Application of reagent for reducing phosphorylation level of HDAC8 protein in preparation of product for improving sensitivity of tumor cells to chemotherapy and / or radiotherapy

Abstract

The invention relates to the technical field of biological medicines, in particular to application of a reagent for reducing the phosphorylation level of an HDAC8 protein S83 site in preparation of a product for improving the sensitivity of tumor cells to chemotherapy and / or radiotherapy. According to the application disclosed by the invention, the ATM protein phosphorylates the HADC8S83 site after DNA (Deoxyribose Nucleic Acid) is damaged, so that the crotonylation modification of MRE11 is reduced, the homologous recombination repair of DNA double-chain breakage is inhibited, the radiotherapy and chemotherapy sensitivity of tumors is promoted, and the radiotherapy and chemotherapy sensitivity of tumor cells can be effectively enhanced by reducing the phosphorylation level of the HDAC8 protein, so that the curative effect of radiotherapy and chemotherapy is improved. The invention provides a novel cancer (especially cervical cancer) treatment target, and the target can be effectively used for cervical cancer treatment scheme selection and has a clinical application prospect.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to the use of a reagent for reducing the phosphorylation level of HDAC8 protein in the preparation of a product for improving the sensitivity of tumor cells to chemotherapy and / or radiotherapy. Background Art

[0002] In the clinical treatment of tumors, radiotherapy and chemotherapy are two commonly used methods. Clinically, in order to improve the therapeutic effect of tumors and reduce the risk of recurrence and metastasis, a combination of radiotherapy and chemotherapy is often used. In this way, the response of tumor cells to radiation and chemotherapy drugs can be enhanced, that is, radiotherapy and chemotherapy sensitivity. Radiotherapy and chemotherapy sensitivity determines the efficacy and prognosis of radiotherapy and chemotherapy, and it is affected by many factors, including tumor type, stage, molecular characteristics, microenvironment, cell cycle, DNA damage repair ability, etc. In general, tumor cells with strong DNA damage repair ability are more resistant to radiotherapy and chemotherapy, while tumor cells with weak DNA damage repair ability are more sensitive to radiotherapy and chemotherapy. Therefore, by inhibiting the DNA damage repair ability of tumor cells and enhancing the sensitivity of tumor cells to radiotherapy and chemotherapy, the efficacy of radiotherapy and chemotherapy can be improved. In DNA damage repair, ATM and HDAC8 are two important DNA damage repair-related factors, which play an important role in the regulation of radiotherapy and chemotherapy sensitivity.

[0003] ATM is a protein kinase that senses and repairs DNA double-strand breaks and has sequence homology with PI3K (phosphphoinositide 3-Kinase). ATM is a key regulator of multiple signaling cascades and responds to DNA strand breaks caused by IR (ionizing radiation), radiation agents, or normal processes. These responses include activation of cell cycle Chk factors (checkpoint factors), DNA repair, and apoptosis. Its downstream targets include CHK1 (cell cycle checkpoint kinase-1), CHK2 (cell cycle checkpoint kinase-2), tumor suppressors such as p53 and BRCA1, DNA repair factors such as Rad50, Rad51, and other signaling molecules such as c-Abl and NF-KappaB. It plays an important role in maintaining genome stability and inhibiting tumorigenesis.

[0004] HDAC8 is histone deacetylase 8, which was first discovered in neuroblastoma cells. Due to its potential effects in promoting tumor cell growth, later studies have found that HDAC8 is also involved in multiple key signaling pathways in the body, which has attracted much attention from researchers. It can remove the acetyl groups of histones H3 and H4, thereby affecting the structure and function of chromatin and regulating gene expression and transcription. HDAC8 is overexpressed in many tumors. As a key enzyme that catalyzes histone deacetylation, it is involved in many processes such as tumor cell proliferation and apoptosis and the regulation of genetic information. HDAC8 dysfunction can lead to the accumulation of DNA damage, thereby causing genomic instability, cell apoptosis and tumorigenesis. At present, HDAC8 has become a potential therapeutic target for many diseases. However, there are no reports on how ATM regulates HDAC8 to affect DNA repair and thus affect the sensitivity of tumor cells to radiotherapy and chemotherapy. Summary of the invention

[0005] In order to solve the above problems, the present invention provides the use of an agent for reducing the phosphorylation level of HDAC8 protein in the preparation of a product for improving the sensitivity of tumor cells to chemotherapy and / or radiotherapy. The present invention has found that reducing the phosphorylation level of HDAC8 protein can effectively enhance the sensitivity of tumor cells to radiotherapy and chemotherapy, thereby improving the efficacy of radiotherapy and chemotherapy.

