5'-AAGCCCAAAGAUUUCAUAGTT-3' (SEQ ID No. 3)) and plasmid pcDNA3.1(+)-UCP2 were purchased from Synbio Technologies. DsRed-Mito plasmid was purchased from Clontech. N2a cells were transfected in Opti-MEM (31985062, Gibco, California, USA) using Lipofectamine 3000 (L3000015, Invitrogen, Carlsbad, CA, USA).

[0046] PrP 106-126 +Irisin +siUCP2 experimental group: Irisin (final concentration 100 ng / ml) was added 24 hours after cell transfection with UCP2 siRNA, and PrP was added 2 hours after irisin administration. 106-126 Peptide (final concentration 150 μM).

[0047] PrP 106-126 +siUCP2 experimental group: PrP was added 24 hours after cells were transfected with UCP2 siRNA. 106-126 Peptide (final concentration 150 μM).

[0048] Ctlr+siRNA experimental group: Cells transfected with UCP2 siRNA.

[0049] PrP 106-126 +OEUCP2 experimental group: Cells were transfected with plasmid pcDNA3.1(+)-UCP2, and PrP was added 24 hours later. 106 -126 Peptide (final concentration 150 μM).

[0050] 1.3 Flow cytometry detection of apoptosis

[0051] To quantify the apoptosis rate of cells, PrP 106-126 Experimental group, irisin + PrP 106-126Cells in the experimental group, irisin experimental group, and control group were digested with 0.25% trypsin and then subjected to protein hydrolysis with 10% FBS. The cell suspension was then centrifuged at 3000 rpm for 5 minutes, washed once with PBS, and stained with Annexin V-FITC and propidium iodide (PI) solution (C1062, Beyotime Biotechnology, China) at room temperature for 15 minutes. The percentage of apoptotic cells in each sample was then analyzed using a BD FACSCalibur flow cytometer (BD Biosciences, USA). Results are shown below. Figure 1 AB in the middle.

[0052] 1.4 TUNEL Analysis

[0053] PrP was detected using the one-step TUNEL apoptosis assay kit (C1086, Beyotime, Shanghai, China). 106-126 Experimental group, irisin + PrP 106-126 Experimental group, irisin experimental group, control group, PrP 106-126 +Irisin +siUCP2 experimental group, PrP 106-126 +siUCP2 experimental group, Ctlr+siRNA experimental group and PrP 106-126 Apoptosis in N2a cells of the +OEUCP2 experimental group. Initially, N2a cells were seeded in 24-well plates and prepared according to the manufacturer's instructions before each treatment. Apoptosis was then carefully observed and analyzed using an A1 confocal microscope (Nikon). Results are shown below. Figure 1 CD in Figure 6 C in the middle.

[0054] 1.5 Mitochondrial Function Assessment

[0055] PrP was measured using Mitosox (Thermo Fisher Scientific, Sunnyvale, CA, USA). 106 -126 Experimental group, irisin + PrP 106-126 Experimental group, irisin experimental group, control group, PrP 106-126 +Irisin +siUCP2 experimental group, PrP 106-126 +siUCP2 experimental group, Ctlr+siRNA experimental group and PrP 106-126Mitochondrial reactive oxygen species (ROS) in N2a cells of the +OEUCP2 experimental group. Mitochondrial membrane potential was assessed using the JC-1 Mitochondrial Membrane Potential Assay Kit (C2005, Beyotime, Shanghai, China). Cells were incubated in JC-1 staining solution at 37°C with 5% CO2 for 20 min, and samples were analyzed by flow cytometry. ATP levels were measured using the ATP Assay Kit (S0026, Beyotime, Shanghai, China) and a microreader from Biotec (Beijing, China). All procedures were performed according to the manufacturer's instructions. Results are shown below. Figure 3 C, D, F Figure 7 C, E, Figure 8 A in the middle.