[0006] In order to achieve the above object, the present invention provides the following technical solutions:

[0007] The present invention provides the use of a reagent for reducing the phosphorylation level of the S83 site of the HDAC8 protein in the preparation of a product for improving the sensitivity of tumor cells to chemotherapeutic drugs and / or radiotherapy, wherein the S83 site of the HDAC8 protein is the 83rd amino acid residue of the HDAC8 protein.

[0008] Preferably, the reagent for reducing the phosphorylation level of the HDAC8 protein S83 site includes: a gene editing reagent for reducing the phosphorylation level of the HDAC8 protein S83 site and / or an ATM protein kinase inhibitor.

[0009] Preferably, the gene editing reagent that reduces the phosphorylation level of the HDAC8 protein S83 site includes: a gene editing reagent that mutates the serine at position 83 of the HDAC8 protein to alanine.

[0010] Preferably, the gene editing reagent that mutates serine at position 83 of the HDAC8 protein to alanine comprises sgRNA; the sgRNA consists of sgRNA-F and sgRNA-R; the nucleotide sequence of the sgRNA-F is shown in SEQ ID NO.1, and the nucleotide sequence of the sgRNA-R is shown in SEQ ID NO.2.

[0011] Preferably, the tumor comprises cervical cancer.

[0012] Preferably, said increasing the sensitivity of tumor cells to chemotherapy and / or radiotherapy includes increasing the sensitivity of tumor cells to chemotherapy and / or radiotherapy drugs.

[0013] Preferably, the chemotherapy drug comprises Olaparib.

[0014] Preferably, the radiation source of the radiotherapy comprises Co 60 ray.

[0015] Preferably, the ionizing radiation dose of the radiotherapy is ≥2Gy.

[0016] Preferably, the agent for reducing the phosphorylation level of HDAC8 protein increases the crotonylation of MRE11 protein, reduces the interaction between HADC8 protein and MRE11 protein, inhibits HR repair, and increases the sensitivity of tumor cells to chemotherapy and / or radiotherapy.

[0017] Beneficial effects:

[0018] The present invention provides an application of a reagent for reducing the phosphorylation level of the S83 site of the HDAC8 protein in the preparation of a product that increases the sensitivity of tumor cells to chemotherapy and / or radiotherapy, wherein the S83 site of the HDAC8 protein is the 83rd amino acid residue of the HDAC8 protein. The present invention finds that the ATM protein phosphorylates the HADC8 S83 site after DNA damage, thereby reducing the crotonylation modification of MRE11, inhibiting the homologous recombination repair of DNA double-strand breaks, and promoting the sensitivity of tumor radiotherapy and chemotherapy. Reducing the phosphorylation level of the HDAC8 protein can effectively enhance the sensitivity of tumor cells to radiotherapy and chemotherapy, thereby improving the efficacy of radiotherapy and chemotherapy. The present invention provides a new therapeutic target for cancer (especially cervical cancer), which can be effectively used in the selection of cervical cancer treatment plans and has clinical application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required to be used in the embodiments are briefly introduced below.

[0020] Figure 1 The result is that ATM phosphorylates HDAC8 S83 to promote the decrotonylation of MRE11 after DNA damage;

[0021] Figure 2 The result is that HDAC8 S83 phosphorylation promotes MRE11 recruitment and HR repair. DETAILED DESCRIPTION

[0022] The present invention provides the use of a reagent for reducing the phosphorylation level of the S83 site of the HDAC8 protein in the preparation of a product for improving the chemotherapy and / or sensitivity of tumor cells, wherein the S83 site of the HDAC8 protein is the 83rd amino acid residue of the HDAC8 protein; the 83rd amino acid residue of the HDAC8 protein of the present invention is specifically a serine residue.

[0023] In the present invention, the reagent for reducing the phosphorylation level of the S83 site of the HDAC8 protein preferably includes: a gene editing reagent and / or an ATM protein kinase inhibitor for reducing the phosphorylation level of the S83 site of the HDAC8 protein; the gene editing reagent for reducing the phosphorylation level of the S83 site of the HDAC8 protein preferably includes: a gene editing reagent that mutates the 83rd serine of the HDAC8 protein to alanine; the gene editing reagent that mutates the 83rd serine of the HDAC8 protein to alanine preferably includes sgRNA; the sgRNA preferably consists of sgRNA-F and sgRNA-R; the nucleotide sequence of the sgRNA-F is preferably as shown in SEQ ID NO.1, and the nucleotide sequence of the sgRNA-R is preferably as shown in SEQ ID NO.2, specifically as follows:

[0024] SEQ ID NO.1: 5'-CACCGAGAAGGTCAGGGAAGAGGG-3';

[0025] SEQ ID NO. 2: 3'-CTCTTCCAGTCCCTTCTCCCCAAA-5'.

[0026] In the present invention, the tumor preferably includes cervical cancer; the method of increasing the sensitivity of tumor cells to chemotherapy and / or radiotherapy preferably includes increasing the sensitivity of tumor cells to chemotherapy and / or radiotherapy drugs; the chemotherapy drugs preferably include Olaparib; the radiation source of radiotherapy preferably includes Co 60 The ionizing radiation dose of the radiotherapy is preferably ≥2Gy; the reagent that reduces the phosphorylation level of HDAC8 protein increases the crotonylation of MRE11 protein, reduces the interaction between HADC8 protein and MRE11 protein, inhibits HR repair, and increases the sensitivity of tumor cells to chemotherapy and / or radiotherapy.

[0027] The present invention reduces the phosphorylation level of HDAC8 protein after irradiation by mutating the 83rd site of HDAC8 protein in human cervical cancer cells HeLa. Compared with wild-type cells, the mutated HADC8 protein can increase the sensitivity of HeLa cells to ionizing radiation, and the survival rate of HeLa cells after HADC8 protein mutation is significantly lower than that of the wild-type group. At the same time, the mutated HADC8 protein can also increase the inhibitory effect of the chemotherapy drug Olaparib on the proliferation activity of HeLa cells, which is beneficial to the performance of anticancer drugs. It can be seen that reducing the phosphorylation level of HDAC8 protein can increase the sensitivity of cells to chemotherapy or radiotherapy.

[0028] In order to further illustrate the present invention, the application of the reagent for reducing the phosphorylation level of HDAC8 protein provided by the present invention in the preparation of a product for improving the sensitivity of tumor cells to chemotherapy and / or radiotherapy is described in detail below in conjunction with the accompanying drawings and examples, but they should not be construed as limiting the scope of protection of the present invention.

[0029] Example 1

[0030] The cell lines used in the present invention are as follows: a wild-type cell line and an HDAC8 S83 mutant cell line; the wild-type cell line is a cervical cancer cell HeLa line.

[0031] 1. Construction of HDAC8 S83 mutant cell line

[0032] A human cervical cancer cell line HeLa with a histone deacetylase 8 (HDAC8) mutation (denoted as HDAC8 S83 mutant cell line) was constructed by Beijing Jiman Biotechnology Co., Ltd. The sgRNA sequences are shown in SEQ ID NO.1 and SEQ ID NO.2; the HDAC8 S83 mutant cell line is a cell line in which the 83rd serine (S) of the HDAC8 protein is mutated to alanine (A). By Western detection, the HDAC8 protein in the mutant line can be expressed normally ( Figure 1 Middle G, input group, IB: FLAG HDAC8) and it cannot be phosphorylated by ATM ( Figure 1 Medium G,denature IP-Flag,IB:Ps / T).