[0056] 1.6 DNA extraction and mtDNA copy number determination

[0057] Genomic DNA was extracted from PrP using a universal genomic DNA extraction kit (CW2298S, CWBIO, CWBIO, CEAN, China). 106-126 Experimental group, irisin + PrP 106-126 Experimental group, irisin experimental group, control group, PrP 106-126 +Irisin +siUCP2 experimental group, PrP 106-126 +siUCP2 experimental group, Ctlr+siRNA experimental group and PrP 106-126 Total DNA was isolated from N2a cells in the +OEUCP2 experimental group and quantified using a spectrophotometer (Nanodrop 2000). The experiment utilized a VIIA7 rapid real-time PCR system (ABI) and SYBR Green Master Mix (Q141-02; Vazyme, Nanjing, China) for qPCR. Quantification was based on mtDNA (forward: 5'-CCTATCCCTTGCCATCAT-3' (SEQ ID No. 4) and reverse: 5'-GAGGCTTGTTGCTTGTGTGTGTGTGAC-3' (SEQ ID No. 5)) and genomic DNA (gDNA), using a comparative CT method (2...). -ΔΔCT The calculation was performed. The results are shown below. Figure 3 E in Figure 8 B in the middle.

[0058] 1.7 Measurement of mitochondrial respiratory chain complex

[0059] The activity of mitochondrial respiratory chain complexes I, II, III, and IV was evaluated according to the manufacturer's instructions (Solarbio, Beijing, China). PrP was measured separately using a Biotek (Beijing, China) microreader. 106-126 Experimental group, irisin + PrP 106-126 Experimental group, irisin experimental group, control group, PrP 106-126 +Irisin +siUCP2 experimental group, PrP 106-126 +siUCP2 experimental group, Ctlr+siRNA experimental group and PrP 106-126 The results were measured in the +OEUCP2 experimental group. Figure 3 GJ in the middle, Figure 8 CF in the middle.

[0060] 1.8 Measurement of Oxidative Stress

[0061] Antioxidant defense markers in N2a cells include superoxide dismutase (SOD), catalase (CAT), malondialdehyde (MDA), and the glutathione / oxidized glutathione ratio (GSH / GSSG). (Targeting PrP) 106-126 Experimental group, irisin + PrP 106-126 Experimental group, irisin experimental group, control group, PrP 106-126 +Irisin +siUCP2 experimental group, PrP 106 -126 +siUCP2 experimental group, Ctlr+siRNA experimental group and PrP 106-126 The +OEUCP2 experimental group was assessed for glutathione ratio (GSH / GSSG) following the manufacturer's instructions (Nanjing Jianering Bibionering Instristions). Superoxide dismutase (SOD), catalase (CAT), and malondialdehyde (MDA) were measured. These assays were performed using a Biotec (Beijing, China) microplate reader. To determine mtROS levels in cells, cells were digested with 0.25% trypsin and then neutralized with 10% fetal bovine serum to neutralize proteolytic proteins. The cell suspension was centrifuged at 3000 rpm for 5 min, washed once with PBS, and then mixed with MitoSOX (2 μM, Thermo Fisher Scientific, Sunnyvale, CA, USA) for 30 min, followed by two PBS washes and flow cytometry analysis (BD Biosciences, Franklin Lakes, NJ, USA). Results are shown below. Figure 4 AF in the middle.

[0062] 1.9 Immunofluorescence staining

[0063] For PrP 106-126 Experimental group, irisin + PrP 106-126 Experimental group, irisin experimental group, control group, PrP 106-126 +Irisin +siUCP2 experimental group, PrP 106-126 +siUCP2 experimental group, Ctlr+siRNA experimental group and PrP 106-126 The +OEUCP2 experimental group was used for testing. Compared to the above experimental group preparation methods, this experiment changed the procedure before treatment. For experimental groups that originally did not have a transfection step, a step of transfecting mitochondrial N2a cells with DSRED-MITO for 24 hours was added. For experimental groups that originally had a transfection step, DSRED-MITO was added during transfection to co-treat mitochondrial N2a cells for 24 hours before subsequent operations were performed for each group. Cells were washed twice with PBS and fixed with 4% paraformaldehyde for 30 minutes. Then, the cells were permeabilized for 5 minutes with permeabilization buffer containing Triton X-100 (Beyotime Biotechnology, p0096) for immunostaining. After blocking for one hour at room temperature, the cells were incubated overnight at 4°C with a specific primary antibody (as described in the "Immunoblotting" section). Secondary antibody was applied at 37°C for 1 hour, and then the cells were mounted with an anti-quenching agent containing DAPI. Fluorescence images were acquired using an A1 confocal microscope (Nikon, Tokyo), and quantification was performed using ImageJ software. Results are shown below. Figure 3 AB in Figure 6 AB in Figure 7 A and D in the equation.