[0033] 2. Using pcDNA3.1 vector as the basic plasmid, we commissioned Sino-US Taihe Biotechnology (Beijing) Co., Ltd. to construct the following recombinant plasmids:

[0034] pcDNA3.1-FLAG-MRE11;

[0035] pcDNA3.1-Myc-MRE11;

[0036] pcDNA3.1-FLAG-HDAC8WT (wild type);

[0037] pcDNA3.1-FlAG-HDAC8 S39A (serine (S) at position 39 was mutated to alanine (A));

[0038] pcDNA3.1-FLAG-HDAC8 S63A (serine (S) at position 63 was mutated to alanine (A));

[0039] pcDNA3.1-FLAG-HFAC8 S83A (serine (S) at position 83 was mutated to alanine (A);

[0040]

[0041] The HDAC8 gene was inserted into the ECORI site of pcDNA3.1. The nucleotide sequence of the MRE11 gene is shown in SEQ ID NO.4, specifically: 5'-atggaggagccggaggaaccggcggacagtgggcagtcgctggtcccggtttatatctatagtcccgagtatgtcagt atgtgtgactccctggccaagatccccaaacgggccagtatggtgcattctttgattgaagcatatgcactgcataagcagatgaggatagttaagcctaaagtggcctccatggaggagatggccaccttccacactgatgcttatctgcagcatctccagaaggtcagccaagagggcgatgatgatcatccggactccatagaatatgggctaggttatgactgcccagccactgaagggatatttgactatgcagcagctataggaggggctacgatcacagctgcccaatgcctgattgacggaatgtgcaaagtagcaattaactggtctggagggtggcatcatgcaaagaaagatgaagcatctggtttttgttatctcaatgatgctgtcctgggaatattacgattgcgacggaaatttgagcgtattctctacgtggatttggatctgcaccatggagatggtgtagaagacgcattcagtttcacctccaaagtcatgaccgtgtccctgcacaaattctccccaggatttttcccaggaacaggtgacgtgtctgatgttggcctagggaagggacggtactacagtgtaaatgtgcccattcaggatggcatacaagatgaaaaatattaccagatctgtgaaagtgtactaaaggaagtataccaagcctttaatcccaaagcagtggtcttacagctgggagctgacacaatagctggggatcccatgtgctcctttaacatgactccagtgggaattggcaagtgtcttaagtacatccttcaatggcagttggcaacactcattttgggaggaggaggctataaccttgccaacacggctcgatgctggacatacttgaccggggtcatcctagggaaaacactatcctctgagatcccagatcatgagtttttcacagcatatggtcctgattatgtgctggaaatcacgccaagctgccggccagaccgcaatgagccccaccgaatccaacaaatcctcaactacatcaaagggaatctgaagcatgtggtctag-3';

[0042]

[0043]

[0044]

[0045] 3. Plasmid transfection

[0046] (1) Grow the wild-type human HeLa cell line and the HDAC8 S83 mutant HeLa cell line to a concentration of 60% to 70%, respectively. According to the experimental requirements, use lipo2000 to transfect the transfection plasmid (pcDNA3.1-FLAG-MRE11 or pcDNA3.1-FLAG-HDAC8 WT) into the cells, respectively. The volume ratio of lipo2000 to plasmid is 1:2.5, and the final concentration of the plasmid is 4 μg / dish. Replace the culture medium with fresh medium 6 hours after transfection to obtain wild-type cell lines or mutant cell lines transiently expressing FLAG-MRE11 or FLAG-HDAC8. During the plasmid transfection process, cells transfected with pcDNA3.1 plasmid were used as controls;

[0047] (2) Mix pcDNA3.1-flag-MRE11 and pcDNA3.1-FLAG-HDAC8 WT plasmids at a plasmid ratio of 2:1 to obtain a transfection plasmid; grow the wild-type human HeLa cell line to a concentration of 60% to 70%, and transfect the obtained transfection plasmid into the cells using lipo2000 according to experimental requirements, wherein the volume ratio of lipo2000 to transfection plasmid is 1:2.5, and the final concentration of the transfection plasmid is 4 μg / dish. Replace fresh culture medium 6 hours after transfection to obtain a wild-type cell line transiently expressing FLAG-MRE11 and FLAG-HDAC8.

[0048] (3) Mix pcDNA3.1-Myc-MRE11 and pcDNA3.1-FLAG-HDAC8 plasmids (WT, S39A, S63A or S83A) at a mass ratio of 2:1 to obtain a transfection plasmid; grow the wild-type human HeLa cell line to a concentration of 60% to 70%, and transfect the obtained transfection plasmid into the cells using lipo2000 according to experimental requirements, wherein the volume ratio of lipo2000 to transfection plasmid is 1:2.5, and the final concentration of the transfection plasmid is 4 μg / dish. Replace fresh culture medium 6 hours after transfection to obtain a wild-type cell line transiently expressing Myc-MRE11 and FLAG-HDAC8.

[0049] 4. Irradiation treatment

[0050] Before irradiation, ATM inhibitor (KU-55933, final concentration of 10 nM), DNA-PK inhibitor (NU7441, final concentration of 10 nM) and Olaparib (final concentration of 10 nM) were added to wild-type cell lines and mutant cell lines. 60 4Gy of radiation.

[0051] 5. Western blotting

[0052] Western blotting was used to verify that ATM phosphorylates HDAC8 S83 after DNA damage to promote decrotonylation of MRE11. The test results are as follows Figure 1 As shown in A, E to G and I. Among them, A is the result of Western blotting to verify the interaction between HADC8 protein and MRE11 protein after radiation-induced DNA damage in HeLa cells, and Vector is the empty vector control group; E is the result of ATM protein affecting HADC8 protein phosphorylation after radiation-induced DNA damage in HeLa cells; F is the result of increased crotonylation of MRE11 protein after HADC8 S83 site mutation; G is the result of HADC8 S83 site mutation, radiation-induced DNA damage in HeLa cells, decreased phosphorylation level of HADC8 protein and weakened interaction with MRE11 protein; I is the result of increased crotonylation of MRE11 protein after HADC8 S83 site mutation, radiation-induced DNA damage in HeLa cells.

[0053] Western bloting detection steps are as follows:

[0054] (1) The cells were added to RIPA lysis buffer (Beijing Solebold Technology Co., Ltd.), which contained 1× PMSF (Soliebold) and 1× protease and phosphatase inhibitors (CST, USA), placed on ice for 30 min, centrifuged at 12,000 g for 20 min at 4°C, and the supernatant was transferred to a new 1.5 ml EP tube.

[0055] (2) The total protein concentration was determined by BCA method (Thermo Fisher, USA).

[0056] (3) IP experiment: extract protein lysate and mix with 10 μL of flag-tagged magnetic beads at 4°C on a shaker for 6 h. Magnetic separation and precipitation of target protein. Wash the magnetic beads or agarose beads with washing buffer. Use elution buffer to elute the target protein from the magnetic beads or agarose beads.

[0057] (4) 12% SDS-PAGE electrophoresis.

[0058] (5) Transfer the proteins in PAGE to PVDF membrane (Millipore, USA).

[0059] (6) Immunoblocking: use 5% skim milk to block for 2 h.

[0060] (7) Primary antibody incubation: the dilution ratio of anti-GAPDH antibody, anti-MRE11 antibody, anti-HDAC8 antibody, anti-flag antibody, anti-anti-phodpho-ser / thrphe antibody (Abcam, catalog number: ab17464), anti-Kcr antibody, and anti-myc antibody was 1:1000. The cells were incubated at 4°C overnight and washed three times with TBST for 10 min each time.

[0061] (8) Secondary antibody incubation: goat anti-rabbit IgG-HRP (Biyuntian Biotechnology Co., Ltd., 1:2000), incubate at room temperature for 2 h, and wash three times with TBST, each time for 10 min.

[0062] (9) Exposure: Mix the display solution (Millipore, USA) in a 1:1 ratio and evenly drip it onto the strip for exposure and color development.