[0064] 1.10 Western Blotting of Proteins

[0065] For PrP 106-126 Experimental group, irisin + PrP 106-126N2a cells were homogenized in RIPA buffer (R0010, Solarbio Life Sciences, China Beijing, China) for experimental, irisin-based, and control groups. After recovery, the lysates were incubated on ice for 30 min and centrifuged at 12,000 rpm for 10 min at 4 °C. Protein concentration was determined using the BCA method. Equal amounts of protein were eluted onto 10%–15% SDS-PAGE gels and then transferred to PVDF membranes using a standard protocol. The following antibodies were primarily used for Western blotting: Caspase 3 (19677-1-AP, ProteIntech), Caspase 9 (10380-1AP, ProteIntech), Bax (50599-2-Ig, ProteIntech), BCL2 (68103-1-ig, ProteIntech), Cytochrome c (66264-1-IG, ProteIntech), UCP2 (11081-1-AP, ProteIntech), CoxⅣ (11242-1-ap, ProteIntech), GAPDH (60004-1-Ig, ProteIntech), and α-tubulin (11224-1-AP, Proteintech). Secondary antibodies included HRP-conjugated goat anti-mouse (ZB-2305, ZSBIO) and HRP-conjugated goat anti-rabbit (ZB-2301, ZSBIO). The imprints were visualized using a chemiluminescence imaging system (Tanon Science & Technology). Results are shown below. Figure 2 AG in Figure 5 DE in the middle.

[0066] 1.11 Real-time quantitative PCR

[0067] For PrP 106-126Experimental and control groups were established. First, N2a cell samples obtained from the experiment were homogenized using TRIZOL reagent (R401-01, Vazyme, Nanjing, China). Total RNA was extracted from the homogenized tissue following the manufacturer's instructions. After determining the RNA sample concentration, 1 μg of RNA was transcribed into cDNA using Hisscript II Select SuperMix (R312-02, Vazyme, Nanjing, China). The experiment was analyzed using quantitative real-time PCR (QPCR) with a gene-specific primer set and SYBR Green Master Mixture (Q141-02; Vazyme, Nanjing, China). Fluorescence changes were monitored using a VIIA 7 Rapid Real-Time PCR System (ABI) to record and analyze the experimental process. The primers used are listed in Table 1. Results are shown in [Table 1]. Figure 5 AC in the context.

[0068] Table 1 Primer sequences (SEQ ID No. 6-13)

[0069] Gene name Upstream primer sequence (5′-3′) Downstream primer sequence (5′-3′) UCP2 TAAAGGTCCGCTTCCAGGCTCA TAAAGGTCCGCTTCCAGGCTCA UCP4 TCTACGGGAAGTCGTGTTTGGC AACTGTCCGATGACACCAGCCA UCP5 GTGCTGCAATCGTTGTGGGAGT GCCAAACCACAGGTGAAACTGG GAPDH CATCACTGCCACCCAGAAGACTG ATGCCAGTGAGCTTCCCGTTCAG

[0070] 1.12 Electron Microscope

[0071] For PrP 106-126 Experimental group, irisin + PrP 106-126 Experimental group, control group, PrP 106-126 +Irisin +siUCP2 experimental group, PrP 106-126 +siUCP2 experimental group, Ctlr+siRNA experimental group and PrP 106-126 In the +OEUCP2 experimental group, N2a cells were collected, centrifuged in centrifuge tubes, and then fixed with 2.5% glutaraldehyde at 4°C for 12 hours. The samples were then observed using a transmission electron microscope (HITACHI HT7700, Japan). Results are shown below. Figure 7 B in the middle.

[0072] 1.13 Statistical Analysis

[0073] Data are expressed as mean ± standard deviation (SD) and analyzed using Prism 8.0 software. Statistical comparisons were performed using multiple comparisons, either unpaired student t-tests or Tukey's post-hoc tests. Differences were considered statistically significant at p < 0.05.

[0074] 2 Results

[0075] 2.1 Irisin reduces prion-induced apoptosis in a disease model

[0076] This invention utilizes an Annexin V-based fluorescent labeling method to evaluate the effect of irisin on PrP. 106-126 The effects of PrP-mediated N2a cell neurotoxicity. Results showed that PrP... 106-126 In the group, compared with the control group, apoptosis was significantly increased, and in PrP 106 -126 In cells treated with irisin, this increase was significantly reduced. TUNEL staining results also indicated that, compared to PrP alone... 106-126 Compared to other treatments, irisin pretreatment significantly reduced apoptosis. Furthermore, Western blot analysis revealed that irisin treatment significantly reduced caspase-3 and caspase-9 cleavage, decreased Bax protein expression, increased Bcl-2 expression, and decreased cyt C release, all indicating that irisin can alleviate mitochondrial-dependent apoptosis pathways. Figure 1 ,2).

[0077] 2.2 Iris extract alleviates neuronal mitochondrial dysfunction in a prion disease model

[0078] In evaluating the effect of irisin on PrP 106-126 In its mediated neurotoxic protective effect, this invention explores the potential mechanism by which it prevents mitochondrial dysfunction. In the control group, N2a cells exhibited an intact mitochondrial network, while PrP... 106-126 The treatment group showed significant disruption of the mitochondrial network, indicating damage to mitochondrial structure. In contrast, cells in the irisin-treated group showed improved mitochondrial network status. 106-126 The low mitochondrial membrane potential in the treatment group further indicated impaired mitochondrial function. The addition of irisin led to the restoration of mitochondrial membrane potential, suggesting that irisin can prevent PrP. 106-126 This leads to mitochondrial dysfunction. Furthermore, ATP, as a key indicator of cellular energy metabolism, plays a crucial role in PrP... 106-126 The levels of ATP were significantly reduced in the irisin-treated group, while significantly increased in the irisin-treated group, suggesting that irisin may promote the recovery of mitochondrial function by improving energy metabolism. Changes in mitochondrial membrane potential and ATP levels were accompanied by changes in the activity of mitochondrial respiratory chain complexes (Complex I-IV). 106-126 Treatment with irisin significantly reduced the activity of these complexes, while the addition of irisin significantly enhanced their activity and increased the copy number of mitochondrial DNA. In conclusion, irisin effectively restored the activity of PrP-mediated complexes. 106 -126 Induced mitochondrial dysfunction Figure 3 ).

[0079] 2.3 Iris extract alleviates neuronal oxidative stress in a prion disease cell model

[0080] Given that oxidative stress is a key factor in causing mitochondrial dysfunction, this invention investigated its effect on PrP. 106-126 Effects of induced oxidative stress. Experimental results showed that irisin treatment significantly reduced PrP. 106-126 Mitochondrial reactive oxygen species levels in treated N2a cells. Furthermore, compared to PrP alone... 106-126 Iris extract treatment significantly reduced malondialdehyde (MDA) levels in cells, increased the ratio of reduced glutathione (GSH) to oxidized glutathione (GSSG), and increased the activities of catalase (CAT) and total superoxide dismutase (T-SOD). These results consistently indicate that iris extract can alleviate PrP. 106-126 Induced mitochondrial dysfunction is achieved through resistance to oxidative stress. Figure 4 ).