[0063] 6. GST-pull down experiment

[0064] (1) Irradiated and non-irradiated cells were collected and lysed with NETN lysis buffer by ultrasonication;

[0065] (2) Take 2 mg of protein supernatant, add 2 μg of purified protein-beads complex, rotate at 4°C for 4 h, centrifuge to collect magnetic beads, and wash three times with NETN;

[0066] (3) Western Blotting to identify the binding between proteins. The Western Blotting steps are as in step 5, and the detection results are as follows: Figure 1 As shown in B, C and H. Among them, B and C are the results of GST pull down to verify the interaction between HADC8 protein and DNA MRE11 protein after radiation-induced DNA damage in HeLa cells; H is GST pull down to verify that phosphorylated HADC8 protein can interact with MRE11 protein.

[0067] according to Figure 1 It can be seen that HDAC8 interacts with MRE11, and the interaction between the two increases after irradiation ( Figure 1 A~C). Add Olaparib reagent and KU-55933 reagent, Co 60 After 4Gy of radiation induced DNA damage in HeLa cells, the interaction between HADC8 protein and MRE11 protein decreased ( Figure 1 D), and the phosphorylation level of HADC8 was also reduced ( Figure 1 Middle E), after HADC8 S83 site mutation, MRE11 protein crotonylation increased ( Figure 1Middle F), after HADC8 S83 site mutation, radiation induced DNA damage in HeLa cells, the phosphorylation level of HADC8 protein decreased and the interaction with MRE11 protein weakened ( Figure 1 Middle G), after HADC8 S83 site mutation, radiation-induced DNA damage in HeLa cells, and increased crotonylation of MRE11 protein ( Figure 1 Middle I).

[0068] Example 2

[0069] The specific steps of immunofluorescence experiment are as follows:

[0070] ①Fixed: Co 60 After HeLa cells were irradiated with 4 Gy of radiation for 1, 2, 4, and 8 h, the cell supernatant was discarded, the cells were washed twice with PBS, and then fixed with 3% paraformaldehyde at room temperature for 15 min.

[0071] ② Membrane permeabilization: discard paraformaldehyde, wash 3 times with PBS, and treat the cells with 0.5% Triton-100 at room temperature for 5 minutes to permeabilize the cell membrane.

[0072] ③ Blocking: Aspirate and discard Triton-100, wash three times with PBS, and block the cells with 10% fetal bovine serum (Sigma) at room temperature for 1 hour.

[0073] ④ Primary antibody incubation: Aspirate and discard fetal bovine serum, and incubate the cells with anti-γH2AX antibody, anti-MRE11 antibody, anti-RPA2 antibody, and anti-RAD51 antibody (all at a dilution ratio of 1:200) at room temperature for 1 h.

[0074] ⑤ Secondary antibody incubation: Aspirate and discard the primary antibody, wash three times with PBS, and incubate the cells with goat anti-rabbit and goat anti-mouse fluorescent secondary antibodies (1:200 dilution, Jackson's Lab) at room temperature for 1 hour.

[0075] ⑥ Sealing: Aspirate and discard the secondary antibody, wash three times with PBS, and place the coverslip with cells on the slide with the sealing agent.

[0076] ⑥Photographing: Observe the above samples under a laser confocal microscope with an oil lens at 100× and take photos. Figure 2A to F, A is the foci results of DNA damage marker protein γH2AX at different time points (1h, 2h, 4h, 8h, 12h) after radiation-induced DNA damage in normal HeLa cells and HDAC8 S83 mutant HELA cells; B is the statistical result of the foci results of γH2AX, and the statistical method is Student's st-test; C is the co-localization result of MRE11 protein and γH2AX protein after radiation-induced DNA damage in normal HeLa cells and HDAC8 S83 mutant HELA cells; D is the statistical result of the co-localization of MRE11 protein and γH2AX protein, and the statistical method is Student's st-test; E is the result of HR / NHEJ repair efficiency; F is the co-localization result of RPA2 protein and γH2AX protein after radiation-induced DNA damage in normal HeLa cells and HDAC8 S83 mutant HELA cells.

[0077] Immunofluorescence experiments showed that after ionizing radiation induced DNA damage in HeLa cells, the γH2AX foci in the HDAC8 S83A mutant cell line were significantly higher than those in the wild-type cell line ( Figure 2 In A and B), the co-localization of MRE11 and γH2AX in HDAC8 S83A mutant cell lines was significantly less than that in wild-type cell lines ( Figure 2 C and D in the figure); at the same time, the mutation of HDAC8 S83A site reduces the efficiency of HR repair pathway and increases the efficiency of NHEJ repair pathway; the co-localization of RPA2 and γH2AX in HDAC8 S83A mutant cell lines is significantly less than that in wild-type cell lines ( Figure 2 F), the co-localization of RAD51 and γH2AX in HDAC8S83A mutant cell lines is significantly less than that in wild-type cell lines ( Figure 2 Middle G). Mutation of the HDAC8 S83A site affects the phosphorylation of RPA2 and CHK1 ( Figure 2 Middle H)

[0078] Example 3

[0079] The pcDNA3.1-FLAG-HDAC8 WT (wild type) plasmid or pcDNA3.1-FLAG-HFAC8 S83A (serine (S) at position 83 mutated to alanine (A)) plasmid was stably expressed in wild type cervical cancer cells HeLa to obtain mutant cell lines (HDAC8 S83A) and wild type cell lines (HDAC8 WT). The effects of different doses of ionizing radiation treatment on cell survival in mutant cell lines and wild type cell lines were detected by clone formation experiment. The specific steps are as follows:

[0080] 1. Treatment method

[0081] The mutant cell lines and wild-type cell lines were plated in 60 mm culture dishes according to the following requirements, and 4 ml of fresh culture medium was added: 0 Gy 200 cells; 1 Gy 200 cells; 2 Gy 400 cells; 4 Gy 1000 cells; 8 Gy 2000 cells. After the cells attached to the wall (about 6 hours), the above cells were subjected to 0 Gy, 1 Gy, 2 Gy, 4 Gy, and 8 Gy of Co 60 Ionizing radiation.

[0082] After the cells were cultured for 15 days, the supernatant was discarded, the cells were washed twice with PBS, fixed with methanol for 30 minutes, and then stained with Giemsa for 1 hour, and the cell clones were counted and statistically analyzed.

[0083] 2. Statistical methods: SPSS statistics version 19 was used to perform statistics, including:

[0084] (1) Student's t-test was used to compare the means of the two groups; (2) Kaplan-Meier analysis was used to calculate the overall survival (OS), and the log-rank test was used to compare the OS of the two groups.

[0085] The cell survival results of mutant cell lines and wild-type cell lines are shown in Figure 2 I. Under the treatment conditions of ionizing radiation doses of 2Gy, 4Gy, and 8Gy, the cell survival rate of the mutant cell line was significantly lower than that of the wild-type cell line.

[0086] Example 4

[0087] Using the cell line constructed in Example 3, a clone formation experiment was performed to detect the effect of different doses of Olaparib on cell survival in mutant cell lines and wild-type cell lines. The method was similar to that in Example 3, except that after the cells adhered (approximately 6 h), the ionizing radiation treatment was replaced by adding Olaparib at final concentrations of 0 μM, 0.5 μM, 1 μM, 2 μM, and 4 μM to the above cells, respectively.

[0088] The cell survival results of mutant cell lines and wild-type cell lines are shown in Figure 2 J. Under the treatment conditions of Olaparib at 1μM, 2μM, and 4μM, the cell survival rate of the mutant cell line was significantly lower than that of the wild-type cell line.

[0089] Example 5

[0090] Nude mouse tumorigenesis experiment

[0091] 1. Preparation of Cell Suspension

[0092] (1) The wild-type human HeLa cell line and the HDAC8 S83 mutant HeLa cell line were cultured in DMEM medium containing 20% ​​fetal bovine serum, 100 U / ml penicillin, and 100 μg / ml streptomycin in a cell culture incubator at 37° C. and 5% CO 2 .

[0093] (2) Digest the cells that have grown to 80% to 90% of the culture dish with trypsin, centrifuge at 3000 rpm, remove the supernatant, add PBS to wash the cells, resuspend them in PBS again, count the cells, and adjust the number to 2×10 6 cells / ml.