[0081] 2.4 Irisin exerts protective effects in prion disease models via UCP2

[0082] The results of this invention show PrP 106-126 Treatment did not alter the expression levels of UCP4 and UCP5, but it decreased the expression level of UCP2. In contrast, irisin treatment enhanced the co-storage of UCP2 with mitochondria and upregulated the expression of PrP. 106-126 Downregulated UCP2 expression. To understand the effect of irisin on PrP... 106-126 The potential mechanism of UCP2 protection after treatment: This invention utilizes FITC-labeled irisin to treat PrP. 106-126 In the treated N2A cells, the results showed that FITC-iridin co-localization with UCP2 was observed after FITC-iridin treatment. Further investigation was conducted to demonstrate the role of UCP2 in the iridin-mediated PrP... 106-126 The protective effect of N2A cells after treatment: This invention found that in cells with knocked-down UCP2, irisin failed to alleviate PrP. 106-126 UCP2-overexpressing cells induce apoptosis, while cells overexpressing UCP2 are susceptible to PrP. 106-126 The induced apoptosis had a mitigating effect. This indicates that UCP2 plays a role in the effect of irisin on PrP. 106-126 The treated N2a cells played a key role in the protective effect provided by the treatment. Figure 5 ,6).

[0083] 2.5 Irisin alleviates oxidative stress and maintains mitochondrial function through UCP2.

[0084] To further explore the role of UCP2 in irisin-mediated PrP 106-126The effects of irisin on oxidative stress and mitochondrial dysfunction in treated N2a cells were investigated. By using siRNA to knock down UCP2, this invention found that the mitigating effect of irisin on mtROS production was weakened after UCP2 knockdown. This invention also found that UCP2 knockdown counteracted the irisin-mediated effect on PrP... 106-126 The beneficial effects of irisin on lipid peroxidation and oxidative damage in treated N2a cells were observed, as were unchanged MDA, GSH / GSSG, CAT activity, and T-SOD levels. Furthermore, in cells with knocked-down UCP2 expression, irisin had a positive effect on PrP... 106-126 Induced mitochondrial function loss in N2a cells resulted in a loss of protective effects. Irisin treatment failed to restore the mitochondrial network state when UCP2 expression was reduced, and electron microscopy revealed abnormal mitochondrial ultrastructure. However, both irisin-treated and UCP2-overexpressing cells showed remodeling of mitochondrial cristae and reduced swelling. This was further confirmed by decreased mitochondrial membrane potential, ATP levels, mtDNA copy number, and electron transport chain complex activity (I-IV). These results suggest that irisin alleviates PrP through UCP2 expression. 106-126 Induced oxidative stress and mitochondrial dysfunction Figure 7 ,8).

[0085] 3. Conclusion

[0086] Prion diseases are a group of fatal neurodegenerative diseases characterized by the abnormal folding of cellular prion proteins into pathogenic forms. The development of prion diseases is closely related to oxidative stress and mitochondrial dysfunction. Irisin, an endogenous myokine, protects neuronal health through its antioxidant properties. However, it remains unclear whether irisin offers any protection against prion diseases. This invention found that exogenous irisin treatment can reduce prion-induced apoptosis. Simultaneously, exogenous irisin significantly reduces prion-induced oxidative stress and alleviates prion-induced mitochondrial dysfunction. Furthermore, irisin treatment can target UCP2, significantly improving prion-induced oxidative stress and mitochondrial dysfunction in N2a cells. These effects of irisin in prion disease cell models are blocked by UCP2 knockdown. These results suggest that irisin is a novel and promising early intervention method for treating prion diseases.

[0087] In summary, this invention reveals that oxidative stress induced in prion disease models leads to mitochondrial dysfunction, which may be one of the causes of prion pathogenesis. Irisin can alleviate oxidative stress induced in prion disease models and reduce mitochondrial dysfunction by activating UCP2. In conclusion, these data suggest that irisin has potential therapeutic value in prion diseases.

[0088] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.

Claims

1. Application of irisin in the preparation of drugs for treating prion diseases.

Images