[0094] 2. Establishment of nude mouse subcutaneous tumor model

[0095] The injection site was uniformly set at 0.3 cm from the axilla of the right forelimb of nude mice. After disinfection with iodine cotton balls, a 1 ml syringe was used to extract the mixed cell suspension (density 2×10 6 / ml)0.2ml, after the syringe needle pierces the skin of the nude mouse, slightly lift the needle, move it to the injection site, and slowly inject the cell suspension.

[0096] 3. Grouping and drug intervention

[0097] When the nude mice developed small nodules (about the 7th day after inoculation), the Co 60 Ionizing irradiation, Olaparib group (Olaparib) intraperitoneal injection of Olaparib (2mg / kg). IR+Olaparib group 60 Ionizing radiation and parenteral drug treatment.

[0098] 4. Detection indicators

[0099] (1) Tumor measurement: After the tumor is visible to the naked eye, the short diameter (W) and long diameter (L) of the transplanted tumor are measured with a vernier caliper and the formula V (cm 3 )=L×W 2 / 2The tumor volume was calculated and the tumor size was measured twice a week.

[0100] (2) Final sampling: Six weeks after nude mice were implanted with tumors, tumor tissues were collected and the tumor volume was calculated. Then, the tumors were fixed and preserved with 4% paraformaldehyde. The results showed that the tumor size of the mutant cell line was significantly smaller than that of the wild type ( Figure 2 (middle K~L).

[0101] In summary, HDAC8 is phosphorylated by ATM after DNA damage, affecting MRE11 crotonylation and HR repair. The HDAC8 S83A cell line weakened the cell survival rate of tumor cells after ionizing radiation treatment and enhanced the inhibitory effect of Olaparib on tumor proliferation activity. Therefore, inhibiting ATM protein-mediated HDAC8 protein phosphorylation can increase the radiotherapy and chemotherapy sensitivity of tumor cells. Therefore, ATM protein and HDAC8 protein are potential new targets for tumor treatment by DNA damage radiotherapy and chemotherapy.

[0102] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. Use of a reagent that reduces the phosphorylation level of the S83 site of the HDAC8 protein in the preparation of a product for improving the sensitivity of tumor cells to chemotherapy and / or radiotherapy, wherein the S83 site of the HDAC8 protein is the 83rd amino acid residue of the HDAC8 protein.

2. The use according to claim 1, characterized in that: The reagents for reducing the phosphorylation level of the HDAC8 protein S83 site include: gene editing reagents and / or ATM protein kinase inhibitors for reducing the phosphorylation level of the HDAC8 protein S83 site.

3. The use according to claim 2, characterized in that: The gene editing reagent that reduces the phosphorylation level of the S83 site of the HDAC8 protein includes: a gene editing reagent that mutates the 83rd serine of the HDAC8 protein into alanine.

4. The use according to claim 3, characterized in that: The gene editing reagent that mutates the 83rd serine of the HDAC8 protein to alanine includes sgRNA; the sgRNA consists of sgRNA-F and sgRNA-R; the nucleotide sequence of the sgRNA-F is shown in SEQ ID NO.1, and the nucleotide sequence of the sgRNA-R is shown in SEQ ID NO.

2.

5. The use according to claim 1, characterized in that: The tumor includes cervical cancer.

6. The use according to claim 1, characterized in that: The improving the sensitivity of tumor cells to chemotherapy and / or radiotherapy includes improving the sensitivity of tumor cells to chemotherapy and / or radiotherapy drugs.

7. The use according to claim 6, characterized in that: The chemotherapy drugs include olaparib.

8. The use according to claim 1, characterized in that: The radiation source of the radiotherapy includes Co 60 ray.

9. The use according to claim 1 or 8, characterized in that: The ionizing radiation dose of the radiotherapy is ≥2Gy.

10. The use according to claim 1, characterized in that: The reagent for reducing the phosphorylation level of HDAC8 protein increases the crotonylation of MRE11 protein, reduces the interaction between HADC8 protein and MRE11 protein, inhibits HR repair, and increases the sensitivity of tumor cells to chemotherapy and / or radiotherapy.

Images